miRTarBase - #MIRT133334 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BCL7A   
Synonyms BCL7
Description BCL tumor suppressor 7A
Transcript NM_001024808   
Other Transcripts NM_020993   
Expression
Putative miRNA Targets on BCL7A
3'UTR of BCL7A
(miRNA target sites are highlighted)
>BCL7A|NM_001024808|3'UTR
   1 ACGATGCTTTAAAGCCTCCGATCCATGTTCCATGGAAGGTACATCAGCAATTAATTCTAGAGCAACTTTGCCCCAGCGAT
  81 TCCTCTTGGGTGCGAACAGAACTACTAACGTTTCAAGTTTACCAAGTGCAAATCCAAGAAGACCCAGAACGGCGTCACTT
 161 CTCAGACACTGAAGAACTCTGCTGTGAAGCAAAACACTCAAACCTTTAAGGGACTGTCCTTGGGGAGGCAGGCGGGGCTG
 241 ACAGCTCAGGAGTGTCTGCACACTGTCTCGGAAGCCAGGATTCCATTTGTGTTGCTGCTGTATTTTCCCCCCACTTCTCT
 321 ATGTAACGATATAAGCTATCGGAGGGTGGTACCGATCAGGAACGCTTTTTGGCGGGGCTTTCCACTGTTCAACCGATTCC
 401 TTCCGCTTTCTTTTTTTGTGCCTTGTGCCCTTGAGGTGACCTCTGGCATGTATCCTGGTGGTTCTTACATCCCCCTCTGC
 481 AAAGTGCCCTCTTGGTTTGGTTCGGGCGGCGGCTGCCACCCTACTCACCGCTCTCCTCCCTGCCCCAGGACTTCATCGGA
 561 GCAGGCAGGGTGGAGCGAAGGAGCTCCTTAGCCCACCTGGTTTGCAGGTGCAGGGGGACCTTAGGCACGCCCCAAGCACC
 641 AGGCACCAGGGCCCAAGGACGCGCAGGTGTTGGGGCACAGTCCCCAAGGGCTCGGCCCCTTGGATCAGGCTGGGCACTCG
 721 CTGTGCTCTCCCCTCCTTGGGGCGTTTAGGACTGGGCGTCTCCAAGCCCACCATGGCCCAGATGGACGTGCAAAGCCCTT
 801 GGAATTTTCTGGCACTTCCTCTCTATTGCCCCCACCACCACCACCCCCATCACTGCTTTCTCCCAGACCTCCGAATACGA
 881 AATGGCTTCTCTGGCTGACTGCAAGGCTGTCTCCTTAAGGCACTGAGTGGGCCGGGGAGGCTGGGAGCCGGCGGCAGGAT
 961 TAGCTGGTGCTGAACTTTCTCTCATAGGACGTCGCTTGGATTTCAAATCCACGGTCACCTGCTGCCCTTTGCCTCCCCCG
1041 ACGCCCCAGCCTGTGCCCCGGAGAGGCAGGATCGCAGTGGTCAGAATCCACGTGCTTTCCTATTCTCAGGCTGTTCTGAC
1121 TCTGAGCCAACAGCTGGACCGTGTCTCATCCCCAGAACATGCCGTCTGTCCCCACCGGGGAGTGGGCCTTGATGGCCGGG
1201 CCTCGAAGGCCACAAACAAGGCGTCGAGGAATTGGAAAGATTTGCACACCCTCCAGAAAGGAGAGACGCAATCTCCCCTC
1281 CCTCCCATCCCCCACCTTCGCTGGAACAGCTTCCTCTCACTGAACGGAGACGCCCCCTTGGACGAACTGCCTAATCGTTT
1361 GGTTCTGAGGCCTGGTTTGCTCTTAATTAATATATGAACTCCTCAGACCTTAAACCTTTTCCTAAGCTTTCTTTACTGCA
1441 CTGGAGTTCTGACTCCCTTTGAGTTGTGTGTTACTGGGGGTGGGGTGGGGTCATGGGTTTTGTTGTTTTTGGGGGCTAAT
1521 TGGTGCATATTCAGGTACCACCTTTGACGTGTGGCTCTTTCTCCTGACCATCATGGGAAGTGTCTGCTGGATTCCATTTT
1601 CTAAGAGTTTCTGAGGGTGAGGCTCTTATTTTTTTTTTTAAGGGATCCTGTCTATTTCCTGCACTTCGAGAAGAATCAAA
1681 ATGTTCCTGAATTTCAAATACCTCATGCAAAATGTCTCCTGAAATAAGGGAAAAAAAAAAAACCACAACTTTGAAAATCT
1761 TAATGTTGAAGTTAGCAATGCCGAAAGGTTTCTGTCTTAAAAAAAAAAATCCTTGTACTTATCAATTTTGCCCCTTAGGC
1841 AGTCAGTTTTGTTGAGAACTGTGTCCTGCATCCTGGCGCAGAACCTACCTGATGCGGTTCCTCTCCACGCATCTCGAGGC
1921 GGCGTTACCTCCAGATTCCGTAGAGTTAGAGTCACATTTTTCTTTGCAGCGAAACTCCATCTTGGTGAGAGATGAATTTG
2001 GATATTTATTTCCTTCTCTGTTTTTGGGAAACGAGAGGCTACAACCAAGACAGCTGAAGGAGAATGAAACACACACATCC
2081 ACAGAAACAGAGAGGCGTAGGTGGCCCTGCCGTTGACCGCAGCCTCTCTGGACAGGCAAGGGGAGTTGGCGCAGGTGAGG
2161 ACTCAGACGACGTCCACCGTCCCAAGGCTGTCACTAGTATTTCTCTGAAGTGCCTGAAGGTAGGAATGGGCCGGCGATTG
2241 GGACCAGCTGGGCCCCACCACGGCCACGCCAGGCAAAGCGCCAGCAGCCCTGCACTCCACGCTGGCCAAGAAGGCCTTCC
2321 ACGCAGAATGACAAGACTGCAAAAATCCGATGTGCTTCCTTCCCTGGCGCAGTCGCTCCTCGAGCCGCTGCCCCCCACCC
2401 ACCCTGCACCCCTCGCCCTCCCCCCACCACAGAATCTAAGACCTTTCAGCTTCGAGCCAGGGGGCGGGGGATCCCGAGCA
2481 AAAGCCTTCCGTGGACATCAGGCCCCGTGGCCTCAAGGGCTCCCAGGGCAAACCTAATTCCCCCCAAAACGTGAAGTCGG
