miRTarBase - #MIRT148302 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RNF138   
Synonyms HSD-4, NARF, STRIN, hNARF
Description ring finger protein 138
Transcript NM_016271   
Other Transcripts NM_198128   
Expression
Putative miRNA Targets on RNF138
3'UTR of RNF138
(miRNA target sites are highlighted)
>RNF138|NM_016271|3'UTR
   1 AGGCTGTAGACATCTCTGCATCTTTGTACCTGCAAGTGCCATCTTTAAGGGGGAAACTACATGAAGTCACCGTTACAGTA
  81 ACTTGATGTGTATATTAATAAAAGTAATTCAGTCATTTTAGTTTTTGATTGAAAATAAAGGTAGGGCTTCTAAAAACTTC
 161 ATCATCTTGATAAGTTAAAAAATGAAAGTTATGACATTAGCTTTAAAGGTGTAAAAAAGATGTTTCACTAATGTAACGGT
 241 GAAAGAGAATCCCTGTTGTACTTTATCTTTTTGTAATATTATTTTTGAATTTTTCATTATTATGTTGCTTTTGAAATTTG
 321 ATGCATTCCTCCCATTTACTTTATTATTGTACACATTTAACACACAGTAGCAAATTTTGAACGATGTGATTGATATAACC
 401 TAACAAATCTGAGCCAGTTATTATTAGAGTTGCAGAATAGAAACTTGAAGTGCTAAATGGAATAATCCAAAGGAAATTTT
 481 TTAAATGCAGGTTCTAGCTGAAAAATTCAACTATAAGAAAATTGTATTTATATAACATTTACTATTTTTGAAGACTAGTG
 561 AGATTTCTGTAATAATTTTAATTCTTTAAAAAGTGAAAGCTTGTTGTAAAGATATTTTCTTTTTGTTATTAGAAGGAAAT
 641 ACAAAGAGAAAAATTTCTTTCTTTCATGGGCATTTGATAATTTCAGTCTTTGACTGATTTGTAAGCCTAGAATATACTAA
 721 GCTGAATAACAGCTCTTTGGCCTCAGAATTTTCAGTAGCCAGTATTTCTGATTAACTAAGTTGAAACTCTTATTAGAAAC
 801 TTTCAGTTGGTGATATTGTATTCTAGAAGATATAAATGAGAGGTTTGGCTTCATCTCAGTTTAGAAATTTATTCAAAGCT
 881 AAAGATGTATATATACATATACTTTTGTGTGTATATATACACATATGTGTGTATGCAGTTTGTCAGGTTATATATAGAAT
 961 TTCTATTAAGGATTTTTTAAATGGACAAGCAATAGGGGGTTGAAGTGTTTATCTGATTTGTTTAAAATTTTGTATATCAC
1041 CAAATTTTTAAAAAGTGATAGTCACAGTGCTAAGTTATCTAGTTGGCTACTATTACACCTTAAAAATTGAGTTTACACAC
1121 ACACAATTACCTGTTTATATGGTGCTCATTTGTTATTCTCAAATATAATGTGTGACCGTGATATAGTGAGAAAGATTCTA
1201 CCAACCACTGTTTCACTACTTTTTAGTTAAAATTGGGTATGTTCTTAATATTCATTAGTGAGAATCACAAAGTATTTTGT
1281 AGAAGGCCCAAATCACAGAATAAAGGACTAAGAGTGGATTTGCTGACATTCCATACTAATATACATTGTTTATGCTTTCT
1361 TTAAAATAACTAGAAGAACATAAAAGAAAGAGAATCTCAGAAGTAGTTTGCTGCTAATATATACATATATTGTATAAAAA
1441 GGTATATTTTGGTTTTGTTAAAACCCTTGTTGACTTTTCTACACTGAACATTTTTTTTAACTTGATTTAATAAAAATGTT
1521 AATTTTGGAAGTGCAGTTTTGTAAAAACCTTTTTCAGTCAAACAGTAAAGACTTTATTTATGGATTGTAATAACAACCAC
1601 AAGAAAAGCCATACATCTTAATGAACATACGCCTTTGTTCTGTCATTTTAAAGAGTGGTGTTTACTATGTGTGTGCTTGA
1681 GCATTTTCTTTCAGTTACATGGGTGTAATTTAAAAAACAGCTCCTTTTTAAGACTTTTGACCATAGTGTTTTCCAGTTTA
1761 AAGCAATAACTTTCATAGTTTCTTTCAAAGTTTAATACATCCAATATGTCAAGTTAAACCATTCTGGGATTTGCAAAGTT
1841 TAATACATCCAATATGTCAAGTTAAACCATTCTGGGATTTGCAAAGTTTAATACATCCAATATGTCAAGTTAAACCATTC
1921 TGGGATTTGGGAACTTCTTTAAAGGAAAATTGTAGTAGAGGTCATCTTGATGGAATTGTGTTTTAAAGTTTTGTGAATGA
2001 GTTAAATATCATTGATAGTCTTGTGTGTCTCACATATCAGCTTTTTCATAAGGAAAATACTTTATTTGCTTTTATCTGAG
