miRTarBase - #MIRT152503 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ENTPD6   
Synonyms CD39L2, IL-6SAG, IL6ST2, NTPDase-6, dJ738P15.3
Description ectonucleoside triphosphate diphosphohydrolase 6 (putative)
Transcript NM_001114089   
Other Transcripts NM_001247   
Expression
Putative miRNA Targets on ENTPD6
3'UTR of ENTPD6
(miRNA target sites are highlighted)
>ENTPD6|NM_001114089|3'UTR
   1 TGGCCGAGCCATCCCTGTCCCCGTCAGCAGTGTCTGTGTGTCTGCATAAACCCTCCTGTCCTGGACGTGACTTCATCCTG
  81 AGGAGCCACAGCACAGGCCGTGCTGGCACTTTCTGCACACTGGCTCTGGGACTTGCAGAAGGCCTGGTGCTGCCCTGGCA
 161 TCAGCCTCTTCCAGTCACATCTGGCCAGAGGGCTGTCTGGACCTGGGCCCTGCTCAATGCCACCTGTCTGCCTGGGCTCC
 241 AAGTGGGCAGGACCAGGACAGAACCACAGGCACACACTGAGGGGGCAGTGTGGCTCCCTGCCTGTCCCATCCCCATGCCC
 321 CGTCCGCGGGGCTGTGGCTGCTGCTGTGCATGTCCCTGCGATGGGAGTCTTGTCTCCCAGCCTGTCAGTTTCCTCCCCAG
 401 GGCAGAGCTCCCCTTCCTGCAAGAGTCTGGGAGGCGGTGCAGGCTGTCCTGGCTGCTCTGGGGAAGCCGAGGGACAGCCA
 481 TAACACCCCCGGGACAGTAGGTCTGGGCGGCACCACTGGGAACTCTGGACTTGAGTGTGTTTGCCTCTTCCTTGGGTATG
 561 AATGTGTGAGTTCACCCAGAGGCCTGCTCTCCTCACACATTGTGTGGTTTGGGGTTAATGATGGAGGGAGACACCTCCTC
 641 ATAGACGGCAGGTGCCCACCTTTCAGGGAGTCTCCCAGCATGGGCGGATGCCGGGCATGAGCTGCTGTAAACTATTTGTG
 721 GCTGTGCTGCTTGAGTGACGTCTCTGTCGTGTGGGTGCCAAGTGCTTGTGTAGAAACTGTGTTCTGAGCCCCCTTTTCTG
 801 GACACCAACTGTGTCCTGTGAATGTATCGCTACTGTGAGCTGTTCCCGCCTAGCCAGGGCCATGTCTTAGGTGCAGCTGT
 881 GCCACGGGTCAGCTGAGCCACAGTCCCAGAACCAAGCTCTCGGTGTCTCGGGCCACCATCCGCCCACCTCGGGCTGACCC
 961 CACCTCCTCCATGGACAGTGTGAGCCCCGGGCCGTGCATCCTGCTCAGTGTGGCGTCAGTGTCGGGGCTGAGCCCCTTGA
1041 GCTGCTTCAGTGAATGTACAGTGCCCGGCACGAGCTGAACCTCATGTGTTCCACTCCCAATAAAAGGTTGACAGGGGCTT
1121 CTCCTTCTCTGGGATTCCTCTCGTTGAGCGACAGTAGCATTTGCCCACCTGGCACCTGAGATCCCTGTTTACTAAACCTT
1201 AGAAAAGCTGCCAAAGGGGGTGGCGTATTTCCAGTCCTGTCGACATCCCTCTCGAGGACACAGCAGTGGAGGGCCCCTGG
1281 GGGCTGGGGCTGGTGAAGGGTCTGGCTGGTGGCCCCGGCCCTCCCAGCGTCTGTTGAGCACAGCTCCTCCTGTGCCAGGC
1361 CAGCAGCCCACAGCACGGCCAGGTGAGGCCTGGGCACATAACCTCGAGTGAGCTGCAAGTCCCCATGTCATTCTGTTCAG
1441 CAAGGATCTGGTTTTGGTCTGGAAGCGTCCCAAAGGTGTCGCATGCCAGGGAAACTGCAGACCAGCCCACATCCCGAGTG
1521 CTTGTGCCTGAAGCCCCCCCCAACCAACTGTCACAGGAGGACAGGATCTGGCCCTAGGGCCTCCCAGGGCTGCAGCGAAT
1601 GCTGATGGAGCCACGTGGTGGAGGCCTGCACAGAGCAGGAAAGGACAAAAGACAAAAAGAGGAACAGTTTCCTCCCTCCC
1681 GCCTGGGCTGGGTCCCCACCAGCGCCTTTACTTCCATAATATCCACCAGCTTAAATATTTAAAGAACTCCGGAGGCTGAG
1761 AATCAGACGCATGAAGGTAAAGCCAAAATCAATTTGGTCCATTTAAAGAAGGTCGGTGACCTCATGCCTGAAAAAGGCAA
1841 ACAACTGGAAGTTTTCCAAAAGTGCACCAAATAAGTCATGGAATATTTCTGGGCCCGGCAAAGTATGCAAGTCATTTCTC
