miRTarBase - #MIRT137517 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RCOR1   
Synonyms COREST, RCOR
Description REST corepressor 1
Transcript NM_015156   
Expression
Putative miRNA Targets on RCOR1
3'UTR of RCOR1
(miRNA target sites are highlighted)
>RCOR1|NM_015156|3'UTR
   1 GAAACTGGTGGCTTTGAACACTTGGTGTGGACTACTGTGTTATCCGGGATATCAGGTATTATGAGACATCACCTAGCCAT
  81 CTGCATCACATCTCTCTGGACAAGCAGCTATTACCAAAAAAGGCATATACTTCCAGTCCTGTGCTCCATCTGCCTTAATT
 161 CTTTGCTCGTTCCTCCATGTTGGCGCCACTTCCCAGAGAGCTCCACTGCATCTCACACTCTGCCCACGTGCTGGGGAAGT
 241 CTCACGGCCTGCACATCTCTTGTGACTCTGGGAACCGCCTCTCCCGCCGGAGCCCCCGAGCCCCACCAATGGCAGCTCTT
 321 CCCAGTCAGCAGCTTCAGAGCAGGCAGTCTCCTTGGAAGGCCCGACTCTGTTCCTGCATGGCCTGCAGTTTCTACTTTGT
 401 GCATAGAGTCATTTTCAGAGTCACCGCGACCCTGTTGGCCTTCTAGAAAGTTTCTTTTGTTCTTTTCTGAGACAACCACC
 481 TAAGTGATAATACGCTTTTTTGGAAACTAATATATATTGCCAGACTGCATCATAACCTTTATCATGCCAAGCATCCTGAT
 561 GCAACTCACATTTCCCTAAACATGGGGTACAGTTATGATTTATAAATTGAGTTGGCTTAAATCTCCCTCTTCTCCCTTCC
 641 CAAGTGTTACAAAGATCATTTACTGCAACTGTCGTTGGACACTGTAGCTTAAAGGGAACGTGGACCTCAATGCTTTCTGC
 721 CTTCAACTTTTCAGCATTGTGACCCCAGGGTGGTTGCCACCCCATCTTTTCCTGACCCCCCCCACCCCCCCACCTCCAAG
 801 AGGTTCGGCCCACATCACTGTACCTGGTGCTTGTAAATTTGGAATTGGTGCCTTCTCCTTTTGGCAACCATGGTTATCAA
 881 TCCTTTTTCTGTTTTAGTGTCTTATTTCTTCTTTCAAGTTATTTGCTAGCCAAAGATGACATCACTGAGATTAGGAGACA
 961 GGGGAGAGCTTGCTGCAGATTCTGACAGTGCAGATTTTAAATGTCAGGATATTAGAATAGCTGGCGCTGGTTTATGAAAG
1041 CTGCGCGTTGTTCCGCGTTCTCTCGGTGTGCCTGGCCTTTTATGTGGCACTCTGTATGTCAGTTTGTGTCCTTCATGTGC
1121 TGATGTGATTACACAAACACCATGCACTCTCTTTTCATATCAGAGTACAGGACAGAGAAGTGATCAATGTATTGGTCTAG
1201 TGAGACTGAGATGAAAAGAAATAACCTACAGAGTGGTCTGTAATGCCTTTTGGTTGGACTGGGAACAAGTAAAAATTTCT
1281 AATAAACATTTTGAGACTTCCAGAATCACTTTTGTTATCTTATCAGACCATGGGCCTGCTGAGGGTTGAGCAGACAGCCT
1361 GCATTCTAACATACCCTGTTCCCACCCCACGGCCATTCAGACTGCACTCAATACGCTGAAGTCGCTTTTGTTGTTGTTGT
1441 TGTTGTTTGCATCATTTGGATTTTTTTCCTGCTTTCAATACCAAAAAAATGCAGATGCTTTAAGGCCTAAACAGAATTCT
1521 GAAGAATTTAAAATATGCAATTAAAGTTTGATATGTTTTGTCTCCCAAGCACCTTGTTTTTTGTTGTTGTTGTTGTTGTT
1601 GAAGTCAGCTGATTTTCTCTTTAGAAAGAGGGTCAGCTAGAAACCTAGGTTTTTTGGAATTGTAAATTTTTTTTTAGTAT
1681 AGTCTGGAGAGAAAGGTCATTCAAAAGGAAAGTACAATGGGACTTGCTGCCCTTCATCATCTCGTTCCCGTGCCAGGTGT
1761 GTGTTGGTCACGTAAAAGCCTGGGAAGCATCAGAGGAGTCCCGGATTGCTGCTGCTACCTGGAGACAGGGTTAGCAAAAT
1841 AACACTAGTGATGAGGGAGAGGCTTCTTTTCACCATAAGCCTGCTGTGTACACCGAGGGCGGCAGGAGAAGCATGGGAAG
1921 GAGTCAGCCTAAGTTTGCACATTGCATAAAGGGTACACTAAGGTATGAGCTGAAGCTTTAGGTTCTCCGTGCTTCCCTCA
2001 AGACCTCCTTCTTGCTAACAGAAGCAGTAGGCAATTGCTGCAGTGCGTTTCTCACCCTGCCAATAGGTCTGTCTGTATCT
2081 CTGTTAAGGAAAATAGCCTGGTCCCTCCTGGCAGTGCTTGGAAGCTTGATGCTAATTTTTATATAGCGTGGCAAACTGAC
2161 CAGCAGTGCCAGGCCTTGATCTGTATTCTGCACTATCCCTTTACTTGGTTCCTGGCACTGAATGGTCTCCAGCCCTGAAG
2241 AATCACGTGTGATCACAGCAGCTGACCTGGGCTTTCTCCCCGAGAGGAAGGGGCATGTCATTTTTATTTGACAGAGGGAA
2321 AATGGGAGCTGTCCTTGACTGCCTTTGTTGTGCTTTCCCGCGTAAGATAGCACTGTGTTTTAAACTGTTGCATTACACTG
2401 TCTTTGCAATGATGTAAATGTAAGAAATCACTTAGCTTTAAAAGCGCAGTGGTTTGATCTTATTTATATGAAGACTTTTT
2481 AACATATCAAGAATTAGGTGCATTGGCAGGTAGGGTTTGGGGTGTGATAACTGCTTCAGATGGAATGTTCACTTAAGCTT
2561 TGTCTTCTTAAAAATTATCAATGTGAATGTCATAATTATATATATTTTTGTGGAAAATTTTCTCCTAAGTATAAGTTATT
2641 GTGCAAAATATAGTGTCATTGATGCAAATAATAGTTTAACTTTTAGTTTAGAACTCCTAAAAGATATAAATTGTATTGCA
2721 TATGCATTAAAAGTTTGTTTTATTTAATTTTATGTAGATGTGTGAAGTGTTAGGTAAAATTTTTTTCACTTATCCATTTA
2801 AACACCTTGTTACTTGAATATTGTGTTGACTGGTCTGCAACAGTGATCCATTCTGTAATATAGCTCTTTTAACTGGGAAG
2881 GAACCACACCCCAGTTGTGCCGATTACATTAGTGTTGGCACACAGTCGGGTGCTAGTGTAACACAAATGCCGCGTTGTCT
2961 GGGTGTACAGTGTTTGTGGAGACGCCACTTCCTCAAAATGGTTTTTGATTGTTTTTAACCTATAAGACGTTCTGATGCTC
3041 ACAAACCTCTATTCAACACACAAAACAAACATGAAAAGGTAGTTAGTTGGGTTGTAACAGCTTACTGGGGTGGACTCATA
3121 AAACAGTGGCTTTCTGTTCATCTAAAGTTTCCTCAGATACCACAGACCACTGTTAAGTGTGCTCATTGTCACTTTAAATT
3201 TCAACGATACCCTATTTTTGTCATTCTAAATATCAGATGTACTATTGGTATAATTGCACACCAAAAATAAGCCAAACAGT