2081 AATTTCTCAGTATGAAAATGATTGTTTAAAATTTCCCCTCTTTTTGTCAGTGCATTGGGAATAGGGATAGACTTTACAGA
2161 TTTATGGAAATTAAATTTATGGGGAAAAGTTTATTTTTAATATTACTTATAGCTGAGTCAGAATTAAAGGAGGGAATTGT
2241 ATTGATACTCCAATACCTAAATTTCACAATACCACTTAGGAAAGCTATTTCAACAAATTACAGTTTTATTGTTAAAACAG
2321 AGTCTTATTTGAGATGTATTGCTTTATTTTTCAATTAAAAGTGGTTTTCTCCTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAU-ACACGACGAu 5'
            ||:|  | || | ||||||| 
Target 5' ctCAGA--AGTAGTTTGCTGCTa 3'
1396 - 1416 152.00 -11.90
2
miRNA  3' guguuuGGUAAU-ACACGACGAu 5'
                :||||| | ||:|||| 
Target 5' aattttTCATTATTATGTTGCTt 3'
288 - 310 144.00 -11.60
3
miRNA  3' guGUU--UGG--UAAUACACGACGAu 5'
            |||  |||   |||| || |||| 
Target 5' caCAATTACCTGTTTATATGGTGCTc 3'
1122 - 1147 132.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30464988 41 COSMIC
COSN9330786 46 COSMIC
COSN30151496 51 COSMIC
COSN31520063 64 COSMIC
COSN30504049 70 COSMIC
COSN31585594 72 COSMIC
COSN31595440 113 COSMIC
COSN31544592 141 COSMIC
COSN17182677 203 COSMIC
COSN20114866 302 COSMIC
COSN20093420 322 COSMIC
COSN20093421 324 COSMIC
COSN21442510 396 COSMIC
COSN9836794 400 COSMIC
COSN30544702 455 COSMIC
COSN26550676 492 COSMIC
COSN31585815 505 COSMIC
COSN31568634 585 COSMIC
COSN31565229 649 COSMIC
COSN31549370 656 COSMIC
COSN31527983 662 COSMIC
COSN6119266 710 COSMIC
COSN31595442 720 COSMIC
COSN9330787 748 COSMIC
COSN31591105 840 COSMIC
COSN31519487 853 COSMIC
COSN31564936 906 COSMIC
COSN32069335 933 COSMIC
COSN26555458 943 COSMIC
COSN26549473 1000 COSMIC
COSN31607777 1609 COSMIC
COSN31591125 1631 COSMIC
COSN26650012 1721 COSMIC
COSN31588908 1725 COSMIC
COSN20114870 1734 COSMIC
COSN6119267 1742 COSMIC
COSN30164636 1783 COSMIC
COSN31567509 2000 COSMIC
COSN31563354 2002 COSMIC
COSN22599148 2156 COSMIC
COSN20114875 2193 COSMIC
COSN1737490 2196 COSMIC
COSN1737491 2207 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs776679074 3 dbSNP
rs762996635 6 dbSNP
rs1257287453 7 dbSNP
rs1291690096 8 dbSNP
rs199752645 11 dbSNP
rs774296897 12 dbSNP
rs533293892 13 dbSNP
rs1422079058 14 dbSNP
rs1428052470 16 dbSNP
rs1171216006 25 dbSNP
rs148608895 26 dbSNP
rs1464740935 27 dbSNP
rs774858657 28 dbSNP
rs898013143 30 dbSNP
rs767356050 33 dbSNP
rs1306405247 40 dbSNP
rs1295118964 41 dbSNP
rs1350886964 44 dbSNP
rs1325935772 52 dbSNP
rs1404136878 54 dbSNP
rs368247267 56 dbSNP
rs1394362208 61 dbSNP
rs1160490784 62 dbSNP
rs1473305191 71 dbSNP
rs1409043000 72 dbSNP
rs994293999 75 dbSNP
rs1368307779 76 dbSNP
rs1176283464 77 dbSNP
rs1248314108 78 dbSNP
rs1219074975 79 dbSNP
rs1451020930 109 dbSNP
rs1236098564 110 dbSNP
