miRTarBase - #MIRT152922 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NOL4L   
Synonyms C20orf112, C20orf113
Description nucleolar protein 4 like
Transcript NM_080616   
Expression
Putative miRNA Targets on NOL4L
3'UTR of NOL4L
(miRNA target sites are highlighted)
>NOL4L|NM_080616|3'UTR
   1 CCCCACCGGCACCTGGAGCGCACTGCCCTAGGGAAGGAGGCTGTCCCAGCCTGGACCTGGCTTCCTGCCTCACCAGTTGG
  81 TACATTTTGTTTTTGAAAGAGGTGGGATCCAAAAGAGCTGTTTCTAGCCACACTCCAAGCACCTGAGACTTTGGGCACAA
 161 GGACACTTTTTTTTTTTTTTTTTTTTTTTTTTGGAATCTCACCACACGGGTGCTCTGACCTGCTTGGAAGAGGCCAACGG
 241 GGCAGCTCTGGAAGGGTTGGGGGCTCCCCTGACAAGGCGCTGGGGCTGCAGCTCTGTTTAGAATCACCTTCGTGGACCCT
 321 GATGTTAGAATCCCACCCCCAGATAATTACCTTTCAAGTCTTAGGTGAGCAGAATTGCATATTTATTGAGAAAAGCAAAG
 401 TGGACCCTTTCTTCCTCTCCCCTTAGTAATTTATTTTTCTGAAAATGGATTCTTTTGTGTTTGTACAGATTGCTAGTCTG
 481 TGTCTGTCTGATCAGAAGGATGTATCCCCATACCTAACATTCCATATCACTACACTGATGTGGGCTGGGGCCAGTAGGGG
 561 CAGGACAGGTGCCAGGCTGGCTGTTCCTCTGCATGCCTGGTGCACCCTGTGGCCGCTAGCCCTTGGCCAGGCCATCCTGT
 641 TGCAGATCCCAGTGCTGCCACAGGGACACCACCAGGCACCTCCCTAGGCAACGCCAAGCAGGAGGACCTCACCCACACCC
 721 ATGGCAAAGCAAAACAAAAGAGGCACCCCGACCCCATTCTACAGAAGCCCCAGTCCATGGTCACCTGTATTCTACCTCAC
 801 ACTCCAGCGTGGGCTTTTTCCAGGATGTGCCCTGAGCCTGTTCTGAACAGCTGTAACCCCAACTCCCCCACACAATGTGT
 881 CTGCCTGGGAGGTAAGTAAGTCCAGACTGGGTGTCCAGGAGCTGGAACCCAGAGAGCGTCCTGTCCCTAACCAGCCACTG
 961 CAGCCCTCCAGCTCTGGCCCTCAGCTGCTTGACAGGACGGACTGCTGGGAGATGGCAGCCGGTTGGCAGGGCCCTTGCCC
1041 TCACACCCCGCTGCCCAGGAGCCAGGTCTGAACTTCTGTGCACAGGCCTGGCCCCTCAGACTCACTCCTGCCAAGAGGGG
1121 CCACTTCTTCAGGGTGAGCCCCGGCTATCAGGCAGCCGTGAGCTCCAGGGCGGGCTGCAGCTCCCATCCCCTTGCGCCAT
1201 GTTTGGAGTAAAGGGATCAGTGGAAGTGGAGGAGCCACTTGGGTTCTCCTAAGACCAGCCCTTCCGGAGGGGCCGGTCCT
1281 GGAAGAAACCCATAATCCCTGGAGTGTGAAAAAGGGCAAAAAGAAAAAGCTGGCCTGGTTTCCTTCCTCCCTGATTGATT
1361 GATTGATAGGCACTTCCTCTTGCTCAGTGCAATACCTACCAGTGCTGCTAAACCAGGGACTCGCCCAGACCTCAGCAGGC
1441 CCCCAGGGCCTCTCCGTGCAACACTCCGTAGCCATGACAGCAGCTCTCTGCTGCCCGCCCCTGCCCAGAGCTGGCAGAAG
1521 CCCTCTGTTGCCTTTCCTCCCTCAGAGCAGAGAGGCCCCAGGGGAGCCAGGGCCGAGTGGATCCTAGGATGGCCACGGAG
1601 AGCCACTCGCTCCCAGAACAGGCACCCCTTCCCAAACCAGCTTTTCTGCAGCCAATTGCCTGTTGCAGCTGTGGCCACTG
1681 CCTCCCGGCACTGTGGCAGACTCCCCCCAAGGAGGGATGGGGGGGGCACCAGTGAGGATGCCCCATCCTGCCTCAGGTCC
1761 AGAACTCTGAAAGGTAGGGTGCCCACCCCGTGCTTACTTCCGGCCCCTAGAGGTTGGGGGTGGTCGTTATCTCTCAAGTG
1841 GCCTCCAATACCCCATCCAGCCACACCACCTCTGCCTTCCATCTGACCAATCCCCAGGCCTCTGGTCAGGGCCAGGACAC
1921 CTGAGACTCACCCTTAGCACAGCACAACCTCCAGTGCCCAAGGCCTCTCCCACACCCCAGCCATCCACACATCTGGCCCC
2001 ACCTGCTCAGTACTACTCAACATTTGAATTCGTGTAAATATTTATTTTTGTGTGTGAACAATACTACAAAGTAATCAGTA
