miRTarBase - #MIRT133769 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SKI   
Synonyms SGS, SKV
Description SKI proto-oncogene
Transcript NM_003036   
Expression
Putative miRNA Targets on SKI
3'UTR of SKI
(miRNA target sites are highlighted)
>SKI|NM_003036|3'UTR
   1 ATTCCGTGCCTGCCGCCGCAGCGCCGCCGACAACGCGGGTGCAGGGGGGCGCGGCTGGGCGGTGCAGCTCCGCCCGGCTC
  81 CGCCCCTGCAGCCCACACAGCACAACGTCTTACCGTGCCTATTACCAAGCGAGTGTTTGTAACCATGTAGTTTTGGAACC
 161 CACTGCAAAATTTTCTACTGGCCAAGTTCAAGTGAGTAAGCCGCGTCCCCCAACTACAGCTGGAGACGGGGCCAGCTCGG
 241 CGGCCTGCTGGTCCTCTGCTTGCTGGAACATTCTAACATTTACACTTTTGTTATAAGCTATTTAAAACCAGTAAGGAGAC
 321 TTGAAATTCAGAAAATCAACACATTTTTAAATGACTAACTTCTAAAAGCCCCAACACATGACGCCATCTGAAGACCCGCA
 401 ACGGAGTGGGGGTGGCGGCCGCCCCACCCTCCCCACCCGGGGAAGCCATCACAGCTCATCTGCCCGCGGCTGCGTGAGGA
 481 CAGCAGGGGTTTTTCTTCAGAGTCTATTTTTTCAGCGACAAGGACCCAGGTCTTCCTGCTGCTGCCAGGGAGAGCAGGGA
 561 CAGTGCCGCGTGCGAGATGAGCTCGAACACTGCCCGCCTTACTGCCGCCTACCCCGCCCGCCACGCCGCCGTCGATGCCA
 641 GCGCTGTCCCCACGGGTACCAGGAAGTGCAGAGCCGCACAGGAGCTGCCCCGGAGCTGAGGGGACGGTCTTCGGCTCCTC
 721 TGCACCCCGTGATTCTGCCCACGCTCCTCCACCACGAGGCACTGACCTGCGTCGGGTGGTGACCGTGGCTGGCGGTCACG
 801 CCCTCAGCCCCTCCGGGCACACGTGCCGCCTGACCGGGCGACCCTTTTCAGTTCGGCAAACGTCGCTCCCTTCATTTTGG
 881 GACTGAGGCTGCAGCATTGGAACAAAAGAGCATTATTTCAATTTTTCTTTCTTTTTTTTTGTTCGTTCATTTAAACGTAT
 961 ATTTAGAACTGCACTTTGTCCACAACCTTCCCTTCTCTTTCTATTCCCCAGTGAACTGAGGTTTTTACCGATTTATAGAG
1041 CAGTCAAATCCGAAGTGCTCGAGTGCTTAGAAACCCCCTCTGGTGCTTGGTTGAACAAGGGAATCACAAGAAAACGAAAA
1121 TGCAAAAACTGAACTTCGGGGGTCGTTCTGTGCCTTCCAGCATCTTGTACAGCAAATCCTGACTCGTGTCTTTTTACCCC
1201 CAAGATATCTGTCTTCAGTAGCGACTGAATCTGCCACTCTCAGAATAAGTTCCTTGCATTTATTCCAAATAATCTCGTTT
1281 ACTCTCACCTGTTTATGCAAATTGTATAAGGTTTCTTATGCCCAAGCTTGAAAAATGATTTCCCAGTAGACAAGAGGCGG
1361 CTACCTATCCTACAGTTACGGTATTTATTTACATAAGAAGATCTTACAGGAGTTCTTTGCTTGAATCCGTTCTAACACCC
1441 GCGGCAGCTGCACGCGCTCACAGAAGGTGGAGGTTACTTGCCCAGGTACAGACGACCTCGGGGCAGTGACGAGCAAAGAC
1521 CAGAGACTGCTGAGCCCTCGCATCTGGGTGGCGGAATTGCCTGCGGGGTTTTGCCCTTGGTTTACTGAGGGGGGTCTTGG
1601 TTGCTGCTGAAGCCCCCCACCCCTTCTAAAGTGCAATGCAAAAGGGACATCATGTATATGCAGCGTTTGTTTGGAATTTT
1681 CTTTGCTTTTGTTTTCTTTGCGGTTGTTCTGTGTGCATGGATTCCACACCTCTGCCGTAGGTAGATCCGTCAGCGGGCAT
1761 TATTACCGTGTCTTGTAAAGGGTCGGTTTTGTTATGCAACATGCAGAATGCTGTTTTTAGCCTTGTTTTACCAGAGTTGT
1841 TTTTTTTTTCAGTTATTTCTTCAAGGGAAACTAAATGATTTAGTTGGAGCAAAGCTTTAAGTGTGTTGGCGTGCTTCTGT
1921 GTGGCTGTCCTGTGTCGCCAGGTCGAAGATCACAGTGAGGTAGAGGCCCTGCCCCATCCCCAGGGCCGCCAGGCTTGCTC
2001 CGTTTGCTTTGAGTTTTTAGACCCCAGAGGGAGATGAGCTTTTCCAAGCTGTGTCTGGGCCAGAGCCTCTCCTTGCCCTT
2081 GCTCCATCCCGACGGTCACCGTTGGGTCCACGCCTCCACCGCCCCATCTTGCCCCAAACGGAAAGCGCTGTATCTGCAGT
2161 GGCAGCCCTTCCCCACTTCGGCTCTGGGAGGGTCCAGCCAGTGTCACCTGGGCCCACCCTTTCCTGCAGCTGCCAGGCCC
2241 GTGCGGTCAGTGGGACCCGGACGTGGGCAGGCGAGCTCGGGACCCTCCCAGGCAGTTCCCACAGCTCTTGCCTCGGCTCA
2321 CCAGGGTCACTTCCACTGTCAGGGGCCTGAGGGGGCAGCTGTGGCTGCAGGGCTGCTCTGGACTGAGGGGTCCCAGGCCC
2401 CGAGGGGTGCACGCCTGGCTCCCCTTGGCACAGGTGCGAGTCCGTTTCTTTTCAGCAGAAGGGGGAAGAGGTGTCCGCTG
2481 TGTGGGCTGCTGACTCCTCTGTGTGTGAGGCCCTTCATCTAAGTGATTGTGTATTCAGTTTAATTCTCATTATATTTCTA
2561 TACTGAAAGAAGATTTTTAACGAAGGGAAAAACAACAGCAATAACATTCATATCTCTGGAGCAGCTAACTCATACACGTA
2641 ATGTCTGCTTTTCGTACAGAACTAGCCAATGTAAAAACAGTTCACCTGTAAATACTTTTTCCTTTTTCACCGTTGTATTA
2721 TACATGTATATGCTGGGTCCTTTTTCAGAAACTCTTTTCTTACCTGAGAGTTGTCTTGTTTTCTGGGCTGTTTTTAACTG
2801 AGGAAAAAAAAAATGCTTTCCTGCCGGGGGGCAGGGGAGACGGAGAAACCCATGTGCGTTTCCCATGTGACCCCCTCCTC
2881 CCTGTGGGTCTGAGCCCCGGCCCCCCCCACCTCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCACCCCCTCCTCCCT
2961 GTGGGTCCGAACCCCGGCCCCCCCACCCCCTCCTCCCTGTGGGTCCGATCCCCGGCCCCCCCCACCCCCTCCTCCCTGTG
3041 GGTCCGAACCCCGGCCCCCCCCCCACCCCCTCCTCCCTGTGGGTCCGAACCCCGGCCCCCCCACCCCTCCCTCAGCCCAC
3121 CAGGGTCCAGGGAGATGTTCGTTCTCGCTTTAAGTCAGGAGTCACAAATGACTTTTTTTTTTCAATTAAGGAAAAAGCTC
3201 CATCTCTACCTTTAACATCACCCAGACCCCCGCCCCTGCCCGTGCCCCACGCTGCTGCTAACGACAGTATGATGCTTACT
3281 CTGCTACTCGGAAACTATTTTTATGTAATTAATGTATGCTTTCTTGTTTATAAATGCCTGATTTAAAAAGAAAAGAGCTT
3361 GGCATATTTATCTATTTCGCTGTGTACCTGTTAGTCCTTCCCCGACCCCGAAACAGATGACATTGTACAATAAAGGACTT
3441 TGAGAGGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||:::| ||   ||||||| 
Target 5' ccCAGGTC-TT-CCTGCTGCTg 3'
525 - 544 146.00 -14.10
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ::::| ||:  ||||||| 
Target 5' gggGGGTC-TTGGTTGCTGCTg 3'
1589 - 1609 146.00 -12.90
3
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' cccgtgccccacgcTGCTGCTa 3'
3239 - 3260 140.00 -13.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
222822 1 ClinVar
1198748 5 ClinVar
1194396 14 ClinVar
383970 18 ClinVar
1208348 40 ClinVar
COSN24398679 10 COSMIC
COSN30545127 10 COSMIC
COSN28849433 61 COSMIC
COSN31593190 77 COSMIC
COSN30173592 101 COSMIC
COSN30173447 257 COSMIC
COSN31596290 506 COSMIC
COSN31587919 516 COSMIC
COSN30175765 546 COSMIC
COSN31521348 565 COSMIC
COSN24157301 694 COSMIC
COSN17964685 753 COSMIC
COSN31577742 756 COSMIC
COSN31563880 816 COSMIC
COSN31609567 932 COSMIC
COSN7205666 934 COSMIC
COSN31486995 945 COSMIC
COSN31529049 952 COSMIC
COSN30545034 982 COSMIC