rs1268721452 112 dbSNP
rs1210436738 122 dbSNP
rs561426277 128 dbSNP
rs1286513934 141 dbSNP
rs1338534354 142 dbSNP
rs575291848 147 dbSNP
rs542697278 149 dbSNP
rs1277023762 157 dbSNP
rs1434788304 159 dbSNP
rs1370667619 167 dbSNP
rs1321813069 168 dbSNP
rs1212677686 171 dbSNP
rs1459233667 185 dbSNP
rs1385881082 189 dbSNP
rs777085414 192 dbSNP
rs1157731009 195 dbSNP
rs888221545 197 dbSNP
rs1006558530 210 dbSNP
rs1189054262 223 dbSNP
rs562302878 228 dbSNP
rs574260704 231 dbSNP
rs114242877 238 dbSNP
rs560103248 239 dbSNP
rs1438389095 263 dbSNP
rs1199331461 264 dbSNP
rs182265459 268 dbSNP
rs551490368 271 dbSNP
rs1031225491 277 dbSNP
rs1312799034 280 dbSNP
rs956554677 288 dbSNP
rs1217623791 291 dbSNP
rs36074374 296 dbSNP
rs57482240 296 dbSNP
rs1298783112 297 dbSNP
rs915325476 298 dbSNP
rs1363608060 300 dbSNP
rs150910685 302 dbSNP
rs200182726 302 dbSNP
rs143736933 303 dbSNP
rs969479672 313 dbSNP
rs1360353574 321 dbSNP
rs1166588100 322 dbSNP
rs1422257279 324 dbSNP
rs980706182 326 dbSNP
rs1390627854 328 dbSNP
rs1466649407 329 dbSNP
rs1324600334 330 dbSNP
rs1447635567 334 dbSNP
rs1260983100 335 dbSNP
rs1182335509 342 dbSNP
rs118156286 359 dbSNP
rs1483622992 363 dbSNP
rs1239223990 369 dbSNP
rs1209071162 374 dbSNP
rs547174848 383 dbSNP
rs1275851920 384 dbSNP
rs1231046844 389 dbSNP
rs1295542590 392 dbSNP
rs939575779 392 dbSNP
rs1257775988 396 dbSNP
rs1036629189 397 dbSNP
rs76056760 400 dbSNP
rs1300560307 402 dbSNP
rs1380778944 402 dbSNP
rs919529872 405 dbSNP
rs1428376642 409 dbSNP
rs1370763610 418 dbSNP
rs776240160 418 dbSNP
rs1339964595 421 dbSNP
rs1427615164 421 dbSNP
rs566496064 426 dbSNP
rs930809162 431 dbSNP
rs771735030 438 dbSNP
rs1425473566 439 dbSNP
rs1416137493 441 dbSNP
rs1185862986 446 dbSNP
rs530950926 453 dbSNP
rs1049297314 458 dbSNP
rs1332792974 464 dbSNP
rs1215722160 465 dbSNP
rs888187266 468 dbSNP
rs1223025593 475 dbSNP
rs1323994122 477 dbSNP
rs1310014350 478 dbSNP
rs1232172456 483 dbSNP
rs1350522200 490 dbSNP
rs1289839783 491 dbSNP
rs1407552294 516 dbSNP
rs1395580805 518 dbSNP
rs8096674 526 dbSNP
rs567153206 533 dbSNP
rs1459417662 543 dbSNP
rs1039346623 553 dbSNP
rs1164074695 558 dbSNP
rs1474941527 559 dbSNP
rs900853224 570 dbSNP
rs1484928994 578 dbSNP
rs998290095 586 dbSNP
rs1417549092 599 dbSNP
rs1250303330 601 dbSNP
rs1030901385 608 dbSNP
rs892418877 608 dbSNP
rs1271859203 613 dbSNP
rs528293665 614 dbSNP
rs1010689019 616 dbSNP
rs1236516216 616 dbSNP
rs546355774 626 dbSNP
rs1301781685 639 dbSNP
rs1325149213 643 dbSNP
rs969406077 643 dbSNP
rs980841617 645 dbSNP
rs571452494 648 dbSNP
rs1161417169 649 dbSNP