2561 GGAAGCTGCGGCTACACATTCCACAAAGTGCTGGCACTTACACCCACAACCCGGAAGGCTGTGGACCGATTCCTCTAGGG
2641 TGGTGACCTCCCATTAGCAAACGGTGTCATGGTTTGGAATGTTCATTATCGCCAAGAACCTGGTTAGAGGCATAAAGACC
2721 TTTTTTCACCGTTACCTAATTTTTTCCCCTTTCAAGAATTTTTTTTTTTTTTGGTGTGTTGTACAGCAGTATAATTTTTC
2801 ACTTATTTATTCCATCAGTAGATATGGTTTGTACAATGTACAATTGTTTCATTTCAGAAAATAAAAATTTCAAATCATGA
2881 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGU-AAUAC-ACGACGAu 5'
                ||| ||:|| ||||||| 
Target 5' aggattCCATTTGTGTTGCTGCTg 3'
277 - 300 160.00 -18.30
2
miRNA  3' guGUUU-GGU---AAUACACGACGau 5'
            |||| |||   | |  ||||||  
Target 5' ttCAAATCCACGGTCACCTGCTGCcc 3'
1002 - 1027 136.00 -11.30
3
miRNA  3' guGUUUGGUAAUA-----CAC-GACGAu 5'
            | :||||| ||     ||| ||||| 
Target 5' tcCTGACCATCATGGGAAGTGTCTGCTg 3'
1562 - 1589 132.00 -13.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30500251 3 COSMIC
COSN30158254 17 COSMIC
COSN30465889 21 COSMIC
COSN30496907 23 COSMIC
COSN26967785 24 COSMIC
COSN31554217 76 COSMIC
COSN27694641 198 COSMIC
COSN20046861 213 COSMIC
COSN19408203 235 COSMIC
COSN25091332 613 COSMIC
COSN31769742 654 COSMIC
COSN31488756 822 COSMIC
COSN26678078 926 COSMIC
COSN28727499 934 COSMIC
COSN8698391 988 COSMIC
COSN7610076 1041 COSMIC
COSN31591028 1093 COSMIC
COSN10099561 1198 COSMIC
COSN31769743 1218 COSMIC
COSN30539781 1281 COSMIC
COSN8585496 1483 COSMIC
COSN31522054 1640 COSMIC
COSN26573757 1656 COSMIC
COSN26572526 1732 COSMIC
COSN31487299 1784 COSMIC
COSN31546405 1827 COSMIC
COSN27667097 2080 COSMIC
COSN31489549 2490 COSMIC
COSN31769745 2711 COSMIC
COSN31523256 2719 COSMIC
COSN31769746 2721 COSMIC
COSN26648228 2731 COSMIC
COSN30173434 2754 COSMIC
COSN19661208 2765 COSMIC
COSN20110255 2773 COSMIC
COSN22590304 2814 COSMIC
rs28384349 934 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs550091216 3 dbSNP
rs755848366 4 dbSNP
rs562062691 5 dbSNP
rs1455155770 8 dbSNP
rs529033756 9 dbSNP
rs368258721 15 dbSNP
rs774282210 20 dbSNP
rs372266845 21 dbSNP
rs1183156847 27 dbSNP
rs772036219 32 dbSNP
rs773380784 33 dbSNP
rs945994998 34 dbSNP
rs1309781929 36 dbSNP
rs1051485416 40 dbSNP
rs760785150 41 dbSNP
rs1373498450 42 dbSNP
rs777093755 44 dbSNP
rs373993754 48 dbSNP
rs765756172 50 dbSNP
rs959511538 58 dbSNP
rs1278949390 63 dbSNP
rs564084558 66 dbSNP
rs1378937206 69 dbSNP
rs773315385 70 dbSNP
rs1342722403 78 dbSNP
rs918098606 79 dbSNP
rs763719414 83 dbSNP
rs191030948 86 dbSNP
rs532821694 87 dbSNP
rs951666204 91 dbSNP
rs1250154384 94 dbSNP
rs907538282 95 dbSNP
rs1183253195 99 dbSNP
rs1442085808 100 dbSNP
rs773170697 100 dbSNP
rs566007663 101 dbSNP
rs771142155 106 dbSNP
rs774375307 117 dbSNP
rs1213895048 118 dbSNP
rs1446583093 123 dbSNP
rs1283302021 124 dbSNP
rs1240554283 126 dbSNP
rs992421020 144 dbSNP
rs1025673311 148 dbSNP
rs1037563092 151 dbSNP
rs900403666 152 dbSNP
rs1367687311 155 dbSNP
rs1477307373 185 dbSNP
rs1169192962 193 dbSNP
rs1428227265 202 dbSNP
rs539569491 204 dbSNP
rs1344167571 205 dbSNP
rs1390239321 212 dbSNP
rs1421850408 218 dbSNP
rs1374219133 221 dbSNP
rs1454811052 224 dbSNP
rs879422015 234 dbSNP
rs980190310 235 dbSNP
rs1475227564 236 dbSNP
rs1052000409 237 dbSNP