1921 TCTGAGTGTCTTTTGTGATAATGAAGTAGGCTCTCATTTGTCAAAAATAGCTACACGTGCACATCGTAAAAGAAGCAAAC
2001 TAGGGTTGCTTGAAAATTCTGTTCCCTCAGGATGTGTGCATTGACAAGCTCAGACAGGTCTCACACGCCCCACATGCCAC
2081 CCCAGCCCGCGTACCCCACATCACTTAGCACCCATTGCTGCCCACTGAGCTGCCTCAGTCCTGCAGTCCCCGTGTTTGGA
2161 TGGCAGGATCCCAGGGCAGTGAGTTTCAGGGCATAAGCAGACGTTGCCACGTTGCCTTCAATCCTACTGGACAAGCATCG
2241 GTGCTGGCCTCCCCCATGTCCTAACAGCTACAGCCAGTTTAATCTTTGCCATTCTGGCAGATTTAAAAAAATGATAACTG
2321 GTAGTTTTAATATGCATGGATCTAATTCATCGGGTATATCTAAGTTGTATTTCCGTGAAACATCTGTTCATATCCCTTGC
2401 CGATTTTCTATAAGATTGTCATCATTTTTTTGTTAATTGTAGATCTTTATTTATTAAGGAAATTATCCCATTATGATAAA
2481 AAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAA-----UACACGACGAu 5'
            :||||:|||      ||||||||| 
Target 5' tgTAAACTATTTGTGGCTGTGCTGCTt 3'
706 - 732 168.00 -18.40
2
miRNA  3' guguuugguaAUAC--ACGACGAu 5'
                    |:||  ||||||| 
Target 5' tccgcggggcTGTGGCTGCTGCTg 3'
323 - 346 146.00 -17.90
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            || ::| ||| |||| ||| 
Target 5' gcCATGTC-TTAGGTGCAGCTg 3'
859 - 879 131.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19727886 6 COSMIC
COSN30118407 7 COSMIC
COSN30132346 10 COSMIC
COSN30483377 14 COSMIC
COSN13851756 15 COSMIC
COSN31509799 23 COSMIC
COSN30514912 52 COSMIC
COSN30481884 62 COSMIC
COSN30151583 70 COSMIC
COSN31541595 100 COSMIC
COSN25166850 101 COSMIC
COSN30740840 101 COSMIC
COSN31523852 109 COSMIC
COSN28639335 169 COSMIC
COSN28639191 173 COSMIC
COSN16587316 258 COSMIC
COSN17076300 262 COSMIC
COSN28201522 577 COSMIC
COSN17819366 583 COSMIC
COSN31538987 686 COSMIC
COSN31540605 745 COSMIC
COSN32065025 814 COSMIC
COSN31550183 858 COSMIC
COSM8883812 975 COSMIC
COSM8948804 1004 COSMIC
rs1044573 422 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1189300100 2 dbSNP
rs749363862 4 dbSNP
rs868523230 5 dbSNP
rs768912575 6 dbSNP
rs375534753 7 dbSNP
rs762031283 9 dbSNP
rs1462181560 12 dbSNP
rs1171595048 14 dbSNP
rs1373415982 15 dbSNP
rs781601685 18 dbSNP
rs1313224742 22 dbSNP
rs575260179 23 dbSNP
rs773014634 24 dbSNP
rs925873589 28 dbSNP
rs1465278017 29 dbSNP
rs957996165 31 dbSNP
rs760565839 36 dbSNP
rs112287117 37 dbSNP
rs913983437 38 dbSNP
rs945495609 41 dbSNP
rs766269868 48 dbSNP
rs1041593918 56 dbSNP
rs6050459 58 dbSNP
rs932827972 63 dbSNP
rs1465884682 64 dbSNP
rs111670539 67 dbSNP
rs532578891 68 dbSNP
rs1005220295 73 dbSNP
rs776222344 87 dbSNP
rs552707742 100 dbSNP
rs907416732 101 dbSNP
rs1239551003 108 dbSNP
rs1200934333 110 dbSNP