COSN31550590 1012 COSMIC
COSN26507655 1062 COSMIC
COSN31540282 1069 COSMIC
COSN31531383 1191 COSMIC
COSN31516003 1277 COSMIC
COSN17182838 1411 COSMIC
COSN22804261 1708 COSMIC
COSN31960156 2095 COSMIC
COSN7205693 2259 COSMIC
COSN16016195 2496 COSMIC
COSN28907592 2814 COSMIC
COSN21833254 2892 COSMIC
COSN7205705 2910 COSMIC
COSN23926257 2913 COSMIC
COSN28605665 3090 COSMIC
COSN14817719 3104 COSMIC
COSN20094172 3183 COSMIC
COSN32061985 3197 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1426959600 1 dbSNP
rs869025526 1 dbSNP
rs1344859997 4 dbSNP
rs1387422875 4 dbSNP
rs1330809659 5 dbSNP
rs879043759 7 dbSNP
rs1240331611 8 dbSNP
rs1380676600 9 dbSNP
rs1242627775 10 dbSNP
rs981226930 11 dbSNP
rs920341578 12 dbSNP
rs1356960548 14 dbSNP
rs563357852 14 dbSNP
rs1317311585 15 dbSNP
rs567459593 16 dbSNP
rs1183604661 17 dbSNP
rs777412251 17 dbSNP
rs746845280 18 dbSNP
rs1194073828 19 dbSNP
rs1213750432 19 dbSNP
rs1157210755 21 dbSNP
rs982634081 22 dbSNP
rs908391053 23 dbSNP
rs1161636505 24 dbSNP
rs1404110864 26 dbSNP
rs770736166 27 dbSNP
rs1337429023 29 dbSNP
rs1384938058 30 dbSNP
rs1180124899 32 dbSNP
rs1439908033 33 dbSNP
rs2230008 34 dbSNP
rs1423585605 35 dbSNP
rs749324704 36 dbSNP
rs191800649 40 dbSNP
rs1260880092 41 dbSNP
rs774638939 42 dbSNP
rs1170011372 43 dbSNP
rs1322310334 44 dbSNP
rs559655649 46 dbSNP
rs1444679669 48 dbSNP
rs1180244434 50 dbSNP
rs1232726654 51 dbSNP
rs1470727543 52 dbSNP
rs1288927763 54 dbSNP
rs1184706855 60 dbSNP
rs932372911 61 dbSNP
rs1050792751 62 dbSNP
rs1438552939 64 dbSNP
rs1404404807 65 dbSNP
rs1408204948 65 dbSNP
rs890905795 66 dbSNP
rs1336217248 67 dbSNP
rs760271148 67 dbSNP
rs528789588 68 dbSNP
rs1371411288 71 dbSNP
rs1236184573 73 dbSNP
rs1281951277 76 dbSNP
rs1223720422 77 dbSNP
rs1264498549 79 dbSNP
rs1336871884 79 dbSNP
rs1052529247 82 dbSNP
rs1272935015 83 dbSNP
rs1438862097 85 dbSNP
rs1184818810 87 dbSNP
rs1315338295 94 dbSNP
rs892648358 96 dbSNP
rs1215424471 97 dbSNP
rs1261315201 99 dbSNP
rs1466317448 102 dbSNP
rs960507798 103 dbSNP
rs1022550019 106 dbSNP
rs1252951989 106 dbSNP
rs905190438 107 dbSNP
rs1002245847 110 dbSNP
rs1455114089 114 dbSNP
rs1324257074 115 dbSNP
rs1035083590 116 dbSNP
rs960755705 120 dbSNP
rs992896405 122 dbSNP
rs1207885067 125 dbSNP
rs1406311873 126 dbSNP
rs1490285032 127 dbSNP
rs551609306 130 dbSNP
rs1015048146 132 dbSNP
rs1269743464 134 dbSNP
rs1004311037 136 dbSNP
rs1445453227 136 dbSNP
rs3835420 138 dbSNP
rs1373692127 140 dbSNP
rs1459443359 144 dbSNP
rs1015401529 146 dbSNP
rs778011087 147 dbSNP
rs1384439560 153 dbSNP
rs1425075845 155 dbSNP
rs564983050 160 dbSNP
rs1395102969 163 dbSNP
rs1438602635 165 dbSNP
rs1381285098 166 dbSNP
rs974392818 170 dbSNP
rs1277553889 175 dbSNP
rs973403226 178 dbSNP
rs1372354525 191 dbSNP
rs919810671 196 dbSNP
rs1231330812 197 dbSNP
rs769542370 200 dbSNP
rs749743463 201 dbSNP
rs771632454 203 dbSNP
rs1267553412 204 dbSNP
rs986454405 205 dbSNP
rs985806640 206 dbSNP
rs1466294646 207 dbSNP
rs1181763374 209 dbSNP
rs1272676760 210 dbSNP
rs1445118428 211 dbSNP
rs911047190 212 dbSNP
rs912248246 214 dbSNP
rs779741742 216 dbSNP
rs1452690670 222 dbSNP
rs530801321 224 dbSNP
rs1052813378 226 dbSNP
rs1469968145 228 dbSNP
rs1040768975 229 dbSNP
rs558841964 230 dbSNP
rs945682215 233 dbSNP
rs1163570051 238 dbSNP
rs763877755 239 dbSNP
rs1394674673 240 dbSNP
rs1042715973 241 dbSNP
rs1406956302 242 dbSNP
rs779321206 243 dbSNP
rs1201880245 247 dbSNP
rs878917058 248 dbSNP
rs904748586 252 dbSNP
rs1461746486 254 dbSNP
rs768180847 255 dbSNP
rs1248222857 257 dbSNP
rs1353652719 258 dbSNP
rs1182179018 259 dbSNP
rs1413756053 270 dbSNP
rs1442698526 274 dbSNP
rs567771239 277 dbSNP
rs577047800 278 dbSNP
rs1406134436 286 dbSNP
rs1467059206 289 dbSNP
rs1305092343 290 dbSNP
rs1371734416 291 dbSNP
rs1391179080 294 dbSNP
rs1289326786 296 dbSNP
rs1352618574 298 dbSNP
rs1035043224 299 dbSNP
rs1221884441 301 dbSNP
rs1262662872 306 dbSNP
rs536317054 309 dbSNP
rs895975809 310 dbSNP
rs1480244898 311 dbSNP
rs1352537832 314 dbSNP
rs1002473065 318 dbSNP
rs1056447572 319 dbSNP
rs1198229703 321 dbSNP
rs1429444380 322 dbSNP
rs1434408914 326 dbSNP
rs1167616365 329 dbSNP
rs1004260290 334 dbSNP
rs896494795 334 dbSNP
rs1015725549 336 dbSNP
rs962854149 337 dbSNP
rs1014468480 340 dbSNP
rs1292744176 343 dbSNP
rs1282898892 344 dbSNP
rs1357146423 346 dbSNP
rs1368494409 349 dbSNP
rs1028641514 353 dbSNP
rs72642140 357 dbSNP
rs868111162 360 dbSNP
rs962127304 363 dbSNP
rs973380286 367 dbSNP
rs1221379980 369 dbSNP
rs1246928309 370 dbSNP
rs912196107 371 dbSNP
rs1184311414 373 dbSNP
rs184330809 376 dbSNP
rs188831690 379 dbSNP
rs1484484838 383 dbSNP
rs1423136170 384 dbSNP
rs1302883880 385 dbSNP
rs1350708448 389 dbSNP
rs1186793360 397 dbSNP
rs558074456 398 dbSNP
rs1361352063 403 dbSNP
rs1473504656 404 dbSNP
rs577749264 405 dbSNP
rs1229122570 408 dbSNP
rs946863924 409 dbSNP
rs911169008 413 dbSNP
rs547005488 415 dbSNP
rs1236695831 416 dbSNP
rs943835788 417 dbSNP
rs1043874949 418 dbSNP
rs1170236670 420 dbSNP
rs1373467039 421 dbSNP