rs1163399999 653 dbSNP
rs1451955612 655 dbSNP
rs1199800268 656 dbSNP
rs1383771942 661 dbSNP
rs538920066 667 dbSNP
rs556722598 669 dbSNP
rs1038005971 671 dbSNP
rs1193622239 678 dbSNP
rs1035404793 681 dbSNP
rs568820003 686 dbSNP
rs567614913 689 dbSNP
rs1256262386 691 dbSNP
rs919514219 691 dbSNP
rs930924584 706 dbSNP
rs1340928645 711 dbSNP
rs1414039064 717 dbSNP
rs1291378306 719 dbSNP
rs1435770178 726 dbSNP
rs773390709 739 dbSNP
rs910724436 761 dbSNP
rs1039483545 773 dbSNP
rs942401170 773 dbSNP
rs1350189955 778 dbSNP
rs1467761719 784 dbSNP
rs1393729164 788 dbSNP
rs1173371332 790 dbSNP
rs1203643929 791 dbSNP
rs1250470403 792 dbSNP
rs900943678 794 dbSNP
rs536378623 799 dbSNP
rs1256175218 801 dbSNP
rs1488831607 808 dbSNP
rs762925397 811 dbSNP
rs1201884766 829 dbSNP
rs1052567344 834 dbSNP
rs1279397889 844 dbSNP
rs1256016154 845 dbSNP
rs892349048 849 dbSNP
rs1343988002 856 dbSNP
rs543675068 868 dbSNP
rs1268347848 877 dbSNP
rs766687853 881 dbSNP
rs1022062333 885 dbSNP
rs1187608536 886 dbSNP
rs1416901271 888 dbSNP
rs554725032 890 dbSNP
rs1451125967 900 dbSNP
rs572937945 901 dbSNP
rs1159960040 906 dbSNP
rs1392344600 906 dbSNP
rs1035091588 911 dbSNP
rs1473909490 912 dbSNP
rs961115946 912 dbSNP
rs751782557 914 dbSNP
rs1205343158 917 dbSNP
rs191653437 918 dbSNP
rs1026738672 919 dbSNP
rs1270598295 919 dbSNP
rs1195200265 920 dbSNP
rs776945265 923 dbSNP
rs1284914638 925 dbSNP
rs1310909453 927 dbSNP
rs148271161 928 dbSNP
rs759694854 939 dbSNP
rs1410609964 942 dbSNP
rs1356690094 943 dbSNP
rs1396578703 943 dbSNP
rs760288820 947 dbSNP
rs1327227898 948 dbSNP
rs1409960242 957 dbSNP
rs910693410 966 dbSNP
rs943501147 973 dbSNP
rs1473959051 982 dbSNP
rs1416466507 993 dbSNP
rs976697725 1006 dbSNP
rs1473351051 1010 dbSNP
rs922370761 1017 dbSNP
rs933745058 1034 dbSNP
rs763901615 1035 dbSNP
rs374136278 1036 dbSNP
rs1291940749 1041 dbSNP
rs946607765 1044 dbSNP
rs1272598825 1045 dbSNP
rs1375788392 1046 dbSNP
rs1043612541 1071 dbSNP
rs905140807 1071 dbSNP
rs1332003929 1072 dbSNP
rs1210595053 1075 dbSNP
rs571467710 1077 dbSNP
rs1056733951 1084 dbSNP
rs770411909 1085 dbSNP
rs1393150714 1090 dbSNP
rs775987995 1091 dbSNP
rs1486920119 1092 dbSNP
rs896534689 1093 dbSNP
rs1405360931 1095 dbSNP
rs1157562226 1099 dbSNP
rs993988796 1100 dbSNP
rs1248187676 1110 dbSNP
rs1026289277 1115 dbSNP
rs952037790 1115 dbSNP
rs753593263 1119 dbSNP
rs377526920 1127 dbSNP
rs765848334 1137 dbSNP
rs1201558890 1139 dbSNP
rs1249152381 1140 dbSNP
rs1209460282 1145 dbSNP
rs1006253736 1147 dbSNP
rs532683971 1154 dbSNP
rs1017869614 1163 dbSNP
rs964995735 1168 dbSNP
rs183429596 1170 dbSNP