rs112358702 117 dbSNP
rs1318977213 119 dbSNP
rs1014027755 140 dbSNP
rs1024493120 142 dbSNP
rs562257189 155 dbSNP
rs1358625500 157 dbSNP
rs969887263 158 dbSNP
rs1001781989 160 dbSNP
rs1003250657 163 dbSNP
rs1374961296 173 dbSNP
rs1206296362 181 dbSNP
rs1333544755 183 dbSNP
rs1032850564 193 dbSNP
rs553434656 204 dbSNP
rs1349046233 216 dbSNP
rs6037063 218 dbSNP
rs1162642103 223 dbSNP
rs531263649 225 dbSNP
rs6132818 233 dbSNP
rs894926001 247 dbSNP
rs1012391298 253 dbSNP
rs1437218549 260 dbSNP
rs6050460 265 dbSNP
rs1180241491 266 dbSNP
rs567714530 283 dbSNP
rs1178823039 285 dbSNP
rs968299907 288 dbSNP
rs1020937682 290 dbSNP
rs1246467606 299 dbSNP
rs527624665 301 dbSNP
rs1453828011 307 dbSNP
rs1291133545 312 dbSNP
rs1239534489 313 dbSNP
rs1351532974 314 dbSNP
rs1311775613 315 dbSNP
rs976836177 320 dbSNP
rs547359540 322 dbSNP
rs922687762 323 dbSNP
rs932798178 326 dbSNP
rs185084020 327 dbSNP
rs539272286 328 dbSNP
rs556355160 329 dbSNP
rs1361863349 338 dbSNP
rs941623453 361 dbSNP
rs1171512827 375 dbSNP
rs1354789265 381 dbSNP
rs1465210150 382 dbSNP
rs1310619864 387 dbSNP
rs1356824170 388 dbSNP
rs150898594 402 dbSNP
rs1479176729 408 dbSNP
rs867512479 414 dbSNP
rs1216467899 417 dbSNP
rs1487370053 421 dbSNP
rs1044573 422 dbSNP
rs555044834 432 dbSNP
rs34001350 434 dbSNP
rs574728348 436 dbSNP
rs41310173 437 dbSNP
rs1299397599 440 dbSNP
rs1220764693 446 dbSNP
rs554187659 448 dbSNP
rs1277534360 451 dbSNP
rs1398047186 459 dbSNP
rs940859224 468 dbSNP
rs1032839162 469 dbSNP
rs1208992551 470 dbSNP
rs1465049187 474 dbSNP
rs370828235 475 dbSNP
rs1357083160 476 dbSNP
rs1177726238 479 dbSNP
rs1416545902 480 dbSNP
rs1430378731 483 dbSNP
rs1193632859 486 dbSNP
rs577429980 491 dbSNP
rs140344699 492 dbSNP
rs781066952 502 dbSNP
rs1010086621 509 dbSNP
rs1254521939 510 dbSNP
rs928908253 514 dbSNP
rs1240895159 530 dbSNP
rs1020173608 531 dbSNP
rs1216795064 536 dbSNP
rs370436061 553 dbSNP
rs1056165734 556 dbSNP
rs531350467 562 dbSNP
rs541514636 571 dbSNP
rs1376294002 576 dbSNP
rs561380043 580 dbSNP
rs776949636 584 dbSNP
rs1043875225 590 dbSNP
rs1170400146 597 dbSNP
rs1464341264 598 dbSNP
rs879086713 600 dbSNP
rs1431738938 601 dbSNP
rs1423366950 615 dbSNP
rs879308792 628 dbSNP
rs761749219 633 dbSNP
rs941528516 638 dbSNP
rs1044577 639 dbSNP
rs1237723251 643 dbSNP
rs1376847616 647 dbSNP
rs903562653 648 dbSNP
rs769814883 652 dbSNP
rs1030783974 653 dbSNP
rs1343413818 658 dbSNP
rs901796038 659 dbSNP
rs972950826 660 dbSNP
rs6037064 662 dbSNP
rs750582952 667 dbSNP