rs759570962 238 dbSNP
rs1242867198 239 dbSNP
rs879517274 243 dbSNP
rs890299253 248 dbSNP
rs1008726933 252 dbSNP
rs927024284 255 dbSNP
rs1489130324 265 dbSNP
rs1021073050 270 dbSNP
rs966690634 271 dbSNP
rs1210055895 272 dbSNP
rs935757371 279 dbSNP
rs1302768330 283 dbSNP
rs1387155751 284 dbSNP
rs1360860410 290 dbSNP
rs1322600044 291 dbSNP
rs1000893801 292 dbSNP
rs1402321599 300 dbSNP
rs1353941369 303 dbSNP
rs1329314953 304 dbSNP
rs1032364187 306 dbSNP
rs959576850 307 dbSNP
rs1361368731 308 dbSNP
rs1168455445 311 dbSNP
rs913057044 313 dbSNP
rs78067163 315 dbSNP
rs918074560 322 dbSNP
rs569702350 323 dbSNP
rs537091593 328 dbSNP
rs1186872273 329 dbSNP
rs1483553509 338 dbSNP
rs1257635563 339 dbSNP
rs1358680208 341 dbSNP
rs1210847152 342 dbSNP
rs983593435 354 dbSNP
rs767382611 355 dbSNP
rs761501744 356 dbSNP
rs1220106448 357 dbSNP
rs1450451704 359 dbSNP
rs1353112078 364 dbSNP
rs941801973 365 dbSNP
rs1396927956 368 dbSNP
rs775190078 374 dbSNP
rs898542319 375 dbSNP
rs995598128 377 dbSNP
rs1401106268 382 dbSNP
rs1249116743 387 dbSNP
rs921613083 395 dbSNP
rs749038387 396 dbSNP
rs1025773923 401 dbSNP
rs1163829733 404 dbSNP
rs1051725778 405 dbSNP
rs1175403971 406 dbSNP
rs1258265296 406 dbSNP
rs1480237241 411 dbSNP
rs890278794 412 dbSNP
rs1199939999 422 dbSNP
rs1332253677 423 dbSNP
rs1186064155 429 dbSNP
rs945932781 438 dbSNP
rs1042479475 458 dbSNP
rs1246036880 460 dbSNP
rs1014201242 462 dbSNP
rs902579002 466 dbSNP
rs1223725878 469 dbSNP
rs1378209290 475 dbSNP
rs1333478741 476 dbSNP
rs760353756 480 dbSNP
rs965265863 500 dbSNP
rs1025197129 502 dbSNP
rs970064126 504 dbSNP
rs1032303685 505 dbSNP
rs376855615 508 dbSNP
rs555735343 509 dbSNP
rs763712452 511 dbSNP
rs1012903250 512 dbSNP
rs73417628 517 dbSNP
rs1466726333 519 dbSNP
rs1266317340 521 dbSNP
rs913004679 524 dbSNP
rs971286105 527 dbSNP
rs1489224099 529 dbSNP
rs983614090 530 dbSNP
rs1015058409 531 dbSNP
rs963063336 534 dbSNP
rs1370324067 536 dbSNP
rs1295448403 537 dbSNP
rs1464421842 541 dbSNP
rs1302005024 545 dbSNP
rs534870769 555 dbSNP
rs973130883 558 dbSNP
rs1265292553 559 dbSNP
rs942614487 565 dbSNP
rs921600990 566 dbSNP
rs1452090935 574 dbSNP
rs1376586839 575 dbSNP
rs931701579 576 dbSNP
rs987781672 577 dbSNP
rs1434575733 578 dbSNP
rs1216399188 579 dbSNP
rs1259167151 579 dbSNP
rs1210905972 580 dbSNP
rs1288860920 583 dbSNP
rs1209374934 584 dbSNP
rs1039692610 593 dbSNP
rs1256700431 596 dbSNP
rs911839593 599 dbSNP
rs1324956150 600 dbSNP
rs1464807419 604 dbSNP
rs1206324021 611 dbSNP
rs945974982 616 dbSNP
rs1041545574 621 dbSNP
rs904358665 622 dbSNP
rs549726325 623 dbSNP
rs887204685 628 dbSNP
rs756689190 629 dbSNP
rs1053905005 630 dbSNP
rs1366286110 631 dbSNP
rs183516966 638 dbSNP
rs1473458240 641 dbSNP
rs1047005779 643 dbSNP
rs1192472046 646 dbSNP
rs905412071 661 dbSNP
rs1265803449 663 dbSNP
rs1387857870 663 dbSNP
rs554644175 664 dbSNP
rs545899269 665 dbSNP
rs1012272664 666 dbSNP
rs1287247078 666 dbSNP
rs1404435293 674 dbSNP
rs1025413473 677 dbSNP
rs1279926300 679 dbSNP
rs957015748 683 dbSNP
rs146922318 689 dbSNP
rs1257733320 694 dbSNP
rs569693712 695 dbSNP
rs1020001636 697 dbSNP
rs576105361 708 dbSNP