3281 GCATTACGCTAACTGGATCCCTGCTTTTATGTGAGCTAAGGAAAGATGGAGCCAACTCCAACGAGGGCCTCTTTTTCTCT
3361 CTTGTCTAGCCTGTTTCTAAACCGAATGATCCAGGATTCAAGCTTCTATTGTCAAGTGAAACTTTCCTCAGATGGACTCC
3441 AGGTAGCCAGGTCACCTAAACCTAGTGGTCCTGTGCGATGCTCTTTCTGCCAGTCCCTGAATCTCTGCAGCTTCTCTTAC
3521 CTGTCTTACCTGTAGTAAAGCACAATTGCAGTGGCGTCGCATTCAGAAGAAGGGAAGGTCAGCAGAGGCTATGCATGTTG
3601 TGTGATGATGAGTGTTTACAGCCACCTTCTCCTAAAACGAAATTTATACCGGGGTGGATAGTATTCCATTAGGTAGACTT
3681 ATCGACTTTGCTAAGTGCTTTTTAGACAGCTTAAAAAATTTTCAAGATTTTAAAAGATGTATAAGGTTAAGTTTGCAAAT
3761 ATAATGGAAATGCTGTATATCTTTTGAAGTGATGAAATCCACGTTGGAATTTTAAAGAAAATATGTTGTAATAATGCTGT
3841 TGTAAGTAATATTTTAATGTCTCTTTGCCTGTTTTCTATTTCAGCACATTCATTGTGGTGAATGTTCATAGCATTATAAC
3921 TGCTTAGCCATTGAATGATAACATTTGTTAGTGGAAATTGGAAAATTTATTTGTGAAATTCTGCAGAATTCATTTTTCTA
4001 TTTCCAATATTTGCTGAGGTTAAATAAAAATTTTCAAGCCATTGATGTAATAAAATATGAAATGAAAGCAAAAAAAAAAA
4081 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |: ||   || ||||||| 
Target 5' aggAGTCCCGGAT-TGCTGCTg 3'
1794 - 1814 146.00 -12.80
2
miRNA  3' guGU-UUGGUAAUAC----ACGACGau 5'
            || || || || |    ||||||  
Target 5' aaCAGAAGCAGTAGGCAATTGCTGCag 3'
2017 - 2043 134.00 -11.10
3
miRNA  3' gugUUUG-GUAAUA----CACGACGAu 5'
             |||: ::||:|     |||||:| 
Target 5' agaAAATATGTTGTAATAATGCTGTTg 3'
3816 - 3842 133.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26991870 26 COSMIC
COSN30447225 30 COSMIC
COSN31961041 30 COSMIC
COSN31495145 56 COSMIC
COSN30448913 74 COSMIC
COSN31492702 185 COSMIC
COSN19659879 784 COSMIC
COSN26481980 963 COSMIC
COSN31570437 1045 COSMIC
COSN29682672 1490 COSMIC
COSN1164487 1609 COSMIC
COSN17597774 1715 COSMIC
COSN22152256 2138 COSMIC
COSN23736532 2318 COSMIC
COSN8822096 2351 COSMIC
COSN28815666 2474 COSMIC
COSN28700107 2523 COSMIC
COSN31524436 2586 COSMIC
COSN30166923 2681 COSMIC
COSN26635726 2725 COSMIC
COSN31589756 2762 COSMIC
COSN19280275 2821 COSMIC
COSN31533100 2827 COSMIC
COSN16328285 2894 COSMIC
COSN8139621 2995 COSMIC
COSN28463041 3009 COSMIC
COSN31488210 3045 COSMIC
COSN8587989 3235 COSMIC
COSN30169794 3240 COSMIC
COSN31485241 3288 COSMIC
COSN26640529 3302 COSMIC
COSN31561806 3330 COSMIC
COSN29372385 3382 COSMIC
COSN30174639 3500 COSMIC
COSN8822097 3560 COSMIC
COSN31568310 3717 COSMIC
COSN6241403 3804 COSMIC
COSN14540070 3827 COSMIC
COSN31563053 3869 COSMIC
COSN31551277 4040 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753773375 2 dbSNP
rs1322206868 6 dbSNP
rs1235116854 11 dbSNP
rs765111166 12 dbSNP
rs1328303118 13 dbSNP
rs1232747037 26 dbSNP
rs1209583752 27 dbSNP
rs571083870 29 dbSNP
rs761922982 32 dbSNP
rs927922042 35 dbSNP
rs767632520 36 dbSNP
rs1256787476 38 dbSNP
rs750622609 44 dbSNP
rs1157673797 45 dbSNP
rs35703706 46 dbSNP
rs756291806 46 dbSNP
rs373986965 47 dbSNP
rs1208299418 48 dbSNP
rs539742580 49 dbSNP
rs1346553380 50 dbSNP
rs755368011 52 dbSNP
rs1327297767 55 dbSNP
rs1349695410 57 dbSNP
rs957217513 63 dbSNP
rs368325038 67 dbSNP
rs1449317060 68 dbSNP
rs1437934061 69 dbSNP
rs745598289 73 dbSNP
rs186355774 84 dbSNP
rs946942062 90 dbSNP
rs1051012722 93 dbSNP
rs532208768 102 dbSNP
rs569295194 111 dbSNP
rs1006563823 126 dbSNP
rs1040703628 128 dbSNP
rs1212455039 130 dbSNP
rs1424219262 139 dbSNP
rs1191614824 141 dbSNP
rs866557793 144 dbSNP
rs900806746 147 dbSNP
rs1270765000 156 dbSNP
rs994052929 169 dbSNP
rs535202035 170 dbSNP
rs190752876 174 dbSNP
rs1463641124 178 dbSNP
rs2295695 186 dbSNP
rs1211107969 189 dbSNP
rs1311929186 190 dbSNP
rs1183439223 194 dbSNP
rs1023878235 196 dbSNP
rs1231128626 197 dbSNP
rs1474842628 211 dbSNP
rs147934723 216 dbSNP
rs1433706454 228 dbSNP
rs557772790 229 dbSNP
rs982169754 230 dbSNP
rs1304160902 234 dbSNP
rs921426172 236 dbSNP
rs1358317266 244 dbSNP
rs1467288886 246 dbSNP
rs1171485999 247 dbSNP
rs1431447914 250 dbSNP
rs1329751360 256 dbSNP
rs531579152 261 dbSNP