rs41297634 671 dbSNP
rs1231729139 673 dbSNP
rs1402877476 676 dbSNP
rs1299292932 684 dbSNP
rs984772443 687 dbSNP
rs1016802608 694 dbSNP
rs1167008865 698 dbSNP
rs1445250557 715 dbSNP
rs756132829 740 dbSNP
rs905603600 741 dbSNP
rs766673932 743 dbSNP
rs1250940209 749 dbSNP
rs937113509 750 dbSNP
rs754083394 763 dbSNP
rs1449287330 778 dbSNP
rs6050461 779 dbSNP
rs3180935 785 dbSNP
rs189598636 791 dbSNP
rs142692437 799 dbSNP
rs991753874 801 dbSNP
rs1379652373 804 dbSNP
rs916132319 805 dbSNP
rs947713197 807 dbSNP
rs1389220345 810 dbSNP
rs1267631571 824 dbSNP
rs1295749153 827 dbSNP
rs569854435 829 dbSNP
rs147340977 830 dbSNP
rs748469819 831 dbSNP
rs1441762675 833 dbSNP
rs7453 842 dbSNP
rs1052241038 843 dbSNP
rs1350296992 846 dbSNP
rs998191032 848 dbSNP
rs997274446 849 dbSNP
rs1029331907 859 dbSNP
rs1487704258 860 dbSNP
rs1175157498 870 dbSNP
rs1406830160 871 dbSNP
rs889038244 872 dbSNP
rs955429549 874 dbSNP
rs1254995578 875 dbSNP
rs368077357 886 dbSNP
rs564336301 887 dbSNP
rs1006956168 888 dbSNP
rs1385959800 891 dbSNP
rs1172173613 900 dbSNP
rs1363090939 902 dbSNP
rs1379133086 907 dbSNP
rs1200132120 912 dbSNP
rs1424012033 922 dbSNP
rs1485185716 923 dbSNP
rs1195233979 925 dbSNP
rs1308546221 930 dbSNP
rs745443934 931 dbSNP
rs1035749285 937 dbSNP
rs111429623 942 dbSNP
rs35444749 942 dbSNP
rs1278694778 943 dbSNP
rs1224732903 944 dbSNP
rs991634066 946 dbSNP
rs1276791787 951 dbSNP
rs916186808 952 dbSNP
rs972898600 954 dbSNP
rs1333816461 957 dbSNP
rs767724731 960 dbSNP
rs750847864 962 dbSNP
rs1394497479 963 dbSNP
rs1408116670 967 dbSNP
rs918841168 972 dbSNP
rs1313024259 977 dbSNP
rs979536847 978 dbSNP
rs1358817998 980 dbSNP
rs972089468 989 dbSNP
rs1172678702 990 dbSNP
rs981114718 994 dbSNP
rs1236358091 995 dbSNP
rs1185031859 998 dbSNP
rs181262533 1015 dbSNP
rs372122121 1016 dbSNP
rs375156176 1019 dbSNP
rs554098516 1020 dbSNP
rs3203849 1023 dbSNP
rs1392918311 1024 dbSNP
rs933155752 1025 dbSNP
rs766976186 1030 dbSNP
rs753898606 1037 dbSNP
rs1185044741 1045 dbSNP
rs373146739 1049 dbSNP
rs1242619552 1050 dbSNP
rs914327650 1056 dbSNP
rs530352948 1060 dbSNP
rs549958214 1067 dbSNP
rs1006120135 1068 dbSNP
rs901747599 1072 dbSNP
rs997866420 1073 dbSNP
rs1410448362 1075 dbSNP
rs1412528041 1079 dbSNP
rs897842539 1081 dbSNP
rs1050383394 1082 dbSNP
rs546086389 1085 dbSNP
rs1177593709 1089 dbSNP
rs767941003 1097 dbSNP
rs1236717748 1099 dbSNP
rs1451553086 1101 dbSNP
rs1207326005 1107 dbSNP
rs1438907641 1112 dbSNP
rs1289724841 1114 dbSNP
rs1406464097 1117 dbSNP