rs757262354 1178 dbSNP
rs923436326 1179 dbSNP
rs955127964 1185 dbSNP
rs1321742365 1189 dbSNP
rs1432293979 1194 dbSNP
rs1342886910 1199 dbSNP
rs1380523181 1202 dbSNP
rs988310042 1208 dbSNP
rs187661874 1214 dbSNP
rs946365672 1217 dbSNP
rs750007597 1219 dbSNP
rs572712996 1229 dbSNP
rs926534158 1229 dbSNP
rs1240409410 1237 dbSNP
rs1056258549 1254 dbSNP
rs1443211394 1264 dbSNP
rs1282986154 1270 dbSNP
rs896325347 1271 dbSNP
rs879739699 1276 dbSNP
rs545677273 1277 dbSNP
rs1232569852 1282 dbSNP
rs993566069 1283 dbSNP
rs1299030524 1287 dbSNP
rs1216783485 1301 dbSNP
rs1395785169 1312 dbSNP
rs757842807 1318 dbSNP
rs565261797 1325 dbSNP
rs779640549 1334 dbSNP
rs141859704 1336 dbSNP
rs1006219500 1337 dbSNP
rs866821570 1343 dbSNP
rs1301649748 1345 dbSNP
rs1017627656 1346 dbSNP
rs1314331986 1352 dbSNP
rs1172510306 1353 dbSNP
rs1417544156 1355 dbSNP
rs1426634022 1355 dbSNP
rs964922251 1356 dbSNP
rs1234532047 1357 dbSNP
rs1251247246 1365 dbSNP
rs11333 1366 dbSNP
rs530912312 1368 dbSNP
rs1208949261 1372 dbSNP
rs1485561962 1372 dbSNP
rs1030471123 1374 dbSNP
rs1207287403 1374 dbSNP
rs1252228157 1374 dbSNP
rs550836831 1382 dbSNP
rs1228404787 1383 dbSNP
rs757460398 1383 dbSNP
rs1291084812 1385 dbSNP
rs1491492386 1387 dbSNP
rs1491413660 1388 dbSNP
rs746675179 1389 dbSNP
rs913649744 1389 dbSNP
rs989018599 1389 dbSNP
rs1165312139 1391 dbSNP
rs1420049012 1401 dbSNP
rs1186137215 1409 dbSNP
rs1197012701 1412 dbSNP
rs1474983982 1413 dbSNP
rs967804571 1415 dbSNP
rs1467721855 1416 dbSNP
rs979031727 1422 dbSNP
rs1251278337 1424 dbSNP
rs926294252 1430 dbSNP
rs937916881 1433 dbSNP
rs1270699523 1437 dbSNP
rs1232374900 1441 dbSNP
rs1191385494 1445 dbSNP
rs992495972 1448 dbSNP
rs542584389 1455 dbSNP
rs1389467047 1465 dbSNP
rs1372291745 1467 dbSNP
rs917867771 1473 dbSNP
rs1442980034 1475 dbSNP
rs1396831872 1480 dbSNP
rs1162870243 1481 dbSNP
rs1169568010 1484 dbSNP
rs1364609729 1487 dbSNP
rs1161509058 1490 dbSNP
rs1047631673 1491 dbSNP
rs1371256366 1491 dbSNP
rs929111605 1491 dbSNP
rs560057543 1498 dbSNP
rs1250662367 1499 dbSNP
rs1212538679 1502 dbSNP
rs1350683729 1507 dbSNP
rs942098697 1515 dbSNP
rs1039030034 1517 dbSNP
rs1303834988 1518 dbSNP
rs1172864667 1519 dbSNP
rs760605100 1520 dbSNP
rs1360446031 1522 dbSNP
rs900517431 1529 dbSNP
rs769826631 1535 dbSNP
rs750291050 1536 dbSNP
rs915214420 1544 dbSNP
rs945396472 1550 dbSNP
rs1324151555 1559 dbSNP
rs1042455396 1572 dbSNP
rs1451858456 1573 dbSNP
rs1387702863 1574 dbSNP
rs1455813901 1575 dbSNP
rs561063964 1575 dbSNP
rs1393814175 1578 dbSNP
rs1193517848 1585 dbSNP
rs906665755 1591 dbSNP
rs1306239806 1592 dbSNP