rs963553433 720 dbSNP
rs1329127729 721 dbSNP
rs973119512 729 dbSNP
rs1028728996 732 dbSNP
rs1397334185 735 dbSNP
rs1207376626 739 dbSNP
rs976679428 741 dbSNP
rs543410567 743 dbSNP
rs1465847843 744 dbSNP
rs74495539 745 dbSNP
rs963907513 746 dbSNP
rs575986884 749 dbSNP
rs919870946 751 dbSNP
rs540843703 757 dbSNP
rs755507536 758 dbSNP
rs1237643010 759 dbSNP
rs1047113741 769 dbSNP
rs977373536 770 dbSNP
rs1459276273 774 dbSNP
rs1483811448 778 dbSNP
rs1271482435 782 dbSNP
rs781585867 788 dbSNP
rs949510271 789 dbSNP
rs1246910615 791 dbSNP
rs1046512028 797 dbSNP
rs76338977 801 dbSNP
rs1178141778 802 dbSNP
rs1446860296 807 dbSNP
rs532998003 816 dbSNP
rs1402073365 819 dbSNP
rs1323475099 822 dbSNP
rs1405202742 824 dbSNP
rs1414997135 829 dbSNP
rs1002349230 832 dbSNP
rs535494903 835 dbSNP
rs1380172071 836 dbSNP
rs551456625 837 dbSNP
rs1179390645 838 dbSNP
rs1459118508 846 dbSNP
rs1251436720 849 dbSNP
rs1053849673 852 dbSNP
rs916646062 857 dbSNP
rs1452341920 859 dbSNP
rs73217770 863 dbSNP
rs1373913787 865 dbSNP
rs1351488209 867 dbSNP
rs1011171711 873 dbSNP
rs1309083028 874 dbSNP
rs1046358149 879 dbSNP
rs758401094 880 dbSNP
rs967119095 896 dbSNP
rs1008384675 902 dbSNP
rs1019398727 903 dbSNP
rs1005090182 904 dbSNP
rs115452244 907 dbSNP
rs975257688 908 dbSNP
rs1159774621 912 dbSNP
rs1441682674 922 dbSNP
rs1393359485 926 dbSNP
rs139372923 933 dbSNP
rs28384349 934 dbSNP
rs535304180 935 dbSNP
rs1487184030 937 dbSNP
rs1285294294 945 dbSNP
rs1029596567 950 dbSNP
rs1481956262 951 dbSNP
rs953130288 953 dbSNP
rs949455149 954 dbSNP
rs1367924986 955 dbSNP
rs1009073603 960 dbSNP
rs1018607761 968 dbSNP
rs967068655 970 dbSNP
rs938151414 976 dbSNP
rs977321361 977 dbSNP
rs1432494435 980 dbSNP
rs1357885489 984 dbSNP
rs1175516750 985 dbSNP
rs553424549 986 dbSNP
rs1427614209 991 dbSNP
rs1393330516 992 dbSNP
rs925881933 994 dbSNP
rs945639382 997 dbSNP
rs571859736 1010 dbSNP
rs1042679241 1013 dbSNP
rs1007922912 1014 dbSNP
rs1235642220 1019 dbSNP
rs957292026 1022 dbSNP
rs371459575 1025 dbSNP
rs1370127251 1034 dbSNP
rs539286454 1040 dbSNP
rs991292126 1041 dbSNP
rs915736671 1044 dbSNP
rs1019754030 1050 dbSNP
rs1279265359 1052 dbSNP
rs1295616685 1053 dbSNP
rs948123274 1060 dbSNP
rs557840762 1061 dbSNP
rs1046957414 1074 dbSNP
rs1448922652 1075 dbSNP
rs927980524 1078 dbSNP
rs940725204 1092 dbSNP
rs1465331960 1101 dbSNP
rs1036554688 1103 dbSNP
rs899402972 1104 dbSNP
rs1171186082 1109 dbSNP
rs1478662283 1114 dbSNP
rs576214969 1117 dbSNP
rs1273489225 1120 dbSNP
rs1339586268 1125 dbSNP
rs1181192584 1128 dbSNP
rs1223545691 1132 dbSNP
rs996645007 1134 dbSNP
rs1026828896 1136 dbSNP
rs995065631 1138 dbSNP
rs952559859 1143 dbSNP
rs1196163239 1144 dbSNP
rs1457082723 1148 dbSNP
rs1488148766 1151 dbSNP
rs1050584668 1152 dbSNP
rs1189396967 1153 dbSNP
rs371732893 1154 dbSNP
rs749537838 1156 dbSNP
rs1015537904 1160 dbSNP
rs771088747 1165 dbSNP
rs1381924812 1171 dbSNP
rs543018615 1177 dbSNP
rs1446099905 1178 dbSNP
rs1401351120 1182 dbSNP
rs143294306 1184 dbSNP
rs112110801 1188 dbSNP
rs982145747 1190 dbSNP
rs926684862 1191 dbSNP
rs1424357489 1192 dbSNP
rs938099029 1199 dbSNP