rs111503612 1118 dbSNP
rs1361632391 1121 dbSNP
rs1239663596 1124 dbSNP
rs754988870 1124 dbSNP
rs962826446 1125 dbSNP
rs1374453933 1127 dbSNP
rs1281064327 1134 dbSNP
rs556381727 1141 dbSNP
rs6115092 1143 dbSNP
rs114923017 1144 dbSNP
rs879786422 1150 dbSNP
rs796328739 1152 dbSNP
rs982075646 1153 dbSNP
rs1271951204 1154 dbSNP
rs41282326 1163 dbSNP
rs958329063 1164 dbSNP
rs115723997 1166 dbSNP
rs924835383 1167 dbSNP
rs1301300365 1169 dbSNP
rs1214422086 1172 dbSNP
rs989814959 1188 dbSNP
rs1474221053 1198 dbSNP
rs1292568255 1199 dbSNP
rs1216244567 1213 dbSNP
rs1190002994 1218 dbSNP
rs548475305 1219 dbSNP
rs1286534440 1220 dbSNP
rs1418430222 1221 dbSNP
rs185490470 1226 dbSNP
rs1273058493 1228 dbSNP
rs774135099 1229 dbSNP
rs1406685611 1239 dbSNP
rs1345668462 1241 dbSNP
rs1041535573 1242 dbSNP
rs987726389 1243 dbSNP
rs1346626830 1248 dbSNP
rs73341103 1252 dbSNP
rs933181538 1254 dbSNP
rs1424870376 1255 dbSNP
rs1197956824 1257 dbSNP
rs1444500420 1262 dbSNP
rs1270141523 1267 dbSNP
rs1050736007 1272 dbSNP
rs889041560 1273 dbSNP
rs1312423835 1274 dbSNP
rs1487320963 1277 dbSNP
rs569805498 1278 dbSNP
rs1244088178 1280 dbSNP
rs1006892260 1283 dbSNP
rs933073452 1286 dbSNP
rs1038411838 1300 dbSNP
rs1276242053 1302 dbSNP
rs1225048236 1303 dbSNP
rs1162228110 1314 dbSNP
rs533114889 1316 dbSNP
rs1277434640 1317 dbSNP
rs994274269 1318 dbSNP
rs1340407063 1319 dbSNP
rs1289141707 1320 dbSNP
rs1225746071 1325 dbSNP
rs941830154 1329 dbSNP
rs550081896 1330 dbSNP
rs1430637909 1334 dbSNP
rs559655029 1347 dbSNP
rs761591811 1348 dbSNP
rs897706894 1355 dbSNP
rs1003048791 1357 dbSNP
rs1483050899 1359 dbSNP
rs1279078003 1362 dbSNP
rs772102394 1370 dbSNP
rs1205360044 1377 dbSNP
rs563500402 1378 dbSNP
rs1257391609 1386 dbSNP
rs1212360829 1391 dbSNP
rs958983861 1396 dbSNP
rs1308804499 1397 dbSNP
rs1258189239 1398 dbSNP
rs1295664446 1400 dbSNP
rs1427830921 1406 dbSNP
rs1190835205 1407 dbSNP
rs1374581891 1409 dbSNP
rs989762436 1413 dbSNP
rs1173263733 1414 dbSNP
rs895931074 1420 dbSNP
rs1393449137 1426 dbSNP
rs189754014 1436 dbSNP
rs968924704 1439 dbSNP
rs1171239000 1440 dbSNP
rs6083783 1441 dbSNP
rs1313522385 1460 dbSNP
rs1384933601 1467 dbSNP
rs967034905 1468 dbSNP
rs549168434 1481 dbSNP
rs77841281 1482 dbSNP
rs1481576813 1484 dbSNP
rs6050462 1490 dbSNP
rs1220214118 1492 dbSNP
rs1356590879 1500 dbSNP
rs986019709 1515 dbSNP
rs1302281052 1516 dbSNP
rs547523434 1517 dbSNP
rs1235923997 1518 dbSNP
rs1280404851 1519 dbSNP
rs1389971236 1530 dbSNP
rs1289066399 1534 dbSNP