rs1447099713 1592 dbSNP
rs1203047297 1598 dbSNP
rs939515589 1600 dbSNP
rs1280849669 1612 dbSNP
rs1236233590 1613 dbSNP
rs1345384423 1616 dbSNP
rs1302614313 1623 dbSNP
rs1021755002 1625 dbSNP
rs190190736 1631 dbSNP
rs895321232 1632 dbSNP
rs1360149395 1642 dbSNP
rs1313642108 1659 dbSNP
rs995076592 1659 dbSNP
rs1437004766 1663 dbSNP
rs1373974327 1665 dbSNP
rs1173614659 1668 dbSNP
rs967732326 1671 dbSNP
rs1374361437 1676 dbSNP
rs1028337431 1677 dbSNP
rs886095504 1684 dbSNP
rs1211367585 1685 dbSNP
rs372034185 1689 dbSNP
rs991860820 1692 dbSNP
rs1484598791 1693 dbSNP
rs1004982009 1694 dbSNP
rs1488638060 1698 dbSNP
rs1196381324 1699 dbSNP
rs1185695650 1705 dbSNP
rs1341375121 1706 dbSNP
rs917820899 1712 dbSNP
rs1430191286 1715 dbSNP
rs1018704617 1720 dbSNP
rs1294160874 1721 dbSNP
rs965750822 1724 dbSNP
rs974491466 1725 dbSNP
rs201818453 1729 dbSNP
rs199886842 1730 dbSNP
rs146430117 1731 dbSNP
rs201369742 1731 dbSNP
rs59015789 1731 dbSNP
rs79115710 1733 dbSNP
rs1424354038 1735 dbSNP
rs373677086 1735 dbSNP
rs983244266 1735 dbSNP
rs942067562 1736 dbSNP
rs1039126932 1737 dbSNP
rs1417928448 1742 dbSNP
rs900609616 1744 dbSNP
rs768380742 1745 dbSNP
rs1256618892 1761 dbSNP
rs1351819632 1767 dbSNP
rs1458642847 1769 dbSNP
rs1439272886 1775 dbSNP
rs1270836573 1779 dbSNP
rs957443214 1783 dbSNP
rs60334586 1786 dbSNP
rs759855066 1786 dbSNP
rs1288616156 1792 dbSNP
rs1195109197 1793 dbSNP
rs1317425494 1800 dbSNP
rs1273854182 1802 dbSNP
rs1360340670 1804 dbSNP
rs1235442340 1805 dbSNP
rs1332941265 1813 dbSNP
rs1283755890 1818 dbSNP
rs933316612 1821 dbSNP
rs1051804517 1826 dbSNP
rs201330717 1834 dbSNP
rs1446661702 1835 dbSNP
rs892006655 1836 dbSNP
rs1166454522 1838 dbSNP
rs182784194 1839 dbSNP
rs1459365391 1841 dbSNP
rs990069803 1843 dbSNP
rs1412628424 1846 dbSNP
rs1158748443 1849 dbSNP
rs913163968 1852 dbSNP
rs186681147 1853 dbSNP
rs978530288 1855 dbSNP
rs1230911858 1863 dbSNP
rs1291468993 1868 dbSNP
rs1021722163 1883 dbSNP
rs1253768875 1883 dbSNP
rs904712279 1884 dbSNP
rs1467138468 1885 dbSNP
rs1321912210 1893 dbSNP
rs1224491598 1894 dbSNP
rs1353348074 1897 dbSNP
rs927978042 1901 dbSNP
rs939399217 1903 dbSNP
rs1240140044 1912 dbSNP
rs781718235 1917 dbSNP
rs1372384328 1918 dbSNP
rs748438666 1926 dbSNP
rs1001685390 1934 dbSNP
rs1033370442 1935 dbSNP
rs1055156482 1937 dbSNP
rs916718743 1941 dbSNP
rs1402052016 1951 dbSNP
rs770389519 1952 dbSNP
rs950670109 1955 dbSNP
rs1396815807 1961 dbSNP
rs1489154108 1965 dbSNP
rs1467211809 1974 dbSNP
rs1246177368 1976 dbSNP
rs1216862147 1985 dbSNP
rs1448945474 1989 dbSNP
rs1194213116 1998 dbSNP
rs1282357799 2003 dbSNP