rs989573040 1205 dbSNP
rs1408399963 1206 dbSNP
rs915403639 1214 dbSNP
rs998496004 1222 dbSNP
rs150887242 1223 dbSNP
rs1222713907 1224 dbSNP
rs374749184 1226 dbSNP
rs368882723 1227 dbSNP
rs1377726209 1229 dbSNP
rs943677763 1240 dbSNP
rs1385309858 1241 dbSNP
rs541306226 1250 dbSNP
rs991816874 1252 dbSNP
rs1339945942 1255 dbSNP
rs372159087 1264 dbSNP
rs971672335 1268 dbSNP
rs186688993 1269 dbSNP
rs899547794 1271 dbSNP
rs982206226 1272 dbSNP
rs1380381443 1276 dbSNP
rs544810837 1285 dbSNP
rs1026773614 1291 dbSNP
rs1266205781 1292 dbSNP
rs775343183 1294 dbSNP
rs760453101 1300 dbSNP
rs1015899337 1301 dbSNP
rs1313243316 1302 dbSNP
rs563406030 1314 dbSNP
rs1003916335 1315 dbSNP
rs1330790121 1316 dbSNP
rs1302241659 1322 dbSNP
rs1387194014 1325 dbSNP
rs1320897591 1326 dbSNP
rs542656302 1327 dbSNP
rs373987932 1332 dbSNP
rs201238409 1333 dbSNP
rs959400710 1334 dbSNP
rs989521163 1336 dbSNP
rs1051158061 1341 dbSNP
rs1176313943 1344 dbSNP
rs375188348 1345 dbSNP
rs1209488734 1352 dbSNP
rs549237260 1353 dbSNP
rs944890419 1354 dbSNP
rs1474584717 1356 dbSNP
rs767580873 1357 dbSNP
rs117795225 1358 dbSNP
rs1256604255 1366 dbSNP
rs28718387 1383 dbSNP
rs1423615596 1385 dbSNP
rs1163171612 1386 dbSNP
rs528517492 1388 dbSNP
rs763953287 1393 dbSNP
rs879908103 1394 dbSNP
rs1276100946 1407 dbSNP
rs1458208362 1414 dbSNP
rs1341099956 1421 dbSNP
rs776088029 1427 dbSNP
rs1320200372 1438 dbSNP
rs1393847591 1440 dbSNP
rs1400884949 1443 dbSNP
rs1302846777 1448 dbSNP
rs1319368645 1455 dbSNP
rs1420959149 1456 dbSNP
rs1039335449 1457 dbSNP
rs920926944 1467 dbSNP
rs1375347642 1469 dbSNP
rs1186067773 1482 dbSNP
rs1442283627 1485 dbSNP
rs1256995562 1494 dbSNP
rs932326360 1496 dbSNP
rs1048156982 1497 dbSNP
rs1257631608 1504 dbSNP
rs1217851949 1510 dbSNP
rs547269596 1511 dbSNP
rs1303081576 1512 dbSNP
rs1339764702 1516 dbSNP
rs1312837237 1521 dbSNP
rs888218027 1526 dbSNP
rs1004432348 1527 dbSNP
rs1330254032 1530 dbSNP
rs149602283 1539 dbSNP
rs1289954299 1546 dbSNP
rs144290994 1549 dbSNP
rs1399087554 1550 dbSNP
rs906409877 1551 dbSNP
rs1472773298 1558 dbSNP
rs1227699315 1564 dbSNP
rs1283737585 1569 dbSNP
rs1437903650 1573 dbSNP
rs1237863173 1576 dbSNP
rs1199519384 1601 dbSNP
rs1439705680 1602 dbSNP
rs1274889329 1608 dbSNP
rs1207793991 1612 dbSNP
rs1355614640 1618 dbSNP
rs1247618139 1629 dbSNP
rs1374037257 1629 dbSNP
rs532538752 1629 dbSNP
rs57981128 1629 dbSNP
rs1307812091 1633 dbSNP
rs1445362532 1640 dbSNP
rs761474962 1641 dbSNP
rs1447104329 1646 dbSNP
rs1238297162 1655 dbSNP
rs1337112730 1661 dbSNP
rs1483028086 1664 dbSNP
rs1322046968 1665 dbSNP
rs764684471 1668 dbSNP
rs1186313000 1669 dbSNP
rs1414632625 1674 dbSNP
rs1379766717 1677 dbSNP
rs1473242973 1680 dbSNP
rs1003456044 1687 dbSNP
rs1245177668 1706 dbSNP
rs757580328 1709 dbSNP
rs1159077788 1717 dbSNP
rs1406352585 1720 dbSNP
rs1415707087 1722 dbSNP
rs1334202358 1726 dbSNP
rs1224636540 1731 dbSNP
rs1450813300 1731 dbSNP
rs879225661 1731 dbSNP
rs1033597709 1732 dbSNP
rs1284713614 1733 dbSNP
rs1223836111 1743 dbSNP
rs959348729 1743 dbSNP
rs1309688942 1744 dbSNP
rs781098578 1753 dbSNP
rs1346552520 1757 dbSNP
rs1305265375 1769 dbSNP