rs1241076584 422 dbSNP
rs1464968267 422 dbSNP
rs34954223 422 dbSNP
rs976563941 424 dbSNP
rs369120676 425 dbSNP
rs1189863456 427 dbSNP
rs1250478321 429 dbSNP
rs1413092266 431 dbSNP
rs1312511041 432 dbSNP
rs1341100520 436 dbSNP
rs912955677 437 dbSNP
rs1157177674 438 dbSNP
rs537022804 439 dbSNP
rs1339291052 440 dbSNP
rs1229876363 443 dbSNP
rs1277134405 444 dbSNP
rs1381058867 447 dbSNP
rs1221799954 448 dbSNP
rs945816824 453 dbSNP
rs1283125308 456 dbSNP
rs1043221269 458 dbSNP
rs1346189801 465 dbSNP
rs938207324 466 dbSNP
rs904175222 468 dbSNP
rs1257819925 469 dbSNP
rs1460400637 471 dbSNP
rs1187455701 479 dbSNP
rs1238471021 481 dbSNP
rs373075362 487 dbSNP
rs868238014 490 dbSNP
rs1190366836 491 dbSNP
rs1175775164 495 dbSNP
rs1411542537 496 dbSNP
rs1457919045 499 dbSNP
rs1056733340 500 dbSNP
rs896485218 503 dbSNP
rs1413899191 505 dbSNP
rs937036754 506 dbSNP
rs1004248828 507 dbSNP
rs765311194 507 dbSNP
rs1475696933 517 dbSNP
rs1037510288 518 dbSNP
rs898603881 520 dbSNP
rs896071508 523 dbSNP
rs116161617 524 dbSNP
rs1015120248 526 dbSNP
rs898020679 528 dbSNP
rs1322198179 533 dbSNP
rs534095732 535 dbSNP
rs1174071745 536 dbSNP
rs994911837 539 dbSNP
rs1028190238 540 dbSNP
rs1251514949 542 dbSNP
rs1008062320 546 dbSNP
rs953402773 547 dbSNP
rs1019531601 556 dbSNP
rs1316310651 560 dbSNP
rs1325938220 566 dbSNP
rs1436393865 568 dbSNP
rs1300479686 569 dbSNP
rs1007976075 570 dbSNP
rs1307224308 573 dbSNP
rs955700337 574 dbSNP
rs1018158323 585 dbSNP
rs965279659 586 dbSNP
rs1233976495 597 dbSNP
rs1233374867 601 dbSNP
rs1276055512 605 dbSNP
rs755067484 607 dbSNP
rs913048626 610 dbSNP
rs879100500 612 dbSNP
rs1213321888 613 dbSNP
rs193024082 613 dbSNP
rs1483596205 616 dbSNP
rs925730636 619 dbSNP
rs1203077659 621 dbSNP
rs968467302 622 dbSNP
rs1267076017 623 dbSNP
rs1464967978 624 dbSNP
rs936981436 625 dbSNP
rs1199735782 626 dbSNP
rs980265287 627 dbSNP
rs185708310 628 dbSNP
rs1431404503 631 dbSNP
rs553826415 635 dbSNP
rs938199010 636 dbSNP
rs1386965501 639 dbSNP
rs1055873756 643 dbSNP
rs1433641372 644 dbSNP
rs1297522741 645 dbSNP
rs559900045 647 dbSNP
rs1231104143 648 dbSNP
rs573351238 652 dbSNP
rs1355963397 654 dbSNP
rs747466287 656 dbSNP
rs1036645031 657 dbSNP
rs1453774611 662 dbSNP
rs1248596856 664 dbSNP
rs898503143 668 dbSNP
rs1194017386 670 dbSNP
rs931381027 671 dbSNP
rs1367640788 672 dbSNP
rs1050274784 673 dbSNP
rs1164653875 675 dbSNP
rs897987962 677 dbSNP
rs781442394 689 dbSNP
rs545331149 690 dbSNP
rs995453676 692 dbSNP
rs74600869 693 dbSNP
rs1384290765 697 dbSNP
rs1245910063 703 dbSNP
rs139981381 706 dbSNP
rs1327290815 707 dbSNP
rs544217036 713 dbSNP
rs1010581191 715 dbSNP
rs1466228511 715 dbSNP
rs1021254541 717 dbSNP
rs1392887160 718 dbSNP
rs561087606 719 dbSNP
rs1302405999 720 dbSNP
rs979872195 722 dbSNP
rs1333193282 726 dbSNP
rs1034546115 729 dbSNP
rs1390201312 729 dbSNP
rs1459336052 730 dbSNP
rs1301618968 738 dbSNP
rs1402036510 741 dbSNP
rs1236360251 743 dbSNP
rs1227982984 744 dbSNP
rs1348912937 744 dbSNP
rs959514848 748 dbSNP
rs966038596 750 dbSNP
rs759977925 752 dbSNP
rs1208030142 759 dbSNP
rs1255373722 760 dbSNP
rs992350301 761 dbSNP
rs1020190036 763 dbSNP
rs967179176 769 dbSNP
rs918108904 771 dbSNP
rs1472100411 772 dbSNP
rs979004578 774 dbSNP
rs1270790272 775 dbSNP
rs1467974809 777 dbSNP
rs1377575322 778 dbSNP
rs1466985408 780 dbSNP
rs530218085 782 dbSNP
rs371064577 785 dbSNP
rs1435893023 786 dbSNP
rs1352519841 789 dbSNP
rs765582621 794 dbSNP
rs1300651961 795 dbSNP
rs1363403424 798 dbSNP
rs1312746014 801 dbSNP
rs555940263 802 dbSNP
rs916906199 803 dbSNP
rs1272287846 806 dbSNP
rs1482612075 811 dbSNP
rs1415853716 812 dbSNP
rs546777692 815 dbSNP
rs949734402 816 dbSNP
rs889899067 821 dbSNP
rs1294643354 824 dbSNP
rs372803032 828 dbSNP
rs1036613714 829 dbSNP
rs1169567876 833 dbSNP
rs565907906 835 dbSNP
rs528280335 836 dbSNP
rs1293088757 839 dbSNP
rs1328661037 840 dbSNP
rs189028750 848 dbSNP
rs1010114170 849 dbSNP
rs1043403720 855 dbSNP
rs1228891386 857 dbSNP
rs778195972 858 dbSNP
rs72920922 862 dbSNP
rs1333544079 863 dbSNP
rs1245368968 865 dbSNP
rs1034081467 866 dbSNP
rs1186081827 869 dbSNP
rs1479642433 870 dbSNP
rs763124596 871 dbSNP
rs1252340600 873 dbSNP
rs889184200 875 dbSNP
rs1422095793 878 dbSNP
rs574248890 880 dbSNP
rs1164366896 882 dbSNP
rs749674413 884 dbSNP
rs1459536493 885 dbSNP
rs959754024 890 dbSNP
rs1008036701 894 dbSNP
rs537307135 898 dbSNP
rs1040463287 899 dbSNP
rs115194060 906 dbSNP
rs1227470301 909 dbSNP
rs1290188603 911 dbSNP
rs1323097869 912 dbSNP
rs779439538 921 dbSNP
rs372733030 924 dbSNP
rs560180715 924 dbSNP
rs1464898994 925 dbSNP
rs746408617 925 dbSNP
rs1209896998 927 dbSNP
rs1460969910 928 dbSNP
rs1244281792 929 dbSNP
rs1472018268 930 dbSNP
rs920206830 930 dbSNP
rs1476295202 931 dbSNP
rs1020118213 932 dbSNP
rs1322481034 932 dbSNP
rs1457757832 932 dbSNP
rs373398657 932 dbSNP
rs1357289393 933 dbSNP
rs1167696865 934 dbSNP
rs903106718 936 dbSNP
rs1284548756 937 dbSNP
rs1000003488 941 dbSNP
rs1411216730 942 dbSNP
rs757130448 945 dbSNP
rs567103779 946 dbSNP
rs911242277 957 dbSNP