rs1216355638 2005 dbSNP
rs1349000679 2008 dbSNP
rs983382565 2011 dbSNP
rs1366341600 2014 dbSNP
rs546435273 2014 dbSNP
rs1474217522 2016 dbSNP
rs886732770 2022 dbSNP
rs1004545891 2026 dbSNP
rs1040021777 2032 dbSNP
rs1432529676 2034 dbSNP
rs150187495 2038 dbSNP
rs1416093378 2041 dbSNP
rs995895339 2051 dbSNP
rs1376992386 2054 dbSNP
rs536962231 2055 dbSNP
rs1432491420 2056 dbSNP
rs1343734581 2058 dbSNP
rs749182385 2058 dbSNP
rs974614509 2060 dbSNP
rs1261342797 2061 dbSNP
rs1421905085 2061 dbSNP
rs922002144 2064 dbSNP
rs1282875506 2066 dbSNP
rs1375352639 2073 dbSNP
rs933426748 2077 dbSNP
rs1413518675 2084 dbSNP
rs1028775638 2091 dbSNP
rs1379289728 2093 dbSNP
rs913247958 2099 dbSNP
rs1359198942 2103 dbSNP
rs1054667 2112 dbSNP
rs1414992351 2115 dbSNP
rs763447189 2116 dbSNP
rs138106860 2118 dbSNP
rs1279400438 2119 dbSNP
rs1465311597 2119 dbSNP
rs1355045969 2121 dbSNP
rs1484627619 2121 dbSNP
rs1172401904 2122 dbSNP
rs1411753219 2131 dbSNP
rs770926306 2133 dbSNP
rs1421547913 2139 dbSNP
rs1193269626 2142 dbSNP
rs566558246 2152 dbSNP
rs1055977370 2153 dbSNP
rs1239226216 2158 dbSNP
rs1180490831 2160 dbSNP
rs1483090876 2165 dbSNP
rs1235378042 2167 dbSNP
rs570548282 2178 dbSNP
rs981327625 2179 dbSNP
rs1483623254 2180 dbSNP
rs1315576570 2183 dbSNP
rs34263941 2190 dbSNP
rs374772322 2190 dbSNP
rs3980844 2190 dbSNP
rs201727728 2194 dbSNP
rs1233592625 2195 dbSNP
rs894848447 2207 dbSNP
rs1013356664 2211 dbSNP
rs1395276992 2214 dbSNP
rs1441833593 2214 dbSNP
rs1373727693 2219 dbSNP
rs1299867296 2223 dbSNP
rs1439896411 2234 dbSNP
rs1398287632 2235 dbSNP
rs1159600504 2237 dbSNP
rs1170040136 2241 dbSNP
rs1461978158 2242 dbSNP
rs550829938 2246 dbSNP
rs1025033003 2247 dbSNP
rs950352749 2250 dbSNP
rs1409142818 2252 dbSNP
rs1179501186 2253 dbSNP
rs1456819128 2255 dbSNP
rs1394884628 2262 dbSNP
rs1433344691 2267 dbSNP
rs1213778233 2270 dbSNP
rs1469390261 2272 dbSNP
rs531620961 2274 dbSNP
rs1016188704 2280 dbSNP
rs927945539 2288 dbSNP
rs974538884 2292 dbSNP
rs1222064175 2300 dbSNP
rs185527218 2310 dbSNP
rs1296001637 2318 dbSNP
rs532642480 2319 dbSNP
rs987584136 2324 dbSNP
rs1302355088 2327 dbSNP
rs1457563418 2337 dbSNP
rs1346225507 2338 dbSNP
rs1161714059 2342 dbSNP
rs1438150993 2343 dbSNP
rs1380262008 2347 dbSNP
rs188787840 2355 dbSNP
rs536266441 2356 dbSNP
rs1345487400 2365 dbSNP
rs916677538 2366 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17306 Multiple myeloma 0.492 1.7e-4 0.432 9.7e-4 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.681 4.7e-4 0.770 3.6e-5 20 Click to see details
GSE21032 Prostate cancer 0.28 5.2e-3 0.234 1.7e-2 83 Click to see details