rs1398724841 1778 dbSNP
rs1010890312 1783 dbSNP
rs1350883411 1784 dbSNP
rs374110700 1785 dbSNP
rs745664296 1789 dbSNP
rs1423405323 1791 dbSNP
rs569742020 1794 dbSNP
rs111336661 1799 dbSNP
rs1269374287 1799 dbSNP
rs529086474 1799 dbSNP
rs1277722122 1800 dbSNP
rs78381444 1810 dbSNP
rs78442460 1811 dbSNP
rs966821618 1812 dbSNP
rs1262353045 1816 dbSNP
rs978630079 1820 dbSNP
rs769796213 1823 dbSNP
rs912055210 1826 dbSNP
rs1218281145 1831 dbSNP
rs1279395431 1852 dbSNP
rs1323748851 1857 dbSNP
rs966648673 1859 dbSNP
rs1285604296 1860 dbSNP
rs1347502345 1860 dbSNP
rs1217159050 1863 dbSNP
rs1340492908 1869 dbSNP
rs1289960518 1872 dbSNP
rs537130064 1878 dbSNP
rs1208990918 1879 dbSNP
rs28733446 1882 dbSNP
rs1254165372 1886 dbSNP
rs974971005 1896 dbSNP
rs1178378705 1897 dbSNP
rs140057976 1909 dbSNP
rs1422905466 1910 dbSNP
rs1231705317 1912 dbSNP
rs1479272834 1916 dbSNP
rs1235272329 1917 dbSNP
rs1208753405 1921 dbSNP
rs932278925 1922 dbSNP
rs1423845666 1923 dbSNP
rs749973120 1924 dbSNP
rs1432554067 1925 dbSNP
rs1317666638 1928 dbSNP
rs909586096 1929 dbSNP
rs1170103208 1930 dbSNP
rs749315275 1940 dbSNP
rs868323096 1941 dbSNP
rs573576284 1947 dbSNP
rs1453431814 1950 dbSNP
rs1428903475 1971 dbSNP
rs1329551207 1980 dbSNP
rs534323177 1981 dbSNP
rs1037223398 1992 dbSNP
rs906365127 2001 dbSNP
rs1170829383 2002 dbSNP
rs1003355891 2003 dbSNP
rs559471373 2025 dbSNP
rs1411500884 2028 dbSNP
rs28643366 2033 dbSNP
rs189925061 2034 dbSNP
rs1319991367 2038 dbSNP
rs1176408711 2039 dbSNP
rs1010822956 2042 dbSNP
rs1022260243 2052 dbSNP
rs1320483481 2069 dbSNP
rs143079361 2069 dbSNP
rs372363164 2069 dbSNP
rs1275584034 2073 dbSNP
rs773932520 2074 dbSNP
rs1370342768 2076 dbSNP
rs999612415 2089 dbSNP
rs1385106587 2090 dbSNP
rs544775101 2097 dbSNP
rs73417629 2098 dbSNP
rs182819813 2112 dbSNP
rs1298580743 2113 dbSNP
rs1319181298 2118 dbSNP
rs543097970 2119 dbSNP
rs561271741 2120 dbSNP
rs753256485 2122 dbSNP
rs1211569627 2125 dbSNP
rs1425157943 2125 dbSNP
rs374305163 2132 dbSNP
rs1240043990 2133 dbSNP
rs1477279911 2135 dbSNP
rs1176183200 2136 dbSNP
rs1418199808 2137 dbSNP
rs1250754274 2138 dbSNP
rs1179389200 2146 dbSNP
rs1487704442 2147 dbSNP
rs1453897272 2150 dbSNP
rs1029227775 2151 dbSNP
rs1347151399 2167 dbSNP
rs1223890934 2169 dbSNP
rs1362165734 2169 dbSNP
rs952278800 2173 dbSNP
rs756380008 2179 dbSNP
rs983756136 2180 dbSNP
rs528440325 2182 dbSNP
rs1452050720 2191 dbSNP
rs1317782995 2213 dbSNP
rs909543030 2226 dbSNP
rs1189888949 2233 dbSNP
rs778224682 2234 dbSNP
rs1428676876 2236 dbSNP
rs972492393 2237 dbSNP
rs1165998514 2245 dbSNP
rs1156347676 2259 dbSNP
rs1392610911 2260 dbSNP
rs927732972 2262 dbSNP
rs547026636 2263 dbSNP
rs939158656 2264 dbSNP
rs1054887409 2267 dbSNP
rs1322826439 2269 dbSNP
rs1431030307 2277 dbSNP
rs1429068045 2280 dbSNP
rs776919000 2281 dbSNP
rs749484569 2283 dbSNP
rs1299880755 2284 dbSNP
rs1366260380 2285 dbSNP
rs895032029 2297 dbSNP
rs565545947 2301 dbSNP
rs757595034 2302 dbSNP
rs1486226944 2304 dbSNP
rs539494753 2306 dbSNP
rs779115970 2317 dbSNP
rs1358916554 2323 dbSNP
rs1210754216 2328 dbSNP
rs1311785579 2329 dbSNP
rs1282452900 2341 dbSNP