rs956659208 267 dbSNP
rs1426755976 268 dbSNP
rs1440403207 277 dbSNP
rs1286329433 278 dbSNP
rs988541625 285 dbSNP
rs578031424 286 dbSNP
rs1233235925 287 dbSNP
rs998450799 288 dbSNP
rs182606768 289 dbSNP
rs1050627165 290 dbSNP
rs1226852729 292 dbSNP
rs576482289 296 dbSNP
rs542364643 298 dbSNP
rs1040735036 299 dbSNP
rs1022791360 301 dbSNP
rs971598566 302 dbSNP
rs900922841 304 dbSNP
rs1370957968 306 dbSNP
rs993886931 310 dbSNP
rs1237872248 321 dbSNP
rs1460434743 341 dbSNP
rs760126761 344 dbSNP
rs141619452 345 dbSNP
rs767903373 348 dbSNP
rs753173591 351 dbSNP
rs761066197 352 dbSNP
rs1425734765 360 dbSNP
rs1023487703 361 dbSNP
rs1184618435 363 dbSNP
rs796561562 364 dbSNP
rs186278757 365 dbSNP
rs1194541800 369 dbSNP
rs1489734425 369 dbSNP
rs982805282 377 dbSNP
rs1003638622 384 dbSNP
rs1244861447 388 dbSNP
rs573739701 395 dbSNP
rs909872174 399 dbSNP
rs1344393363 401 dbSNP
rs1229880594 408 dbSNP
rs956775428 410 dbSNP
rs962821822 411 dbSNP
rs988185419 412 dbSNP
rs866769560 421 dbSNP
rs1287457988 426 dbSNP
rs915195378 427 dbSNP
rs548017320 428 dbSNP
rs77691280 429 dbSNP
rs533479868 431 dbSNP
rs764419813 433 dbSNP
rs1161581106 435 dbSNP
rs1473058184 440 dbSNP
rs147063235 444 dbSNP
rs944907982 446 dbSNP
rs1269080988 450 dbSNP
rs924878674 450 dbSNP
rs934897761 451 dbSNP
rs976218767 451 dbSNP
rs117752332 457 dbSNP
rs1270765994 460 dbSNP
rs892800053 463 dbSNP
rs1220620122 474 dbSNP
rs1278950631 480 dbSNP
rs1329397084 482 dbSNP
rs75017083 494 dbSNP
rs1236606242 495 dbSNP
rs1208543716 496 dbSNP
rs1332613694 499 dbSNP
rs1301825497 508 dbSNP
rs1044504172 509 dbSNP
rs546940441 514 dbSNP
rs138253634 516 dbSNP
rs886385650 520 dbSNP
rs1157112464 526 dbSNP
rs565724103 528 dbSNP
rs534414473 537 dbSNP
rs1044970197 538 dbSNP
rs1378601262 543 dbSNP
rs905103751 551 dbSNP
rs1003418948 556 dbSNP
rs1250497505 557 dbSNP
rs780931735 559 dbSNP
rs557971125 561 dbSNP
rs1203019926 565 dbSNP
rs892561687 566 dbSNP
rs1346801238 593 dbSNP
rs1256400390 594 dbSNP
rs1010041433 597 dbSNP
rs1022296572 598 dbSNP
rs577894221 608 dbSNP
rs968419113 616 dbSNP
rs1299804046 627 dbSNP
rs986140593 637 dbSNP
rs537369004 640 dbSNP
rs1364548549 641 dbSNP
rs1017851340 642 dbSNP
rs1398041379 647 dbSNP
rs1172176880 654 dbSNP
rs966247884 655 dbSNP
rs1172338693 658 dbSNP
rs1362931792 659 dbSNP
rs1028799215 666 dbSNP
rs976251418 669 dbSNP
rs1169788577 674 dbSNP
rs919397739 675 dbSNP
rs8017727 676 dbSNP
rs1241040252 678 dbSNP
rs576520449 690 dbSNP
rs909559242 691 dbSNP
rs542164557 693 dbSNP
rs747939726 696 dbSNP
rs934951573 701 dbSNP
rs1044752726 711 dbSNP
rs775446971 727 dbSNP
rs1345548092 736 dbSNP
rs905136204 739 dbSNP
rs1346772977 743 dbSNP
rs1231723301 746 dbSNP
rs1276599661 755 dbSNP
rs1287939918 758 dbSNP
rs990321151 761 dbSNP
rs371613479 765 dbSNP
rs939220130 766 dbSNP
rs1204462511 770 dbSNP
rs1247148305 775 dbSNP
rs1282114140 775 dbSNP
rs11380772 776 dbSNP
rs11410469 776 dbSNP
rs1413252154 776 dbSNP
rs1424032031 776 dbSNP
rs1418040124 777 dbSNP
rs1429706684 777 dbSNP
rs1445349816 777 dbSNP
rs201782250 778 dbSNP
rs1201167953 780 dbSNP
rs1368678972 782 dbSNP
rs1253801794 784 dbSNP
rs1186785092 785 dbSNP
rs1253730833 785 dbSNP
rs888059958 785 dbSNP
rs1192098936 789 dbSNP
rs1205663130 790 dbSNP
rs1437145630 792 dbSNP
rs1004821533 793 dbSNP
rs1211713660 794 dbSNP
rs1056327533 795 dbSNP
rs1454677527 796 dbSNP
rs1357148359 797 dbSNP
rs1169181744 798 dbSNP
rs892253309 800 dbSNP
rs1231710589 801 dbSNP
rs34851392 804 dbSNP
rs1289342444 807 dbSNP
rs1383513364 808 dbSNP
rs1022834689 809 dbSNP
rs1326187444 811 dbSNP
rs1326009465 813 dbSNP
rs1406533087 821 dbSNP
rs903933112 824 dbSNP
rs1163695204 825 dbSNP
rs1369738622 837 dbSNP
rs572544648 839 dbSNP
rs1007539153 851 dbSNP
rs1017545209 858 dbSNP
rs906970922 859 dbSNP
rs1182619981 870 dbSNP
rs1311066619 874 dbSNP
rs938432490 878 dbSNP
rs1452205124 880 dbSNP