rs180799523 958 dbSNP
rs1209988698 959 dbSNP
rs958595744 960 dbSNP
rs1441137252 962 dbSNP
rs1305676235 965 dbSNP
rs1041110473 967 dbSNP
rs1486814654 971 dbSNP
rs1226681243 972 dbSNP
rs1274996518 973 dbSNP
rs767436984 974 dbSNP
rs1344055563 975 dbSNP
rs991640218 987 dbSNP
rs536091885 992 dbSNP
rs750417261 993 dbSNP
rs1334651445 1000 dbSNP
rs1413808039 1000 dbSNP
rs552780450 1004 dbSNP
rs1307033520 1007 dbSNP
rs1407709575 1007 dbSNP
rs1182507725 1008 dbSNP
rs971012738 1011 dbSNP
rs1229715784 1017 dbSNP
rs1272546860 1019 dbSNP
rs1258437107 1029 dbSNP
rs971733458 1030 dbSNP
rs1219149910 1036 dbSNP
rs1279851644 1040 dbSNP
rs1350520914 1042 dbSNP
rs1203370740 1043 dbSNP
rs919482109 1052 dbSNP
rs1391120503 1053 dbSNP
rs1483492752 1059 dbSNP
rs930911381 1061 dbSNP
rs573133016 1062 dbSNP
rs1172213172 1071 dbSNP
rs1245051800 1075 dbSNP
rs985085876 1076 dbSNP
rs904462170 1081 dbSNP
rs910696331 1083 dbSNP
rs1358199032 1092 dbSNP
rs1001477066 1094 dbSNP
rs943582314 1097 dbSNP
rs1370835947 1098 dbSNP
rs1392736474 1105 dbSNP
rs1321086497 1106 dbSNP
rs761477826 1112 dbSNP
rs1040432058 1116 dbSNP
rs895491987 1117 dbSNP
rs901935187 1125 dbSNP
rs771526529 1128 dbSNP
rs1359256687 1130 dbSNP
rs1014721822 1134 dbSNP
rs1042383091 1135 dbSNP
rs961561210 1138 dbSNP
rs878978498 1139 dbSNP
rs1451118892 1142 dbSNP
rs1000508995 1143 dbSNP
rs1231762883 1145 dbSNP
rs1027222728 1146 dbSNP
rs953055072 1154 dbSNP
rs1187740379 1157 dbSNP
rs1032965367 1159 dbSNP
rs1390551665 1162 dbSNP
rs1463251375 1164 dbSNP
rs1161109831 1165 dbSNP
rs1389482440 1168 dbSNP
rs1405474809 1172 dbSNP
rs779754112 1173 dbSNP
rs911180029 1184 dbSNP
rs774999006 1186 dbSNP
rs894298108 1187 dbSNP
rs976794887 1188 dbSNP
rs1311824270 1189 dbSNP
rs1229993985 1191 dbSNP
rs913335720 1191 dbSNP
rs1355849993 1192 dbSNP
rs1210566143 1197 dbSNP
rs1275090077 1198 dbSNP
rs945881960 1201 dbSNP
rs1012757739 1202 dbSNP
rs1484948470 1204 dbSNP
rs1248505251 1205 dbSNP
rs1430088669 1206 dbSNP
rs767500535 1207 dbSNP
rs1185089387 1208 dbSNP
rs556215628 1209 dbSNP
rs1249159539 1212 dbSNP
rs971152031 1214 dbSNP
rs971702195 1221 dbSNP
rs748926281 1223 dbSNP
rs1385791524 1224 dbSNP
rs769239039 1232 dbSNP
rs895482268 1233 dbSNP
rs985436875 1236 dbSNP
rs753617345 1237 dbSNP
rs183885298 1240 dbSNP
rs1433340388 1242 dbSNP
rs1177806169 1244 dbSNP
rs1327176641 1244 dbSNP
rs778505096 1246 dbSNP
rs1486777935 1247 dbSNP
rs575543888 1254 dbSNP
rs1027541186 1259 dbSNP
rs1189643617 1266 dbSNP
rs544459354 1269 dbSNP
rs561383482 1277 dbSNP
rs1018514650 1278 dbSNP
rs1455780791 1282 dbSNP
rs1302334353 1283 dbSNP
rs945480973 1285 dbSNP
rs1042473451 1287 dbSNP
rs965335209 1288 dbSNP
rs374474967 1289 dbSNP
rs530033587 1292 dbSNP
rs1315009869 1295 dbSNP
rs1368059301 1296 dbSNP
rs976744068 1299 dbSNP
rs1054741599 1305 dbSNP
rs1303721712 1307 dbSNP
rs1307768717 1308 dbSNP
rs1318731633 1311 dbSNP
rs796897871 1313 dbSNP
rs967836562 1314 dbSNP
rs1255283106 1316 dbSNP
rs1348331583 1319 dbSNP
rs760367872 1320 dbSNP
rs545853763 1324 dbSNP
rs925738686 1344 dbSNP
rs1182323744 1346 dbSNP
rs937198188 1347 dbSNP
rs991398284 1350 dbSNP
rs1174589670 1352 dbSNP
rs1377493689 1354 dbSNP
rs1466632663 1357 dbSNP
rs188655097 1359 dbSNP
rs1429311789 1363 dbSNP
rs1298877943 1364 dbSNP
rs1375637086 1365 dbSNP
rs1385086722 1366 dbSNP
rs949683945 1374 dbSNP
rs1045612577 1376 dbSNP
rs1489022815 1380 dbSNP
rs560362724 1380 dbSNP
rs3765931 1381 dbSNP
rs1204756763 1382 dbSNP
rs897504865 1382 dbSNP
rs1252637600 1384 dbSNP
rs930347521 1390 dbSNP
rs1487220517 1394 dbSNP
rs1252944334 1395 dbSNP
rs536737640 1396 dbSNP
rs1195936860 1397 dbSNP
rs1472088099 1398 dbSNP
rs1388693910 1400 dbSNP
rs867179784 1404 dbSNP
rs1413537398 1407 dbSNP
rs571425963 1408 dbSNP
rs1171404900 1409 dbSNP
rs148901982 1412 dbSNP
rs1322839729 1414 dbSNP
rs181405262 1416 dbSNP
rs1007039882 1429 dbSNP
rs1005885974 1430 dbSNP
rs1214870224 1432 dbSNP
rs777267393 1433 dbSNP
rs1018237488 1441 dbSNP
rs1273236193 1442 dbSNP
rs1228091917 1443 dbSNP
rs567292545 1444 dbSNP
rs1331339848 1445 dbSNP
rs979253126 1447 dbSNP
rs142729543 1449 dbSNP
rs1421981515 1454 dbSNP
rs976197544 1455 dbSNP
rs770168504 1456 dbSNP
rs553123646 1457 dbSNP
rs1224210308 1459 dbSNP
rs1387762681 1461 dbSNP
rs1431228942 1461 dbSNP
rs917106987 1470 dbSNP
rs1231584150 1479 dbSNP
rs763186447 1487 dbSNP
rs1376568327 1492 dbSNP
rs1482485707 1494 dbSNP
rs1182466322 1495 dbSNP
rs1266809729 1499 dbSNP
rs1446910522 1500 dbSNP
rs949921629 1501 dbSNP
rs1244193557 1507 dbSNP
rs1482435166 1510 dbSNP
rs966884984 1511 dbSNP
rs1162169582 1512 dbSNP
rs918912283 1514 dbSNP
rs1407066210 1515 dbSNP
rs1407228077 1522 dbSNP
rs978145602 1528 dbSNP
rs1161104391 1535 dbSNP
rs1357199036 1535 dbSNP
rs1369728529 1536 dbSNP
rs1313145300 1539 dbSNP
rs553059180 1540 dbSNP
rs566249242 1550 dbSNP
rs1287126346 1553 dbSNP
rs538308326 1554 dbSNP
rs576147394 1555 dbSNP
rs764315178 1558 dbSNP
rs1445875409 1559 dbSNP
rs1310809782 1560 dbSNP
rs915792469 1565 dbSNP
rs774349704 1566 dbSNP
rs1486762288 1569 dbSNP