rs910260106 1534 dbSNP
rs570816292 1536 dbSNP
rs1203319243 1537 dbSNP
rs1038360104 1540 dbSNP
rs1379844226 1540 dbSNP
rs112947738 1541 dbSNP
rs6138542 1541 dbSNP
rs1190520461 1546 dbSNP
rs1192731999 1546 dbSNP
rs1393544971 1555 dbSNP
rs1222500584 1557 dbSNP
rs1352546898 1562 dbSNP
rs929972043 1565 dbSNP
rs1047553632 1570 dbSNP
rs1174400035 1572 dbSNP
rs766402964 1578 dbSNP
rs1057176868 1586 dbSNP
rs895834414 1589 dbSNP
rs1003446771 1597 dbSNP
rs556418625 1598 dbSNP
rs867697800 1600 dbSNP
rs1044491654 1606 dbSNP
rs1324281214 1607 dbSNP
rs904565210 1612 dbSNP
rs1405567166 1614 dbSNP
rs1442643647 1615 dbSNP
rs1157004529 1616 dbSNP
rs1301457408 1631 dbSNP
rs894712987 1636 dbSNP
rs1479419191 1638 dbSNP
rs1270887526 1641 dbSNP
rs753920775 1648 dbSNP
rs892072342 1649 dbSNP
rs1259286170 1652 dbSNP
rs1021845015 1654 dbSNP
rs966983274 1662 dbSNP
rs1206507641 1664 dbSNP
rs1353369395 1667 dbSNP
rs1261677322 1671 dbSNP
rs998413330 1672 dbSNP
rs1177355425 1679 dbSNP
rs1285688710 1681 dbSNP
rs1262452935 1682 dbSNP
rs1405657740 1684 dbSNP
rs977116323 1688 dbSNP
rs1029843929 1698 dbSNP
rs8115257 1699 dbSNP
rs1384121360 1702 dbSNP
rs765493205 1704 dbSNP
rs986355715 1705 dbSNP
rs1467993082 1707 dbSNP
rs910409732 1715 dbSNP
rs1470043582 1721 dbSNP
rs535662711 1742 dbSNP
rs1477239661 1748 dbSNP
rs941858442 1751 dbSNP
rs973285836 1752 dbSNP
rs1447226785 1753 dbSNP
rs1417422363 1758 dbSNP
rs919180525 1761 dbSNP
rs1203452851 1765 dbSNP
rs973261206 1767 dbSNP
rs1184046452 1769 dbSNP
rs919073981 1770 dbSNP
rs753183897 1772 dbSNP
rs1364931147 1793 dbSNP
rs1461368779 1797 dbSNP
rs929966432 1800 dbSNP
rs1327270769 1806 dbSNP
rs756966466 1816 dbSNP
rs1408006169 1819 dbSNP
rs1163311175 1822 dbSNP
rs1397149291 1826 dbSNP
rs149896848 1831 dbSNP
rs1293774045 1834 dbSNP
rs145007833 1837 dbSNP
rs1475425668 1843 dbSNP
rs1367561131 1849 dbSNP
rs1181332961 1858 dbSNP
rs758678894 1864 dbSNP
rs541109350 1869 dbSNP
rs373696325 1870 dbSNP
rs1271444079 1872 dbSNP
rs1197663212 1877 dbSNP
rs904638521 1898 dbSNP
rs1308490248 1900 dbSNP
rs1351091630 1913 dbSNP
rs117884326 1923 dbSNP
rs936071208 1942 dbSNP
rs894619553 1948 dbSNP
rs1011709267 1954 dbSNP
rs1330759425 1956 dbSNP
rs998277433 1969 dbSNP
rs80088191 1977 dbSNP
rs903484978 1978 dbSNP
rs998918258 1981 dbSNP
rs779984809 1982 dbSNP
rs1479770038 1984 dbSNP
rs553473431 1986 dbSNP
rs1184617231 1989 dbSNP
rs954591856 1990 dbSNP
rs11697178 1993 dbSNP
rs1179088207 1994 dbSNP
rs543412118 1995 dbSNP