rs1238149102 881 dbSNP
rs541152439 883 dbSNP
rs1258882523 886 dbSNP
rs976281136 889 dbSNP
rs1269072247 896 dbSNP
rs1048057158 898 dbSNP
rs886272608 906 dbSNP
rs1277056753 919 dbSNP
rs1233139823 934 dbSNP
rs1437832076 940 dbSNP
rs1371037916 955 dbSNP
rs1006147264 960 dbSNP
rs1324612056 960 dbSNP
rs777426029 961 dbSNP
rs564368201 962 dbSNP
rs1026444479 964 dbSNP
rs74084139 976 dbSNP
rs776495782 978 dbSNP
rs1405550666 980 dbSNP
rs558635037 981 dbSNP
rs984970383 983 dbSNP
rs1192811466 988 dbSNP
rs1478296937 993 dbSNP
rs909664586 1000 dbSNP
rs879203195 1001 dbSNP
rs962475735 1012 dbSNP
rs898514430 1016 dbSNP
rs1191814094 1020 dbSNP
rs980463996 1027 dbSNP
rs1248803317 1031 dbSNP
rs1215343311 1044 dbSNP
rs926251231 1045 dbSNP
rs543724754 1047 dbSNP
rs748984206 1048 dbSNP
rs971860656 1051 dbSNP
rs563601098 1053 dbSNP
rs913810678 1055 dbSNP
rs770456102 1056 dbSNP
rs149149103 1057 dbSNP
rs1289038069 1058 dbSNP
rs549012282 1065 dbSNP
rs903963734 1066 dbSNP
rs1435163970 1068 dbSNP
rs773975481 1069 dbSNP
rs1171687901 1073 dbSNP
rs1451342138 1075 dbSNP
rs990373633 1076 dbSNP
rs1393071793 1077 dbSNP
rs565527641 1079 dbSNP
rs1304378741 1085 dbSNP
rs1484996222 1093 dbSNP
rs528221524 1095 dbSNP
rs1211261919 1097 dbSNP
rs1485554715 1099 dbSNP
rs551165730 1109 dbSNP
rs1231288869 1116 dbSNP
rs980204846 1125 dbSNP
rs928313780 1127 dbSNP
rs1459454491 1132 dbSNP
rs901813894 1134 dbSNP
rs758953942 1135 dbSNP
rs1390547705 1142 dbSNP
rs1304606841 1143 dbSNP
rs938469890 1161 dbSNP
rs1027018606 1166 dbSNP
rs1431583204 1169 dbSNP
rs1233844833 1170 dbSNP
rs1047434929 1172 dbSNP
rs143183206 1175 dbSNP
rs1006826469 1183 dbSNP
rs1016422565 1186 dbSNP
rs537207570 1188 dbSNP
rs1037642872 1193 dbSNP
rs776076244 1198 dbSNP
rs1475057511 1203 dbSNP
rs190751671 1205 dbSNP
rs926283819 1212 dbSNP
rs996097808 1213 dbSNP
rs567519332 1219 dbSNP
rs1203199891 1222 dbSNP
rs764509502 1231 dbSNP
rs1444546811 1234 dbSNP
rs536147351 1237 dbSNP
rs1354537377 1245 dbSNP
rs891087454 1253 dbSNP
rs1291175463 1254 dbSNP
rs1008735161 1259 dbSNP
rs1417861425 1264 dbSNP
rs1297545222 1267 dbSNP
rs76015769 1272 dbSNP
rs1473932218 1276 dbSNP
rs77721803 1279 dbSNP
rs945299759 1288 dbSNP
rs1373222434 1297 dbSNP
rs1043963911 1301 dbSNP
rs1184766769 1304 dbSNP
rs1461198122 1306 dbSNP
rs1420121536 1309 dbSNP
rs1250347613 1310 dbSNP
rs1175999873 1313 dbSNP
rs148280054 1314 dbSNP
rs74949278 1323 dbSNP
rs141249247 1324 dbSNP
rs146232369 1327 dbSNP
rs1353546122 1329 dbSNP
rs543566780 1331 dbSNP
rs1229935542 1332 dbSNP
rs1336146705 1333 dbSNP
rs959701203 1335 dbSNP
rs1389637101 1337 dbSNP
rs1369691921 1339 dbSNP
rs1047707437 1341 dbSNP
rs1326638680 1352 dbSNP
rs1461043642 1356 dbSNP
rs1392546789 1357 dbSNP
rs1161655170 1358 dbSNP
rs563539896 1363 dbSNP
rs907603468 1382 dbSNP
rs776089174 1383 dbSNP
rs1016845091 1385 dbSNP
rs905995430 1388 dbSNP
rs74084140 1391 dbSNP
rs1467645787 1392 dbSNP
rs183407184 1397 dbSNP
rs1206555035 1405 dbSNP
rs1051652544 1412 dbSNP
rs559327123 1415 dbSNP
rs1033467396 1416 dbSNP
rs528045326 1424 dbSNP
rs992263107 1425 dbSNP
rs1020590269 1428 dbSNP
rs1287459948 1428 dbSNP
rs577408404 1428 dbSNP
rs762604665 1428 dbSNP
rs1396145547 1431 dbSNP
rs1173581011 1434 dbSNP
rs1187726783 1434 dbSNP
rs967048169 1445 dbSNP
rs750527845 1452 dbSNP
rs1447194182 1456 dbSNP
rs1427457403 1479 dbSNP
rs1167840978 1483 dbSNP
rs746932091 1483 dbSNP
rs1379076640 1488 dbSNP
rs1435086258 1490 dbSNP
rs925117445 1495 dbSNP
rs1233502811 1517 dbSNP
rs1345764835 1521 dbSNP
rs551468703 1533 dbSNP
rs943241496 1534 dbSNP
rs571323333 1538 dbSNP
rs970212443 1547 dbSNP
rs530728147 1554 dbSNP
rs1035919956 1555 dbSNP
rs138047669 1562 dbSNP
rs1312767109 1574 dbSNP
rs567453236 1575 dbSNP
rs1372998937 1577 dbSNP
rs1433371824 1577 dbSNP
rs1257020538 1581 dbSNP
rs1258003535 1581 dbSNP
rs200468608 1581 dbSNP