rs1180154513 1581 dbSNP
rs1178884659 1589 dbSNP
rs369328388 1589 dbSNP
rs564832872 1589 dbSNP
rs776462398 1589 dbSNP
rs1422927982 1590 dbSNP
rs1433894245 1593 dbSNP
rs1380513898 1597 dbSNP
rs1045708381 1601 dbSNP
rs1271251059 1613 dbSNP
rs1427421893 1615 dbSNP
rs1327673452 1616 dbSNP
rs1341923845 1619 dbSNP
rs907025836 1619 dbSNP
rs558731765 1620 dbSNP
rs1276292699 1621 dbSNP
rs1366042469 1623 dbSNP
rs1484512463 1624 dbSNP
rs1047892602 1626 dbSNP
rs1350407273 1628 dbSNP
rs761865958 1629 dbSNP
rs531899359 1632 dbSNP
rs1006271105 1637 dbSNP
rs1017288272 1645 dbSNP
rs1438496876 1646 dbSNP
rs1473701259 1647 dbSNP
rs1458292712 1648 dbSNP
rs867448963 1648 dbSNP
rs1230083605 1650 dbSNP
rs750329332 1652 dbSNP
rs1453694423 1656 dbSNP
rs1042012865 1658 dbSNP
rs1396651075 1663 dbSNP
rs1166970604 1665 dbSNP
rs903175892 1665 dbSNP
rs765153522 1666 dbSNP
rs1411171908 1668 dbSNP
rs1392965874 1669 dbSNP
rs1440810922 1670 dbSNP
rs1304700001 1675 dbSNP
rs1184726630 1681 dbSNP
rs1226598461 1682 dbSNP
rs757968947 1682 dbSNP
rs1269853615 1687 dbSNP
rs1340294505 1689 dbSNP
rs1030580974 1690 dbSNP
rs1389271661 1696 dbSNP
rs1033494456 1702 dbSNP
rs544076804 1703 dbSNP
rs568378373 1703 dbSNP
rs762997111 1706 dbSNP
rs1463399157 1708 dbSNP
rs1192137356 1709 dbSNP
rs978292724 1711 dbSNP
rs1373338830 1714 dbSNP
rs1476170413 1717 dbSNP
rs1161017008 1718 dbSNP
rs1416505992 1719 dbSNP
rs146521575 1725 dbSNP
rs958169254 1730 dbSNP
rs991338293 1731 dbSNP
rs971257175 1733 dbSNP
rs941121001 1735 dbSNP
rs1327317495 1736 dbSNP
rs972382233 1737 dbSNP
rs573213690 1738 dbSNP
rs919208659 1739 dbSNP
rs1274996058 1740 dbSNP
rs1296083036 1741 dbSNP
rs746027892 1741 dbSNP
rs1204371527 1749 dbSNP
rs554949504 1749 dbSNP
rs1045673056 1752 dbSNP
rs928537378 1753 dbSNP
rs951781654 1753 dbSNP
rs984448448 1768 dbSNP
rs545041338 1769 dbSNP
rs1342427435 1772 dbSNP
rs766144122 1775 dbSNP
rs1475266546 1776 dbSNP
rs562268802 1782 dbSNP
rs1166439929 1783 dbSNP
rs1199526401 1785 dbSNP
rs1452257644 1786 dbSNP
rs767638098 1795 dbSNP
rs1443668092 1796 dbSNP
rs1384212633 1797 dbSNP
rs1213510666 1798 dbSNP
rs1354999673 1799 dbSNP
rs1415525368 1802 dbSNP
rs2173049 1803 dbSNP
rs1261177969 1804 dbSNP
rs1450064216 1805 dbSNP
rs1208410808 1806 dbSNP
rs1190257204 1810 dbSNP
rs1393113159 1814 dbSNP
rs540292300 1820 dbSNP
rs1477129935 1821 dbSNP
rs1172234413 1822 dbSNP
rs1189529479 1823 dbSNP
rs1402950708 1839 dbSNP
rs113293239 1840 dbSNP
rs1172145044 1840 dbSNP
rs1364843901 1840 dbSNP
rs1455699378 1840 dbSNP
rs887499814 1841 dbSNP
rs941770467 1843 dbSNP
rs1390828046 1850 dbSNP
rs140979905 1850 dbSNP
rs1388527044 1851 dbSNP
rs1436543800 1852 dbSNP
rs1322887565 1853 dbSNP
rs1329728302 1856 dbSNP
rs934210424 1857 dbSNP
rs1232019914 1860 dbSNP
rs1042350257 1861 dbSNP
rs754588854 1868 dbSNP
rs79907870 1871 dbSNP
rs1000875297 1876 dbSNP
rs1030505995 1878 dbSNP
rs144783657 1883 dbSNP
rs1421370527 1888 dbSNP
rs747870417 1889 dbSNP
rs894490026 1899 dbSNP
rs867701345 1902 dbSNP
rs1175765911 1905 dbSNP
rs777908497 1911 dbSNP
rs1032495636 1912 dbSNP
rs1298788741 1931 dbSNP
rs558094784 1932 dbSNP
rs1465289513 1933 dbSNP
rs777469710 1935 dbSNP
rs1293020543 1937 dbSNP
rs138562685 1938 dbSNP
rs993366226 1940 dbSNP
rs1450851283 1945 dbSNP
rs970675801 1946 dbSNP
rs577964541 1948 dbSNP
rs1252848644 1954 dbSNP
rs1469216271 1957 dbSNP
rs928505705 1960 dbSNP
rs985119967 1962 dbSNP
rs1479160515 1967 dbSNP
rs370695165 1967 dbSNP
rs374101804 1968 dbSNP
rs1157025568 1970 dbSNP
rs929257778 1973 dbSNP
rs964384946 1974 dbSNP
rs1325171364 1978 dbSNP
rs1458171477 1980 dbSNP
rs975796873 1981 dbSNP
rs546290960 1982 dbSNP
rs1360925046 1985 dbSNP
rs566086378 1989 dbSNP
rs1388979897 1990 dbSNP
rs538396245 1996 dbSNP
rs1324679434 2002 dbSNP
rs1336079756 2003 dbSNP
rs1224326472 2007 dbSNP
rs1038743356 2010 dbSNP
rs1240705801 2011 dbSNP
rs900269960 2016 dbSNP
rs1332452375 2027 dbSNP
rs34085168 2028 dbSNP
rs35005443 2030 dbSNP
rs1407684906 2031 dbSNP
rs1485712302 2032 dbSNP
rs1187333664 2037 dbSNP
rs977595821 2038 dbSNP
rs1474278224 2045 dbSNP
rs932959362 2049 dbSNP
rs1051396465 2052 dbSNP
rs35471664 2053 dbSNP
rs1156741512 2056 dbSNP
rs902213235 2059 dbSNP
rs1329264846 2060 dbSNP
rs551849552 2061 dbSNP
rs34066789 2072 dbSNP
rs1033043626 2073 dbSNP
rs1431113670 2073 dbSNP
rs1290298965 2080 dbSNP
rs1353129846 2082 dbSNP
rs1230109527 2083 dbSNP
rs1263575123 2086 dbSNP
rs1355613017 2087 dbSNP
rs893973792 2089 dbSNP
rs1210197603 2091 dbSNP
rs1356722753 2092 dbSNP
rs780409053 2093 dbSNP
rs1054718447 2094 dbSNP
rs1012830095 2095 dbSNP
rs1288481522 2097 dbSNP
rs551876862 2099 dbSNP
rs1045828227 2100 dbSNP
rs970812972 2101 dbSNP
rs994000309 2102 dbSNP
rs1161517108 2110 dbSNP
rs1175418709 2111 dbSNP
rs1407112383 2112 dbSNP
rs538032617 2113 dbSNP
rs887609448 2120 dbSNP
rs1006134665 2121 dbSNP
rs1376747793 2122 dbSNP
rs34975980 2122 dbSNP
rs769065108 2122 dbSNP
rs964333491 2133 dbSNP
rs1278316183 2134 dbSNP
rs774532931 2138 dbSNP
rs111973305 2140 dbSNP
rs555117767 2147 dbSNP
rs1307060230 2148 dbSNP