rs1223864708 2343 dbSNP
rs1347393095 2353 dbSNP
rs946627300 2357 dbSNP
rs1044073126 2360 dbSNP
rs1467501079 2362 dbSNP
rs1210103934 2363 dbSNP
rs902492093 2367 dbSNP
rs999961014 2369 dbSNP
rs1190583250 2370 dbSNP
rs1428133247 2372 dbSNP
rs1177649128 2375 dbSNP
rs1018997822 2376 dbSNP
rs532879161 2379 dbSNP
rs901948664 2382 dbSNP
rs1415637366 2383 dbSNP
rs556511078 2387 dbSNP
rs1322712629 2388 dbSNP
rs1204128098 2391 dbSNP
rs1325445416 2392 dbSNP
rs1275999756 2394 dbSNP
rs1029175302 2397 dbSNP
rs1389468431 2397 dbSNP
rs1381656493 2398 dbSNP
rs1393754576 2399 dbSNP
rs1316517918 2402 dbSNP
rs952225378 2404 dbSNP
rs1470717658 2406 dbSNP
rs1055413887 2409 dbSNP
rs1246033406 2414 dbSNP
rs1293036316 2415 dbSNP
rs1333405056 2416 dbSNP
rs1230766403 2420 dbSNP
rs1269245909 2425 dbSNP
rs188300967 2426 dbSNP
rs1202802886 2427 dbSNP
rs1257874209 2428 dbSNP
rs1442612036 2430 dbSNP
rs759876907 2439 dbSNP
rs1194995085 2448 dbSNP
rs1032639012 2453 dbSNP
rs1415378056 2454 dbSNP
rs892845850 2455 dbSNP
rs961060019 2458 dbSNP
rs576468375 2459 dbSNP
rs1159825981 2466 dbSNP
rs192808949 2467 dbSNP
rs536489286 2476 dbSNP
rs556014682 2477 dbSNP
rs1161992654 2480 dbSNP
rs971236818 2486 dbSNP
rs1424513543 2488 dbSNP
rs1385976729 2490 dbSNP
rs981658690 2491 dbSNP
rs1438122714 2492 dbSNP
rs990563174 2498 dbSNP
rs1015396873 2507 dbSNP
rs1438168747 2508 dbSNP
rs1396810492 2519 dbSNP
rs962071060 2521 dbSNP
rs1252331767 2525 dbSNP
rs972127825 2529 dbSNP
rs1358592351 2530 dbSNP
rs1291899637 2539 dbSNP
rs1247505045 2545 dbSNP
rs758996441 2551 dbSNP
rs548268115 2552 dbSNP
rs1278576194 2555 dbSNP
rs1043634456 2559 dbSNP
rs930664969 2560 dbSNP
rs772042823 2563 dbSNP
rs28597772 2567 dbSNP
rs901896272 2570 dbSNP
rs117459500 2571 dbSNP
rs944988897 2572 dbSNP
rs572640717 2576 dbSNP
rs1407599260 2579 dbSNP
rs567256628 2582 dbSNP
rs775224722 2585 dbSNP
rs934393813 2589 dbSNP
rs1196955733 2596 dbSNP
rs1490179995 2597 dbSNP
rs1257221722 2602 dbSNP
rs1054239418 2613 dbSNP
rs1209703474 2614 dbSNP
rs746978875 2621 dbSNP
rs1013022613 2622 dbSNP
rs1399615726 2628 dbSNP
rs1224027148 2629 dbSNP
rs1483922856 2633 dbSNP
rs1182577140 2639 dbSNP
rs185268832 2645 dbSNP
rs552569026 2663 dbSNP
rs764033974 2664 dbSNP
rs114802215 2667 dbSNP
rs374994940 2670 dbSNP
rs962627975 2672 dbSNP
rs1429162406 2674 dbSNP
rs530672833 2678 dbSNP
rs1379438517 2686 dbSNP
rs993814658 2691 dbSNP
rs1319017952 2692 dbSNP
rs73417631 2693 dbSNP
rs960399150 2702 dbSNP
rs1174043868 2703 dbSNP
rs990511193 2704 dbSNP
rs1429662264 2710 dbSNP
rs1432050684 2711 dbSNP
rs916357746 2715 dbSNP
rs1373311704 2717 dbSNP
rs1241043669 2725 dbSNP
rs541620628 2729 dbSNP
rs967824118 2731 dbSNP
rs1448415186 2732 dbSNP
rs1015344528 2736 dbSNP
rs979691867 2739 dbSNP
rs923844029 2740 dbSNP
rs1213356187 2744 dbSNP
rs935255200 2749 dbSNP
rs961235748 2750 dbSNP
rs376448883 2757 dbSNP
rs548843572 2759 dbSNP
rs755282252 2759 dbSNP
rs1277780241 2760 dbSNP
rs1343811531 2762 dbSNP
rs1205665291 2773 dbSNP
rs1250533688 2774 dbSNP
rs1479654456 2775 dbSNP
rs1192853160 2777 dbSNP
rs1267901227 2779 dbSNP
rs1454779095 2782 dbSNP
rs1193042797 2783 dbSNP
rs575393491 2793 dbSNP