rs536576254 1581 dbSNP
rs546279181 1581 dbSNP
rs762219583 1581 dbSNP
rs544288221 1584 dbSNP
rs1484635021 1588 dbSNP
rs566080878 1599 dbSNP
rs1196448482 1600 dbSNP
rs1293692608 1609 dbSNP
rs767473794 1613 dbSNP
rs1338842875 1615 dbSNP
rs559597199 1623 dbSNP
rs1235399803 1626 dbSNP
rs1483119423 1628 dbSNP
rs1356385546 1630 dbSNP
rs1037989027 1631 dbSNP
rs931804508 1633 dbSNP
rs987811200 1635 dbSNP
rs911836321 1638 dbSNP
rs1346278408 1639 dbSNP
rs1409981444 1644 dbSNP
rs1395170927 1649 dbSNP
rs1165752314 1658 dbSNP
rs1418179958 1667 dbSNP
rs1462664220 1667 dbSNP
rs878944032 1667 dbSNP
rs534671571 1669 dbSNP
rs906110141 1674 dbSNP
rs1053084084 1678 dbSNP
rs1001725490 1679 dbSNP
rs947478251 1680 dbSNP
rs752582293 1682 dbSNP
rs1270938554 1684 dbSNP
rs1184317987 1688 dbSNP
rs1043089307 1690 dbSNP
rs896249808 1690 dbSNP
rs1254427493 1694 dbSNP
rs1272861464 1695 dbSNP
rs142406233 1697 dbSNP
rs75913791 1698 dbSNP
rs1280597213 1700 dbSNP
rs537141200 1705 dbSNP
rs1328655889 1709 dbSNP
rs1334552871 1709 dbSNP
rs77550311 1710 dbSNP
rs1402274655 1714 dbSNP
rs1159741562 1716 dbSNP
rs45485304 1718 dbSNP
rs113970453 1724 dbSNP
rs1287199100 1738 dbSNP
rs116422370 1744 dbSNP
rs559759580 1745 dbSNP
rs1231166519 1748 dbSNP
rs973179330 1750 dbSNP
rs572804484 1751 dbSNP
rs953225964 1765 dbSNP
rs1369190510 1767 dbSNP
rs933421644 1772 dbSNP
rs983519066 1773 dbSNP
rs907941842 1803 dbSNP
rs987335486 1804 dbSNP
rs942080485 1806 dbSNP
rs1038087851 1808 dbSNP
rs544974236 1811 dbSNP
rs937548093 1829 dbSNP
rs145982076 1836 dbSNP
rs756989822 1840 dbSNP
rs377033145 1846 dbSNP
rs935251115 1847 dbSNP
rs1212953150 1848 dbSNP
rs1399967672 1851 dbSNP
rs778374997 1853 dbSNP
rs1378339643 1862 dbSNP
rs1175456228 1863 dbSNP
rs1274537505 1864 dbSNP
rs1468601883 1866 dbSNP
rs1394587166 1867 dbSNP
rs988015005 1872 dbSNP
rs1486957239 1881 dbSNP
rs1013761358 1882 dbSNP
rs562492429 1884 dbSNP
rs1445639892 1888 dbSNP
rs1250826007 1890 dbSNP
rs1235710901 1892 dbSNP
rs1347843752 1895 dbSNP
rs745390764 1896 dbSNP
rs1217027343 1901 dbSNP
rs902258720 1902 dbSNP
rs371620881 1906 dbSNP
rs187086423 1915 dbSNP
rs1031956626 1942 dbSNP
rs964613962 1946 dbSNP
rs371224253 1947 dbSNP
rs1374823679 1948 dbSNP
rs1407079910 1951 dbSNP
rs1174021055 1954 dbSNP
rs529816234 1956 dbSNP
rs1057306218 1958 dbSNP
rs895972227 1959 dbSNP
rs1186159186 1965 dbSNP
rs1005174335 1970 dbSNP
rs1260013728 1977 dbSNP
rs1015172594 1979 dbSNP
rs562620212 1986 dbSNP
rs1417280485 1987 dbSNP
rs1485624216 1989 dbSNP
rs45547632 1990 dbSNP
rs566604444 1996 dbSNP
rs1207339822 2002 dbSNP
rs139461966 2004 dbSNP
rs1273212948 2006 dbSNP
rs954599644 2007 dbSNP
rs1338017049 2011 dbSNP
rs1462066300 2016 dbSNP
rs1294874587 2030 dbSNP
rs983685279 2032 dbSNP
rs907975078 2035 dbSNP
rs1029048810 2047 dbSNP
rs953164475 2048 dbSNP
rs987586925 2048 dbSNP
rs1018817609 2054 dbSNP
rs1035228477 2055 dbSNP
rs1464245350 2057 dbSNP
rs1420369944 2064 dbSNP
rs1299104097 2065 dbSNP
rs963778697 2071 dbSNP
rs1475090158 2076 dbSNP
rs973414550 2078 dbSNP
rs988045942 2082 dbSNP
rs1465333835 2099 dbSNP
rs747568485 2101 dbSNP
rs1222583430 2102 dbSNP
rs915139814 2106 dbSNP
rs927255031 2113 dbSNP
rs149674687 2135 dbSNP
rs978797024 2142 dbSNP
rs1333902449 2145 dbSNP
rs1334915485 2146 dbSNP
rs375010428 2147 dbSNP
rs1393098570 2148 dbSNP
rs1374034312 2149 dbSNP
rs937483381 2155 dbSNP
rs8006699 2156 dbSNP
rs777204090 2161 dbSNP
rs561750329 2164 dbSNP
rs1042260664 2165 dbSNP
rs537173816 2170 dbSNP
rs1367123538 2171 dbSNP
rs940822446 2174 dbSNP
rs1036510560 2193 dbSNP
rs1000997101 2196 dbSNP
rs1204911528 2197 dbSNP
rs762073166 2208 dbSNP
rs1177458978 2220 dbSNP
rs1254427356 2223 dbSNP
rs900140725 2224 dbSNP
rs192258910 2228 dbSNP
rs574190213 2243 dbSNP
rs144382869 2247 dbSNP
rs1240995054 2248 dbSNP
rs1004746706 2250 dbSNP
rs888776983 2251 dbSNP