rs1281227389 2150 dbSNP
rs1444232458 2151 dbSNP
rs1202468088 2156 dbSNP
rs909160697 2164 dbSNP
rs878901184 2169 dbSNP
rs1350770661 2173 dbSNP
rs1470454282 2175 dbSNP
rs2843157 2180 dbSNP
rs974561543 2183 dbSNP
rs921663754 2189 dbSNP
rs1418209655 2192 dbSNP
rs1173910491 2196 dbSNP
rs1403840719 2197 dbSNP
rs1407759809 2198 dbSNP
rs933055649 2200 dbSNP
rs924766925 2202 dbSNP
rs1051491878 2204 dbSNP
rs923624673 2207 dbSNP
rs1333891728 2208 dbSNP
rs1245431891 2209 dbSNP
rs35771060 2210 dbSNP
rs1304473819 2219 dbSNP
rs1347372318 2224 dbSNP
rs1266925219 2233 dbSNP
rs935032525 2239 dbSNP
rs1212924283 2240 dbSNP
rs990385676 2241 dbSNP
rs534463117 2242 dbSNP
rs554209744 2244 dbSNP
rs577306431 2245 dbSNP
rs546360013 2246 dbSNP
rs1254251094 2248 dbSNP
rs562953183 2249 dbSNP
rs78207415 2251 dbSNP
rs1003615754 2257 dbSNP
rs1188870347 2259 dbSNP
rs544095553 2260 dbSNP
rs773183411 2261 dbSNP
rs113784820 2262 dbSNP
rs561101355 2263 dbSNP
rs185935070 2264 dbSNP
rs766229015 2273 dbSNP
rs529951326 2274 dbSNP
rs546871331 2280 dbSNP
rs373512735 2286 dbSNP
rs1220492595 2287 dbSNP
rs1431318348 2287 dbSNP
rs1271247948 2291 dbSNP
rs1300496631 2292 dbSNP
rs374374191 2294 dbSNP
rs974655960 2300 dbSNP
rs1396482000 2301 dbSNP
rs531967547 2302 dbSNP
rs117433242 2303 dbSNP
rs1192035859 2305 dbSNP
rs1227371873 2315 dbSNP
rs568634434 2316 dbSNP
rs1185131545 2317 dbSNP
rs987180781 2326 dbSNP
rs923690902 2327 dbSNP
rs999283380 2331 dbSNP
rs1032532588 2334 dbSNP
rs1399279750 2335 dbSNP
rs934976642 2339 dbSNP
rs1341335162 2341 dbSNP
rs1401964076 2341 dbSNP
rs1291504081 2345 dbSNP
rs1354801811 2346 dbSNP
rs758061101 2349 dbSNP
rs957550728 2349 dbSNP
rs1267077871 2351 dbSNP
rs1053873750 2353 dbSNP
rs1348321099 2357 dbSNP
rs537913341 2361 dbSNP
rs548508759 2365 dbSNP
rs191880690 2369 dbSNP
rs1254268124 2370 dbSNP
rs1284584123 2370 dbSNP
rs1489050034 2372 dbSNP
rs759240847 2373 dbSNP
rs916101936 2376 dbSNP
rs1180104996 2377 dbSNP
rs1045369759 2379 dbSNP
rs1475216618 2380 dbSNP
rs1201147596 2383 dbSNP
rs970260072 2388 dbSNP
rs376497744 2395 dbSNP
rs928645935 2397 dbSNP
rs112501347 2398 dbSNP
rs765176019 2402 dbSNP
rs1311226497 2403 dbSNP
rs1429864298 2409 dbSNP
rs1396642869 2410 dbSNP
rs1173541774 2411 dbSNP
rs373260464 2413 dbSNP
rs1005529379 2414 dbSNP
rs1466080304 2420 dbSNP
rs1309711298 2425 dbSNP
rs1355480705 2426 dbSNP
rs1017330418 2429 dbSNP
rs55795457 2430 dbSNP
rs996043205 2432 dbSNP
rs1201649276 2435 dbSNP
rs539818255 2438 dbSNP
rs758159228 2439 dbSNP
rs1028907430 2443 dbSNP
rs900344935 2444 dbSNP
rs1172045802 2445 dbSNP
rs954508286 2445 dbSNP
rs997352637 2452 dbSNP
rs796578888 2458 dbSNP
rs1466663496 2465 dbSNP
rs1052146971 2467 dbSNP
rs902171547 2471 dbSNP
rs140239034 2477 dbSNP
rs576474146 2478 dbSNP
rs1378845427 2480 dbSNP
rs1231740314 2486 dbSNP
rs1367113870 2488 dbSNP
rs1216499146 2493 dbSNP
rs1312379503 2494 dbSNP
rs956676767 2496 dbSNP
rs1299426627 2497 dbSNP
rs989266409 2497 dbSNP
rs1192124563 2500 dbSNP
rs1459389498 2500 dbSNP
rs1479990400 2500 dbSNP
rs542263613 2500 dbSNP
rs1252656934 2505 dbSNP
rs1311879997 2513 dbSNP
rs1234036493 2518 dbSNP
rs777369951 2532 dbSNP
rs1265148540 2537 dbSNP
rs554516592 2538 dbSNP
rs1371423070 2547 dbSNP
rs1032022676 2549 dbSNP
rs537756711 2551 dbSNP
rs1171324846 2552 dbSNP
rs574569241 2553 dbSNP
rs947734479 2560 dbSNP
rs1463880465 2561 dbSNP
rs981017309 2562 dbSNP
rs1248978617 2565 dbSNP
rs1367933349 2565 dbSNP
rs376886369 2567 dbSNP
rs1292914734 2568 dbSNP
rs1306442750 2568 dbSNP
rs1218663888 2570 dbSNP
rs1259327915 2572 dbSNP
rs1320589321 2573 dbSNP
rs868820061 2573 dbSNP
rs1012006847 2575 dbSNP
rs746546176 2582 dbSNP
rs1265213174 2583 dbSNP
rs1189883956 2588 dbSNP
rs1193144969 2591 dbSNP
rs1023105943 2594 dbSNP
rs778336754 2605 dbSNP
rs1194437355 2607 dbSNP
rs1433471561 2610 dbSNP
rs1425770694 2611 dbSNP
rs1459796565 2615 dbSNP
rs1164056224 2633 dbSNP
rs939472124 2636 dbSNP
rs1350252955 2638 dbSNP
rs751045438 2639 dbSNP
rs543688821 2643 dbSNP
rs559993982 2644 dbSNP
rs1279541920 2649 dbSNP
rs1342999675 2650 dbSNP
rs1159848032 2654 dbSNP
rs532247242 2655 dbSNP
rs941429790 2660 dbSNP
rs928904622 2662 dbSNP
rs950733417 2665 dbSNP
rs1259222201 2668 dbSNP
rs545411729 2670 dbSNP
rs1292786523 2673 dbSNP
rs1217511308 2676 dbSNP
rs1265440784 2683 dbSNP
rs1474226039 2685 dbSNP
rs1367162734 2689 dbSNP
rs1181238892 2696 dbSNP
rs1387569028 2702 dbSNP
rs1425388353 2703 dbSNP
rs34233545 2703 dbSNP
rs1156633321 2706 dbSNP
rs1344311938 2709 dbSNP
rs1038490112 2711 dbSNP
rs562464926 2712 dbSNP
rs531309400 2713 dbSNP
rs866043095 2715 dbSNP
rs548263163 2716 dbSNP
rs1380487786 2718 dbSNP
rs1230451156 2721 dbSNP
rs1305291046 2722 dbSNP
rs921758756 2723 dbSNP
rs1241152047 2724 dbSNP
rs890382969 2725 dbSNP
rs756578214 2726 dbSNP
rs1319307639 2728 dbSNP
rs933191669 2734 dbSNP
rs1051676836 2736 dbSNP
rs1031232219 2738 dbSNP
rs1365849509 2743 dbSNP
rs867825203 2744 dbSNP
rs1175326948 2747 dbSNP
rs1379469071 2748 dbSNP
rs1440005802 2748 dbSNP
rs541702583 2749 dbSNP