rs1186671383 2803 dbSNP
rs1476099024 2822 dbSNP
rs923266747 2823 dbSNP
rs371329365 2825 dbSNP
rs1050489027 2828 dbSNP
rs1171631380 2828 dbSNP
rs1461456617 2832 dbSNP
rs1354311652 2836 dbSNP
rs542460388 2839 dbSNP
rs887874926 2845 dbSNP
rs1274317449 2852 dbSNP
rs1216777117 2874 dbSNP
rs1357376748 2877 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.375 5.2e-2 -0.429 3.0e-2 20 Click to see details
GSE27834 Pluripotent stem cells 0.402 6.1e-2 0.435 4.6e-2 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.323 6.2e-2 0.239 1.3e-1 24 Click to see details
GSE21032 Prostate cancer -0.156 8.0e-2 -0.040 3.6e-1 83 Click to see details
GSE32688 Pancreatic cancer -0.207 1.3e-1 -0.027 4.4e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer -0.224 1.7e-1 -0.165 2.4e-1 20 Click to see details
GSE21849 B cell lymphoma 0.174 1.8e-1 0.249 9.6e-2 29 Click to see details
GSE42095 Differentiated embryonic stem cells -0.196 1.9e-1 -0.093 3.4e-1 23 Click to see details
GSE28544 Breast cancer -0.19 1.9e-1 -0.459 1.2e-2 24 Click to see details
GSE38226 Liver fibrosis 0.187 2.1e-1 0.162 2.4e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.089 2.2e-1 0.143 1.0e-1 79 Click to see details
GSE19536 Breast cancer 0.075 2.3e-1 0.084 2.0e-1 100 Click to see details
GSE14794 Lymphoblastoid cells 0.068 2.6e-1 0.074 2.4e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.132 2.6e-1 0.243 1.2e-1 25 Click to see details
GSE17306 Multiple myeloma -0.056 3.5e-1 -0.094 2.6e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.07 3.7e-1 0.141 2.5e-1 25 Click to see details
GSE17498 Multiple myeloma 0.051 3.8e-1 0.162 1.6e-1 40 Click to see details
GSE21687 Ependynoma primary tumors 0.038 3.8e-1 0.037 3.9e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.044 4.4e-1 -0.236 2.2e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.041 4.5e-1 0.077 4.1e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.041 4.5e-1 0.077 4.1e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.411 0 -0.404 0 68 Click to see details
HNSC -0.509 0 -0.520 0 42 Click to see details
STAD -0.481 0 -0.484 0 32 Click to see details
COAD 0.839 0 0.714 0.02 8 Click to see details
BRCA -0.277 0.01 -0.345 0 84 Click to see details
BLCA 0.47 0.02 0.387 0.06 18 Click to see details
PRAD 0.256 0.04 0.199 0.08 50 Click to see details
LIHC -0.255 0.04 -0.245 0.04 49 Click to see details
KICH -0.336 0.05 -0.466 0.01 25 Click to see details
PCPG -0.976 0.07 -1.000 0.5 3 Click to see details
LUSC -0.21 0.1 -0.099 0.28 38 Click to see details
CHOL 0.396 0.15 0.183 0.32 9 Click to see details
ESCA -0.304 0.18 -0.427 0.1 11 Click to see details
CESC -0.811 0.2 -0.500 0.33 3 Click to see details
KIRP -0.135 0.23 -0.202 0.13 32 Click to see details
LUAD -0.222 0.24 -0.273 0.2 12 Click to see details
THCA -0.074 0.29 -0.028 0.42 59 Click to see details
PAAD 0.277 0.36 0.600 0.2 4 Click to see details
UCEC -0.055 0.41 -0.033 0.45 19 Click to see details
UCEC -0.055 0.41 -0.033 0.45 19 Click to see details
UCEC -0.055 0.41 -0.033 0.45 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*