rs1237982737 2255 dbSNP
rs1373321300 2259 dbSNP
rs1008680398 2265 dbSNP
rs1440411023 2269 dbSNP
rs1015142377 2282 dbSNP
rs1164316057 2283 dbSNP
rs1411812019 2288 dbSNP
rs1157397335 2289 dbSNP
rs1411896843 2291 dbSNP
rs956561393 2294 dbSNP
rs1171504255 2298 dbSNP
rs1009372333 2310 dbSNP
rs963511762 2322 dbSNP
rs1022054160 2324 dbSNP
rs1408458302 2332 dbSNP
rs1486080378 2340 dbSNP
rs967943674 2342 dbSNP
rs973445734 2354 dbSNP
rs182918812 2360 dbSNP
rs573505759 2361 dbSNP
rs992826029 2362 dbSNP
rs1329556169 2363 dbSNP
rs1383068908 2374 dbSNP
rs1413559088 2374 dbSNP
rs545705729 2397 dbSNP
rs766494861 2410 dbSNP
rs1290941820 2428 dbSNP
rs113072246 2438 dbSNP
rs958946428 2445 dbSNP
rs148788175 2446 dbSNP
rs187938015 2447 dbSNP
rs1271903666 2453 dbSNP
rs756106990 2461 dbSNP
rs1375512773 2469 dbSNP
rs992951603 2478 dbSNP
rs917359076 2485 dbSNP
rs1262167896 2488 dbSNP
rs1305545398 2499 dbSNP
rs1212824210 2507 dbSNP
rs544341623 2510 dbSNP
rs990678684 2512 dbSNP
rs940727645 2513 dbSNP
rs1036542071 2515 dbSNP
rs915142073 2517 dbSNP
rs768772784 2519 dbSNP
rs936429400 2521 dbSNP
rs11548118 2523 dbSNP
rs900256750 2525 dbSNP
rs1253241102 2527 dbSNP
rs1476459039 2531 dbSNP
rs930949626 2538 dbSNP
rs1051109417 2541 dbSNP
rs1168710883 2548 dbSNP
rs1276673388 2548 dbSNP
rs1417084675 2563 dbSNP
rs931671327 2566 dbSNP
rs888815849 2575 dbSNP
rs1312820779 2579 dbSNP
rs1051363582 2586 dbSNP
rs1008960778 2587 dbSNP
rs890390575 2590 dbSNP
rs759083620 2592 dbSNP
rs1428155672 2597 dbSNP
rs1009235109 2599 dbSNP
rs1359947021 2600 dbSNP
rs1476066678 2603 dbSNP
rs1005183066 2604 dbSNP
rs775303608 2604 dbSNP
rs1014762836 2605 dbSNP
rs1440732608 2618 dbSNP
rs1196506523 2622 dbSNP
rs1252720174 2622 dbSNP
rs529904123 2624 dbSNP
rs1434670407 2626 dbSNP
rs1256406488 2630 dbSNP
rs898964646 2632 dbSNP
rs994659192 2633 dbSNP
rs1284086467 2634 dbSNP
rs1034457376 2640 dbSNP
rs1338100874 2645 dbSNP
rs967850124 2646 dbSNP
rs1446965756 2647 dbSNP
rs118166758 2652 dbSNP
rs1168106964 2655 dbSNP
rs992861770 2677 dbSNP
rs1327648084 2682 dbSNP
rs756937852 2695 dbSNP
rs1033998232 2696 dbSNP
rs1269212035 2697 dbSNP
rs1024691815 2705 dbSNP
rs1182534217 2708 dbSNP
rs960633645 2708 dbSNP
rs1457381048 2718 dbSNP
rs1236131252 2721 dbSNP
rs778661918 2722 dbSNP
rs1215824589 2723 dbSNP
rs1024278039 2730 dbSNP
rs1280821062 2736 dbSNP
rs377483951 2738 dbSNP
rs560288107 2742 dbSNP
rs1208610064 2743 dbSNP
rs532309718 2753 dbSNP
rs920796603 2754 dbSNP
rs1328817844 2761 dbSNP
rs1442606864 2762 dbSNP
rs1350158284 2764 dbSNP
rs1448800723 2764 dbSNP
rs1050376 2768 dbSNP
rs1403462378 2770 dbSNP
rs1194010016 2780 dbSNP
rs930793912 2781 dbSNP
rs1439123457 2782 dbSNP
rs978051209 2794 dbSNP
rs986422127 2795 dbSNP
rs552029112 2801 dbSNP
rs571326924 2806 dbSNP
rs1454865639 2810 dbSNP
rs745466142 2814 dbSNP
rs1222095534 2815 dbSNP
rs1246417667 2819 dbSNP
rs910812391 2820 dbSNP
rs1449106941 2826 dbSNP
rs944946435 2827 dbSNP
rs1216556703 2831 dbSNP
rs1352200657 2837 dbSNP
rs936198744 2839 dbSNP
rs1306426850 2841 dbSNP
rs1235930159 2844 dbSNP
rs1367862281 2851 dbSNP
rs552247404 2854 dbSNP
rs193205012 2858 dbSNP
rs1171335058 2862 dbSNP
rs1346780014 2864 dbSNP
rs34733381 2875 dbSNP
rs931700669 2889 dbSNP
rs1419000819 2892 dbSNP
rs1358613878 2898 dbSNP
rs79966930 2902 dbSNP
rs1400722244 2903 dbSNP
rs1189714030 2909 dbSNP
rs1043444682 2928 dbSNP
rs890095519 2929 dbSNP
rs569035210 2931 dbSNP
rs115519182 2947 dbSNP
rs1283166938 2949 dbSNP
rs144947055 2952 dbSNP
rs147917943 2953 dbSNP
rs1277432287 2954 dbSNP
rs141762137 2955 dbSNP
rs1024351698 2962 dbSNP
rs962031664 2970 dbSNP
rs1281157090 2976 dbSNP
rs1034176095 2980 dbSNP
rs894570234 2984 dbSNP
rs538031515 2986 dbSNP
rs1205748382 2988 dbSNP
rs1314658181 3001 dbSNP
rs74681622 3003 dbSNP
rs6611 3008 dbSNP
rs1174090944 3009 dbSNP
rs1215756544 3012 dbSNP
rs145438434 3021 dbSNP