rs999469973 2752 dbSNP
rs1413450213 2753 dbSNP
rs1053825897 2754 dbSNP
rs1488566941 2756 dbSNP
rs1450831734 2759 dbSNP
rs1201152281 2760 dbSNP
rs989626627 2762 dbSNP
rs527870542 2763 dbSNP
rs1248926232 2765 dbSNP
rs893484833 2766 dbSNP
rs1376662798 2771 dbSNP
rs1022082567 2773 dbSNP
rs1471996539 2779 dbSNP
rs1023429347 2784 dbSNP
rs1279411470 2785 dbSNP
rs1313970666 2786 dbSNP
rs969003538 2788 dbSNP
rs906012111 2789 dbSNP
rs1003481275 2794 dbSNP
rs980440896 2798 dbSNP
rs1458065708 2799 dbSNP
rs1250821796 2800 dbSNP
rs1403598514 2801 dbSNP
rs951008586 2802 dbSNP
rs1473134372 2804 dbSNP
rs983722980 2804 dbSNP
rs1016182757 2805 dbSNP
rs928178876 2806 dbSNP
rs939565439 2807 dbSNP
rs1235643252 2813 dbSNP
rs1329630480 2815 dbSNP
rs983085354 2817 dbSNP
rs1275594723 2824 dbSNP
rs908697803 2826 dbSNP
rs922040827 2826 dbSNP
rs1257400204 2827 dbSNP
rs933422445 2829 dbSNP
rs548135200 2832 dbSNP
rs1450757160 2838 dbSNP
rs1199164515 2839 dbSNP
rs571180423 2840 dbSNP
rs1038824226 2842 dbSNP
rs1289541349 2843 dbSNP
rs899937853 2851 dbSNP
rs932624204 2857 dbSNP
rs935212534 2858 dbSNP
rs1224204850 2859 dbSNP
rs36195466 2862 dbSNP
rs868089655 2864 dbSNP
rs891147805 2867 dbSNP
rs1389035176 2868 dbSNP
rs1405095718 2871 dbSNP
rs1482556509 2872 dbSNP
rs1009214624 2874 dbSNP
rs1205246670 2874 dbSNP
rs1351813325 2875 dbSNP
rs1030951866 2880 dbSNP
rs1277627892 2881 dbSNP
rs1164780233 2891 dbSNP
rs867250145 2892 dbSNP
rs540102346 2893 dbSNP
rs1291318242 2895 dbSNP
rs1463058553 2895 dbSNP
rs1053744041 2896 dbSNP
rs1181228275 2899 dbSNP
rs893474804 2899 dbSNP
rs1414194797 2900 dbSNP
rs1396033428 2901 dbSNP
rs569571796 2901 dbSNP
rs7527543 2901 dbSNP
rs181984476 2902 dbSNP
rs1367185201 2903 dbSNP
rs570031596 2907 dbSNP
rs1418113540 2908 dbSNP
rs867978832 2909 dbSNP
rs1166531878 2910 dbSNP
rs1339769591 2910 dbSNP
rs1245324861 2911 dbSNP
rs1285719800 2913 dbSNP
rs1309442212 2913 dbSNP
rs1368936376 2915 dbSNP
rs1429429257 2916 dbSNP
rs1329551804 2918 dbSNP
rs1356371463 2919 dbSNP
rs1238985328 2923 dbSNP
rs1446400760 2928 dbSNP
rs1284157021 2931 dbSNP
rs1208072300 2932 dbSNP
rs1384238665 2933 dbSNP
rs1248597325 2934 dbSNP
rs1438178712 2934 dbSNP
rs1442347865 2934 dbSNP
rs1381123273 2935 dbSNP
rs1421636004 2938 dbSNP
rs1170887530 2939 dbSNP
rs1396553240 2940 dbSNP
rs1401477768 2940 dbSNP
rs1445713018 2940 dbSNP
rs1295947598 2947 dbSNP
rs1309596107 2947 dbSNP
rs1355368082 2948 dbSNP
rs1340938631 2951 dbSNP
rs1205444237 2953 dbSNP
rs1345021366 2955 dbSNP
rs1201558939 2967 dbSNP
rs1258807534 2969 dbSNP
rs1456753978 2970 dbSNP
rs1274434972 2972 dbSNP
rs1441762319 2973 dbSNP
rs1440223154 2976 dbSNP
rs1377146559 2977 dbSNP
rs1174269830 2978 dbSNP
rs1331789430 2978 dbSNP
rs1466581885 2978 dbSNP
rs1208862069 2979 dbSNP
rs1378730851 2985 dbSNP
rs1300113790 2986 dbSNP
rs1331197702 2988 dbSNP
rs1237959613 2989 dbSNP
rs1234749720 2992 dbSNP
rs1265584368 2995 dbSNP
rs535617600 3007 dbSNP
rs1189727048 3010 dbSNP
rs555818498 3010 dbSNP
rs1266885013 3014 dbSNP
rs1433893761 3015 dbSNP
rs1201057289 3016 dbSNP
rs1402227832 3016 dbSNP
rs1421482259 3016 dbSNP
rs1491496949 3016 dbSNP
rs1491293493 3017 dbSNP
rs1388075598 3019 dbSNP
rs1275741402 3024 dbSNP
rs1339202112 3024 dbSNP
rs868244671 3025 dbSNP
rs867090905 3026 dbSNP
rs1186444449 3027 dbSNP
rs1309658309 3028 dbSNP
rs891080379 3031 dbSNP
rs1265129706 3034 dbSNP
rs1488929419 3046 dbSNP
rs1389331142 3047 dbSNP
rs1163801155 3049 dbSNP
rs1449034755 3049 dbSNP
rs1477512317 3049 dbSNP
rs1368741361 3053 dbSNP
rs1459132188 3054 dbSNP
rs1168738771 3055 dbSNP
rs1295890497 3055 dbSNP
rs1299396066 3055 dbSNP
rs1359383774 3055 dbSNP
rs1364660445 3055 dbSNP
rs1227034991 3061 dbSNP
rs1322640169 3063 dbSNP
rs1248480794 3064 dbSNP
rs1217387395 3065 dbSNP
rs1421691569 3065 dbSNP
rs867271907 3066 dbSNP
rs1482227674 3069 dbSNP
rs1181152851 3084 dbSNP
rs1256597508 3087 dbSNP
rs1446190586 3090 dbSNP
rs998696441 3092 dbSNP
rs1159931741 3096 dbSNP
rs1419821497 3096 dbSNP
rs1412805992 3097 dbSNP
rs1333651014 3098 dbSNP
rs1302713468 3099 dbSNP
rs1380374224 3100 dbSNP
rs1454893406 3101 dbSNP
rs1307393814 3103 dbSNP
rs1286444482 3104 dbSNP
rs1209372288 3105 dbSNP
rs1237937553 3111 dbSNP
rs1462527609 3118 dbSNP
rs1176512557 3119 dbSNP
rs1407468515 3121 dbSNP
rs1439912856 3126 dbSNP
rs1455056585 3129 dbSNP
rs183394288 3130 dbSNP
rs1318883121 3134 dbSNP
rs1176035201 3137 dbSNP
rs112043297 3141 dbSNP
rs553517520 3142 dbSNP
rs1329709346 3143 dbSNP
rs367755915 3147 dbSNP
rs1447798454 3148 dbSNP
rs1281449502 3149 dbSNP
rs1342497582 3154 dbSNP
rs1218113072 3156 dbSNP
rs1365612333 3158 dbSNP
rs1263297863 3165 dbSNP
rs1325516424 3168 dbSNP
rs1279294530 3170 dbSNP
rs536885069 3170 dbSNP
rs1196592943 3172 dbSNP
rs1206762465 3172 dbSNP
rs112413214 3173 dbSNP
rs1169081698 3173 dbSNP
rs1430680691 3173 dbSNP
rs1481712714 3173 dbSNP
rs576736598 3173 dbSNP
rs1400063817 3183 dbSNP
rs35148324 3183 dbSNP
rs1247134992 3184 dbSNP
rs1348329919 3185 dbSNP
rs1435933838 3186 dbSNP
rs1275498888 3189 dbSNP
rs1347413046 3198 dbSNP