rs1438526204 2001 dbSNP
rs1291130581 2010 dbSNP
rs1474883670 2022 dbSNP
rs1361884756 2026 dbSNP
rs3746337 2040 dbSNP
rs1420591738 2042 dbSNP
rs1348234052 2056 dbSNP
rs1281258428 2058 dbSNP
rs773075456 2062 dbSNP
rs372609830 2067 dbSNP
rs1026040264 2068 dbSNP
rs973274441 2075 dbSNP
rs148659119 2090 dbSNP
rs1353609524 2092 dbSNP
rs1460139820 2099 dbSNP
rs950536477 2105 dbSNP
rs1299449403 2109 dbSNP
rs1406226042 2113 dbSNP
rs374787702 2114 dbSNP
rs1473209303 2130 dbSNP
rs62212147 2134 dbSNP
rs1370636778 2139 dbSNP
rs757730978 2144 dbSNP
rs1197395555 2148 dbSNP
rs879533794 2152 dbSNP
rs1291385796 2153 dbSNP
rs1215297355 2154 dbSNP
rs1314966509 2158 dbSNP
rs917211724 2169 dbSNP
rs1224065275 2176 dbSNP
rs559497940 2199 dbSNP
rs919170683 2203 dbSNP
rs527824543 2204 dbSNP
rs370825278 2207 dbSNP
rs980151429 2208 dbSNP
rs1294570885 2211 dbSNP
rs1306054668 2212 dbSNP
rs928629773 2216 dbSNP
rs1206895423 2219 dbSNP
rs1275550880 2235 dbSNP
rs570786302 2240 dbSNP
rs938695448 2241 dbSNP
rs1053139928 2252 dbSNP
rs913282696 2253 dbSNP
rs1055773788 2254 dbSNP
rs1260277388 2257 dbSNP
rs934202033 2258 dbSNP
rs915999338 2264 dbSNP
rs1486271362 2273 dbSNP
rs1186360457 2276 dbSNP
rs539470651 2286 dbSNP
rs947554720 2290 dbSNP
rs1261234753 2292 dbSNP
rs1051695000 2299 dbSNP
rs549724402 2301 dbSNP
rs1172101956 2308 dbSNP
rs182026696 2310 dbSNP
rs1433592042 2311 dbSNP
rs1363669357 2314 dbSNP
rs1270375606 2321 dbSNP
rs186484710 2325 dbSNP
rs1310521867 2326 dbSNP
rs1436325162 2334 dbSNP
rs1405776855 2338 dbSNP
rs1335383336 2355 dbSNP
rs748726432 2356 dbSNP
rs1043239120 2365 dbSNP
rs890074133 2366 dbSNP
rs1007534537 2375 dbSNP
rs535742488 2376 dbSNP
rs1421967990 2396 dbSNP
rs903419816 2402 dbSNP
rs555723095 2403 dbSNP
rs1038591871 2407 dbSNP
rs1052462632 2411 dbSNP
rs1288152074 2412 dbSNP
rs898843102 2416 dbSNP
rs1250646959 2422 dbSNP
rs890098421 2424 dbSNP
rs1359623316 2430 dbSNP
rs768363654 2432 dbSNP
rs1007643930 2433 dbSNP
rs1382586716 2434 dbSNP
rs1313377009 2440 dbSNP
rs1454860670 2446 dbSNP
rs1380556872 2449 dbSNP
rs994469081 2450 dbSNP
rs1026071509 2460 dbSNP
rs1017365317 2469 dbSNP
rs868270350 2472 dbSNP
rs1298650169 2474 dbSNP
rs1347390767 2475 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.729 1.3e-4 -0.770 3.6e-5 20 Click to see details
GSE19783 ER- ER- breast cancer 0.318 2.1e-3 0.319 2.1e-3 79 Click to see details
GSE21849 B cell lymphoma 0.427 1.0e-2 0.504 2.7e-3 29 Click to see details
GSE19536 Breast cancer 0.221 1.4e-2 0.199 2.4e-2 100 Click to see details