rs1033721722 3023 dbSNP
rs1477048371 3024 dbSNP
rs957611901 3027 dbSNP
rs777209963 3029 dbSNP
rs748574531 3030 dbSNP
rs986715524 3037 dbSNP
rs975562641 3039 dbSNP
rs1207488797 3047 dbSNP
rs1308890701 3048 dbSNP
rs921394751 3050 dbSNP
rs1217732636 3062 dbSNP
rs944953922 3063 dbSNP
rs770001820 3075 dbSNP
rs1295004688 3077 dbSNP
rs976299059 3078 dbSNP
rs931751550 3079 dbSNP
rs1378407672 3080 dbSNP
rs78354301 3082 dbSNP
rs911633485 3084 dbSNP
rs945027422 3087 dbSNP
rs1462596556 3101 dbSNP
rs1326161754 3102 dbSNP
rs1043352400 3103 dbSNP
rs1423732327 3106 dbSNP
rs903615597 3107 dbSNP
rs773599590 3108 dbSNP
rs937743181 3110 dbSNP
rs574491998 3113 dbSNP
rs1197653405 3119 dbSNP
rs151075274 3121 dbSNP
rs541834554 3122 dbSNP
rs114785067 3124 dbSNP
rs1336229046 3130 dbSNP
rs1321043058 3133 dbSNP
rs1310491164 3136 dbSNP
rs1225480304 3140 dbSNP
rs1377785511 3143 dbSNP
rs1308671813 3152 dbSNP
rs764307316 3159 dbSNP
rs1238219495 3161 dbSNP
rs1444812112 3169 dbSNP
rs1286429460 3171 dbSNP
rs1013544010 3178 dbSNP
rs532144185 3188 dbSNP
rs545705287 3205 dbSNP
rs897852103 3206 dbSNP
rs562400775 3207 dbSNP
rs1273980739 3208 dbSNP
rs45560740 3213 dbSNP
rs1380339504 3229 dbSNP
rs550744337 3231 dbSNP
rs1208388124 3235 dbSNP
rs894287307 3237 dbSNP
rs1269102359 3238 dbSNP
rs1438805017 3240 dbSNP
rs185536431 3245 dbSNP
rs952234485 3246 dbSNP
rs117149727 3260 dbSNP
rs1218664380 3265 dbSNP
rs1007602430 3267 dbSNP
rs1238152704 3268 dbSNP
rs1373389102 3269 dbSNP
rs762548113 3274 dbSNP
rs140924102 3280 dbSNP
rs75751656 3284 dbSNP
rs375932003 3288 dbSNP
rs759552160 3289 dbSNP
rs999297911 3293 dbSNP
rs914175634 3297 dbSNP
rs764026056 3301 dbSNP
rs566022263 3305 dbSNP
rs1169341008 3315 dbSNP
rs766046551 3317 dbSNP
rs997033093 3319 dbSNP
rs1028462251 3336 dbSNP
rs924933924 3339 dbSNP
rs937799361 3340 dbSNP
rs539195142 3342 dbSNP
rs753680404 3343 dbSNP
rs559298033 3344 dbSNP
rs1285230276 3346 dbSNP
rs1214473459 3348 dbSNP
rs1294011411 3358 dbSNP
rs1036842435 3360 dbSNP
rs1232761664 3362 dbSNP
rs911669242 3364 dbSNP
rs961812620 3366 dbSNP
rs533130470 3384 dbSNP
rs1340490161 3385 dbSNP
rs920218426 3387 dbSNP
rs1049532770 3394 dbSNP
rs1403757973 3402 dbSNP
rs764990965 3409 dbSNP
rs887779943 3411 dbSNP
rs930564059 3422 dbSNP
rs538531240 3426 dbSNP
rs1172705277 3433 dbSNP
rs545843869 3438 dbSNP
rs1486959943 3439 dbSNP
rs556277859 3446 dbSNP
rs1055688889 3447 dbSNP
rs368998246 3462 dbSNP
rs150201916 3465 dbSNP
rs574354875 3472 dbSNP
rs1256921705 3473 dbSNP
rs1413815403 3473 dbSNP
rs1045563194 3477 dbSNP
rs539970816 3478 dbSNP
rs1194878775 3481 dbSNP
rs758195648 3482 dbSNP
rs903275783 3493 dbSNP
rs1021047216 3502 dbSNP
rs1373353312 3518 dbSNP
rs1461248373 3519 dbSNP
rs779843116 3534 dbSNP
rs966937312 3539 dbSNP
rs145715994 3542 dbSNP
rs979652813 3556 dbSNP
rs1054404689 3557 dbSNP
rs893110603 3559 dbSNP
rs996790946 3560 dbSNP
rs1332981001 3565 dbSNP
rs751129842 3571 dbSNP
rs990999742 3590 dbSNP
rs188016008 3592 dbSNP
rs949085974 3598 dbSNP
rs1394432109 3599 dbSNP
rs1008846320 3608 dbSNP
rs1297976871 3609 dbSNP
rs757574424 3610 dbSNP
rs1240206401 3618 dbSNP
rs918382231 3620 dbSNP
rs931256309 3621 dbSNP
rs1256546741 3629 dbSNP
rs1228077000 3640 dbSNP
rs1048296648 3651 dbSNP
rs576634405 3652 dbSNP
rs962102658 3654 dbSNP
rs374636866 3657 dbSNP
rs1158687716 3658 dbSNP
rs887802797 3660 dbSNP
rs1007579627 3669 dbSNP
rs1310871127 3673 dbSNP
rs192245791 3679 dbSNP
rs541968740 3683 dbSNP
rs140378269 3685 dbSNP
rs1391288968 3699 dbSNP
rs991133233 3703 dbSNP
rs1471828121 3705 dbSNP
rs1382214282 3707 dbSNP
rs1179401678 3711 dbSNP
rs915867875 3719 dbSNP
rs748649036 3721 dbSNP
rs981686478 3727 dbSNP
rs902683745 3728 dbSNP
rs924446896 3738 dbSNP
rs1452575458 3740 dbSNP
rs934755008 3747 dbSNP
rs1289745448 3771 dbSNP
rs868773356 3775 dbSNP
rs1206395960 3776 dbSNP
rs770299485 3778 dbSNP