rs1216731655 3199 dbSNP
rs768975171 3202 dbSNP
rs1318365424 3203 dbSNP
rs1195112541 3206 dbSNP
rs1287373763 3214 dbSNP
rs1044823832 3217 dbSNP
rs1450669223 3217 dbSNP
rs1270418562 3218 dbSNP
rs1477196867 3219 dbSNP
rs1486997919 3220 dbSNP
rs545647733 3223 dbSNP
rs1430086592 3224 dbSNP
rs906253892 3227 dbSNP
rs1170004403 3228 dbSNP
rs562390109 3232 dbSNP
rs1471214080 3233 dbSNP
rs1303920300 3236 dbSNP
rs1367565674 3237 dbSNP
rs1003312293 3240 dbSNP
rs779276705 3242 dbSNP
rs1388596122 3243 dbSNP
rs1282223508 3247 dbSNP
rs1383101748 3248 dbSNP
rs1010742216 3249 dbSNP
rs1228563800 3251 dbSNP
rs187470528 3263 dbSNP
rs1350926258 3264 dbSNP
rs140141421 3266 dbSNP
rs558310035 3266 dbSNP
rs1263186099 3271 dbSNP
rs1448069371 3276 dbSNP
rs1195884602 3278 dbSNP
rs541593681 3280 dbSNP
rs1435316561 3288 dbSNP
rs969145854 3290 dbSNP
rs1164478685 3291 dbSNP
rs1283308664 3294 dbSNP
rs1387292944 3296 dbSNP
rs1325105448 3305 dbSNP
rs1226457455 3313 dbSNP
rs1267392464 3314 dbSNP
rs1383855330 3315 dbSNP
rs137933830 3318 dbSNP
rs1339676900 3320 dbSNP
rs748315769 3322 dbSNP
rs886615983 3323 dbSNP
rs1316765992 3325 dbSNP
rs1374196580 3326 dbSNP
rs1238869117 3338 dbSNP
rs1034673062 3339 dbSNP
rs1287473335 3341 dbSNP
rs1450025789 3353 dbSNP
rs960396257 3358 dbSNP
rs1277066622 3366 dbSNP
rs1005536258 3375 dbSNP
rs1442259708 3375 dbSNP
rs1016508465 3378 dbSNP
rs963327266 3379 dbSNP
rs1198994209 3380 dbSNP
rs1269646896 3382 dbSNP
rs1438076770 3384 dbSNP
rs772295142 3388 dbSNP
rs974688820 3390 dbSNP
rs1180163096 3391 dbSNP
rs1411853845 3401 dbSNP
rs1338442928 3402 dbSNP
rs908798273 3404 dbSNP
rs954920596 3407 dbSNP
rs987582162 3409 dbSNP
rs527350926 3410 dbSNP
rs1273626490 3411 dbSNP
rs1160593827 3412 dbSNP
rs1204798228 3413 dbSNP
rs548024321 3414 dbSNP
rs1265387631 3421 dbSNP
rs1456686909 3423 dbSNP
rs571014563 3424 dbSNP
rs1251487815 3429 dbSNP
rs1420999591 3430 dbSNP
rs1196841224 3431 dbSNP
rs1377059162 3442 dbSNP
rs935219338 3442 dbSNP
rs1178419769 3443 dbSNP
rs1397889828 3445 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' ------ccccacgcUGCUGCUa 3'
1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000378536.4 | 3UTR | CCCCACGCUGCUGCUAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer -0.32 1.6e-3 -0.227 2.0e-2 83 Click to see details
GSE26953 Aortic valvular endothelial cells -0.546 2.9e-3 -0.521 4.5e-3 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.499 1.3e-2 -0.686 4.2e-4 20 Click to see details
GSE38226 Liver fibrosis 0.476 1.5e-2 0.338 6.7e-2 21 Click to see details
GSE42095 Differentiated embryonic stem cells -0.453 1.5e-2 -0.510 6.5e-3 23 Click to see details
GSE19536 Breast cancer -0.198 2.4e-2 -0.203 2.1e-2 100 Click to see details
GSE28544 Breast cancer 0.366 3.9e-2 0.679 1.3e-4 24 Click to see details
GSE14794 Lymphoblastoid cells 0.185 4.0e-2 0.167 5.8e-2 90 Click to see details
GSE19783 ER- ER- breast cancer -0.195 4.3e-2 -0.212 3.0e-2 79 Click to see details
GSE17498 Multiple myeloma -0.205 1.0e-1 -0.056 3.7e-1 40 Click to see details
GSE21849 B cell lymphoma -0.205 1.4e-1 -0.093 3.2e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.302 1.6e-1 0.269 1.9e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.162 2.2e-1 0.106 3.1e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.075 2.8e-1 -0.009 4.7e-1 64 Click to see details
GSE32688 Pancreatic cancer -0.1 2.9e-1 0.082 3.3e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.098 3.2e-1 -0.168 2.1e-1 25 Click to see details
GSE17306 Multiple myeloma -0.058 3.5e-1 -0.175 1.1e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer -0.085 3.6e-1 -0.069 3.9e-1 20 Click to see details
GSE27834 Pluripotent stem cells 0.057 4.2e-1 0.135 3.1e-1 16 Click to see details
GSE19350 CNS germ cell tumors -0.039 4.5e-1 -0.217 2.5e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.039 4.5e-1 -0.217 2.5e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.602 0 -0.673 0 32 Click to see details
BLCA -0.543 0.01 -0.470 0.02 18 Click to see details
HNSC -0.354 0.01 -0.340 0.01 42 Click to see details
LIHC 0.286 0.02 0.256 0.04 49 Click to see details
COAD -0.662 0.04 -0.667 0.04 8 Click to see details
LUAD 0.401 0.1 0.629 0.01 12 Click to see details
CHOL -0.357 0.17 -0.383 0.15 9 Click to see details
ESCA 0.22 0.26 0.482 0.07 11 Click to see details
LUSC -0.086 0.3 -0.005 0.49 38 Click to see details
KIRP -0.06 0.37 -0.110 0.27 32 Click to see details
PRAD -0.045 0.38 -0.062 0.33 50 Click to see details
PCPG 0.315 0.4 0.500 0.33 3 Click to see details
UCEC -0.054 0.41 -0.118 0.32 19 Click to see details
CESC -0.26 0.42 -0.500 0.33 3 Click to see details
THCA 0.027 0.42 0.039 0.38 59 Click to see details
PAAD 0.098 0.45 0.400 0.3 4 Click to see details
KIRC -0.012 0.46 -0.023 0.43 68 Click to see details
KICH -0.01 0.48 -0.138 0.26 25 Click to see details
BRCA 0 0.5 -0.033 0.38 84 Click to see details
BRCA 0 0.5 -0.033 0.38 84 Click to see details
BRCA 0 0.5 -0.033 0.38 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1