GSE21687 Ependynoma primary tumors -0.243 2.7e-2 -0.359 1.8e-3 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.338 4.9e-2 -0.197 1.7e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.421 5.2e-2 0.429 4.9e-2 16 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.321 5.9e-2 0.325 5.6e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.323 6.6e-2 0.338 5.7e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.111 1.5e-1 -0.154 7.4e-2 90 Click to see details
GSE21032 Prostate cancer -0.102 1.8e-1 -0.003 4.9e-1 83 Click to see details
GSE38226 Liver fibrosis 0.199 1.9e-1 0.088 3.5e-1 21 Click to see details
GSE17498 Multiple myeloma -0.112 2.5e-1 -0.105 2.6e-1 40 Click to see details
GSE19350 CNS germ cell tumors -0.202 2.6e-1 -0.371 1.2e-1 12 Click to see details
GSE28260 Renal cortex and medulla -0.153 3.1e-1 -0.324 1.4e-1 13 Click to see details
GSE17306 Multiple myeloma 0.056 3.5e-1 0.104 2.4e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer 0.043 4.3e-1 -0.326 8.0e-2 20 Click to see details
GSE32688 Pancreatic cancer -0.031 4.3e-1 0.012 4.7e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.027 4.5e-1 0.165 2.2e-1 24 Click to see details
GSE28544 Breast cancer -0.009 4.8e-1 0.370 3.8e-2 24 Click to see details
GSE28544 Breast cancer -0.009 4.8e-1 0.370 3.8e-2 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.633 0 0.646 0 32 Click to see details
HNSC -0.425 0 -0.443 0 42 Click to see details
PAAD -0.988 0.01 -0.800 0.1 4 Click to see details
COAD 0.571 0.07 0.738 0.02 8 Click to see details
BRCA -0.123 0.13 -0.137 0.11 84 Click to see details
KIRP 0.176 0.17 0.167 0.18 32 Click to see details
KIRC -0.109 0.19 -0.132 0.14 68 Click to see details
LIHC -0.116 0.21 -0.076 0.3 49 Click to see details
UCEC -0.181 0.23 -0.130 0.3 19 Click to see details
CESC -0.532 0.32 -0.500 0.33 3 Click to see details
PRAD 0.065 0.33 0.181 0.1 50 Click to see details
CHOL -0.142 0.36 -0.100 0.4 9 Click to see details
KICH 0.066 0.38 0.005 0.49 25 Click to see details
BLCA 0.073 0.39 0.084 0.37 18 Click to see details
THCA -0.028 0.42 -0.022 0.43 59 Click to see details
ESCA -0.051 0.44 -0.209 0.27 11 Click to see details
LUSC -0.021 0.45 -0.040 0.41 38 Click to see details
LUAD 0.027 0.47 0.007 0.49 12 Click to see details
PCPG -0.091 0.47 0.500 0.33 3 Click to see details
PCPG -0.091 0.47 0.500 0.33 3 Click to see details
PCPG -0.091 0.47 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*