rs1356534315 3780 dbSNP
rs893203792 3795 dbSNP
rs1287529456 3801 dbSNP
rs1001553161 3803 dbSNP
rs1470762749 3804 dbSNP
rs1448529554 3807 dbSNP
rs531539274 3809 dbSNP
rs544909557 3813 dbSNP
rs1186381316 3814 dbSNP
rs1331504554 3814 dbSNP
rs1032577466 3823 dbSNP
rs1049709411 3825 dbSNP
rs891379186 3829 dbSNP
rs990514057 3835 dbSNP
rs1378644191 3842 dbSNP
rs778066334 3842 dbSNP
rs1193172983 3843 dbSNP
rs1478500712 3850 dbSNP
rs1246463224 3863 dbSNP
rs1197274996 3864 dbSNP
rs1008439701 3883 dbSNP
rs1024611749 3892 dbSNP
rs1264542688 3894 dbSNP
rs750236349 3896 dbSNP
rs542090800 3909 dbSNP
rs897290932 3912 dbSNP
rs972472534 3919 dbSNP
rs1345339679 3941 dbSNP
rs995658748 3947 dbSNP
rs1438660512 3959 dbSNP
rs1357414636 3960 dbSNP
rs918454287 3961 dbSNP
rs1298755063 3965 dbSNP
rs931119150 3983 dbSNP
rs1464556843 3986 dbSNP
rs561148782 3995 dbSNP
rs1290744019 3999 dbSNP
rs561874475 4003 dbSNP
rs375112173 4008 dbSNP
rs991162992 4014 dbSNP
rs1022591424 4016 dbSNP
rs1174652251 4017 dbSNP
rs971739668 4029 dbSNP
rs145563493 4031 dbSNP
rs924511675 4032 dbSNP
rs934535856 4040 dbSNP
rs1211691787 4048 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.588 3.2e-3 0.702 2.8e-4 20 Click to see details
GSE32688 Pancreatic cancer 0.359 2.2e-2 0.498 1.9e-3 32 Click to see details
GSE21032 Prostate cancer 0.182 5.0e-2 0.162 7.2e-2 83 Click to see details
GSE21687 Ependynoma primary tumors -0.178 8.0e-2 -0.161 1.0e-1 64 Click to see details
GSE14794 Lymphoblastoid cells 0.14 9.4e-2 0.129 1.1e-1 90 Click to see details
GSE21849 B cell lymphoma 0.243 1.0e-1 0.286 6.6e-2 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.246 1.2e-1 -0.094 3.3e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.345 1.2e-1 -0.253 2.0e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.123 1.4e-1 0.159 8.1e-2 79 Click to see details
GSE28544 Breast cancer -0.216 1.6e-1 -0.560 2.2e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.233 1.6e-1 0.015 4.7e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.203 1.7e-1 0.211 1.6e-1 25 Click to see details
GSE19536 Breast cancer 0.069 2.5e-1 0.088 1.9e-1 100 Click to see details
GSE38226 Liver fibrosis 0.143 2.7e-1 0.078 3.7e-1 21 Click to see details
GSE17306 Multiple myeloma 0.07 3.2e-1 0.097 2.5e-1 49 Click to see details
GSE17498 Multiple myeloma 0.058 3.6e-1 -0.041 4.0e-1 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.052 4.0e-1 0.004 4.9e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.035 4.5e-1 0.106 3.5e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.009 4.9e-1 -0.406 9.5e-2 12 Click to see details
GSE19350 CNS germ cell tumors 0.009 4.9e-1 -0.406 9.5e-2 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.459 0 0.440 0 42 Click to see details
STAD 0.405 0.01 0.410 0.01 32 Click to see details
PRAD 0.178 0.11 0.015 0.46 50 Click to see details
LIHC 0.149 0.15 0.036 0.4 49 Click to see details
BLCA 0.226 0.18 0.226 0.18 18 Click to see details
CHOL -0.337 0.19 -0.283 0.23 9 Click to see details
PCPG -0.822 0.19 -1.000 0.5 3 Click to see details
PAAD 0.586 0.21 0.400 0.3 4 Click to see details
LUAD 0.169 0.3 0.273 0.2 12 Click to see details
LUSC -0.052 0.38 -0.117 0.24 38 Click to see details
UCEC 0.074 0.38 0.018 0.47 19 Click to see details
CESC 0.311 0.4 0.500 0.33 3 Click to see details
ESCA 0.084 0.4 -0.027 0.47 11 Click to see details
KICH 0.046 0.41 -0.016 0.47 25 Click to see details
KIRP -0.032 0.43 -0.040 0.41 32 Click to see details
COAD 0.039 0.46 0.190 0.33 8 Click to see details
BRCA -0.01 0.46 -0.064 0.28 84 Click to see details
THCA 0.006 0.48 -0.067 0.31 59 Click to see details
KIRC 0.003 0.49 0.025 0.42 68 Click to see details
KIRC 0.003 0.49 0.025 0.42 68 Click to see details
KIRC 0.003 0.49 0.025 0.42 68 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B </