GSE21849 B cell lymphoma 0.399 1.6e-2 0.334 3.8e-2 29 Click to see details
GSE27834 Pluripotent stem cells -0.442 4.3e-2 -0.388 6.9e-2 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.344 4.6e-2 0.291 7.9e-2 25 Click to see details
GSE28260 Renal cortex and medulla -0.479 4.9e-2 -0.495 4.3e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.337 5.8e-2 0.265 1.1e-1 23 Click to see details
GSE38226 Liver fibrosis 0.254 1.3e-1 0.247 1.4e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer -0.202 2.0e-1 -0.293 1.0e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.176 2.0e-1 -0.269 9.7e-2 25 Click to see details
GSE17498 Multiple myeloma -0.135 2.0e-1 0.020 4.5e-1 40 Click to see details
GSE19536 Breast cancer 0.08 2.1e-1 0.059 2.8e-1 100 Click to see details
GSE14794 Lymphoblastoid cells 0.077 2.4e-1 0.079 2.3e-1 90 Click to see details
GSE28544 Breast cancer 0.133 2.7e-1 0.507 5.7e-3 24 Click to see details
GSE19783 ER- ER- breast cancer 0.049 3.3e-1 0.101 1.9e-1 79 Click to see details
GSE21687 Ependynoma primary tumors 0.028 4.1e-1 0.041 3.7e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.039 4.5e-1 -0.182 2.9e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.005 4.9e-1 -0.058 3.9e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.004 4.9e-1 0.155 2.0e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.004 4.9e-1 0.155 2.0e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA -0.588 0.03 -0.582 0.03 11 Click to see details
KIRC 0.187 0.06 0.173 0.08 68 Click to see details
PCPG -0.933 0.12 -0.500 0.33 3 Click to see details
LUSC 0.187 0.13 0.253 0.06 38 Click to see details
KICH 0.214 0.15 0.198 0.17 25 Click to see details
CHOL 0.383 0.15 0.350 0.18 9 Click to see details
BRCA -0.109 0.16 -0.068 0.27 84 Click to see details
LIHC 0.139 0.17 0.106 0.23 49 Click to see details
LUAD -0.229 0.24 -0.063 0.42 12 Click to see details
THCA 0.095 0.24 0.043 0.37 59 Click to see details
KIRP 0.129 0.24 0.100 0.29 32 Click to see details
PRAD 0.101 0.24 0.173 0.11 50 Click to see details
PAAD 0.476 0.26 0.400 0.3 4 Click to see details
COAD -0.254 0.27 -0.381 0.18 8 Click to see details
STAD 0.074 0.34 0.026 0.44 32 Click to see details
CESC 0.412 0.36 0.500 0.33 3 Click to see details
UCEC -0.082 0.37 -0.165 0.25 19 Click to see details
HNSC 0.029 0.43 0.066 0.34 42 Click to see details
BLCA -0.007 0.49 0.160 0.26 18 Click to see details
BLCA -0.007 0.49 0.160 0.26 18 Click to see details
BLCA -0.007 0.49 0.160 0.26 18 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*