2081 AGATCTTTTGCAAAAATGTTACCCCAGGCAATTATTTGTGAAAATCTTAATGTTAAAACCTGGCAGAGACAATCGCCACC
2161 CTAGAATTCCTGGTATCAGTTACTTAACGTGTCACTTCTCCTCCCAGAGGCAGTACCCAAGCTAGACATGAACCGTTTGC
2241 ATTTCTTGGCAGACAGGAGTGAGAAAGACTGGGGAAGGGGCTCCCTCCCCCTACCCACACAAGGATTAGATCTAAAGATC
2321 AGCATAAGCTACAGTTTGAAGTCATGTTTTTCTGAGTTCAAGCTGTTGGAACTGACCACCCTCCAGCCTGCCTTAGTACT
2401 GCGGCAAGAGCGTAGGTTCAATGTGTTTTCAAGAGAAAGGAAAGAATATGTTGTTAAAGTCCATTGGGCCTCCCAGGCCC
2481 CTCCAGGACAATGGATTTCATCATGTCGACCCCACCTCTTGGGTGGGCTCCTCCTTTCCAGTGAAACTACACCTGAAGCC
2561 CTAGAGATGGCAGAATCAGGAGCAAGTTTCTGCATGGAAACAGGATTCCATTTAGCTGGCTCAGTCAGGGAACTTGTTTT
2641 GCTTTTGTTTTAAAAGATGCAGCTTCAACCCCTTCCCCCTACTCCCGACTTGGAGGGCACCAAAGAGCTGGTTCTGATGA
2721 ACTAAGCTCACTGCTGTCTCACCCTCACCAGAGGGACTGCCTTCTCCCAAAAGGAGCTCCCAAAGCCCTTGTCCCACAGC
2801 CATTTAAAAATCTTCTGAAGGGCCTCAGGGCACAAAGTGATCATTTGGGATCCTAAGTTAAAAAGGAAATGCAAGAGTAG
2881 GATACTCCAATTCCAGAGTCTTTGCAGGAGGCTAATCCCACAAGAAGGGTAGCATCAGAGAAGTGGGCATTGGTCTTAGT
2961 GGTGGATCATCAGGTAGACAAGTGATAGTGTGTGTAACCCATCTGAAATTCATTTTACCGTCACCACTCTTACAAAGGAC
3041 AGTTTATTCCCAAGGACAGTGCTGACGGGGAGGGGGACAGGCAGGGAGTTAGGAGGGTTTTCGAGGATTTCAAACAGGTG
3121 GAACCCATCCATCCCTATTCCCAAGGGCCACTTACAACTCTAAGGGTGGTTACAGGATTAACTACCAGTTCATTTTCAAA
3201 ATGCTGCTTTGAACTCAGAGGGTTGATACTTTTAATTTGTAATTTTTTGTAAAACTTTTTACAAAATAGTAAAGTATTTC
3281 ACCAGAATACCAGTTTCAATCCGTCCATGGTCTGATTTTTATATAATTTAGTGGTGCTTTAGAAACTTTGTTTTTGTTGT
3361 TTCTGAGCTAAACAGCTCAATCCTTTTTCGCCTGTATCTACCTAAGACCAATGTGAACCTTTGTATTTTTGCTCCTAATT
3441 TTGGACTCAGTGAAAGTGTACTGTTTACATGTACAGATGCCCCCAGTCCCTGTGTGTTCTGCAAGACTTGCTCTTGAGGA
3521 GGAAGATGCACCTCACTAAGCTCATCTGCTTAGCAAAGCCACAAACAAAAACCTCTCACTTTTTACCTACGTTTCCACCT
3601 AAAAATACAACAAAAAACCTATACCACGTAGAACTCAGATTGGCTGAAAAACACTTTCCACCTGGTAGATGGCCCATATG
3681 CCTCAATTATGTGGTCCATTTAGGAGCAGGAGTCAGAAGAGAGACCTCTTATTGGCTGCTGGTGGGTAACTGCATGGACA
3761 GAGGAAAAGGGAAGGCAGGACTTTGCTGCAGAGCTGTGGGATGAATGTAGTTCTTCCCTGGGCAGCCTGGGAGTGGGAAG
3841 GTCAGAATGACTCATGTTGCCTTCAGGATCAAGCCATCCAGGATTTAGGGACAACCCAAGAGGTCTTTAGTCCTCTGGCA
3921 TAATTTAGACATGTTTTGGAAGAGCATGAGTTCCATATCTGAGATGAGATTTAAGACTTTCAGTGCAGATAGTACAAGCC
4001 ATTTCTTCAGGGTTCCTCTGGGGGCAGCTCCTTCATGAGGTCCCACCTCCGGGGAGGGGCACAGGGCTCCAGATAGTAAG
4081 CACTTAAGGCAAACAGTGGATGGCACCAACTTTTAAAGGTGACTCTATTAATGGCTTCACCTCTAAATTATATTTTTACA
4161 GATATGCACCTATGCAACTTAACGTGGCTCTTCTAAGCAGGTGAGGACTTCCTCCTCAATGCTCTCTATAAAAATTATTT
4241 GTGTTCTATATAGTGAGTTTTACCAGTAAATGTGGCTTAATATTTTAATTCTTAGAATGTGTCTTCTCTACGTGATGTGA
4321 CTAAATTCTGTTTTGTTTGTGGAATGACTAGCACAGGCCGACTCCCTCTCTCCCTCACTTAACAAAAGACCAATGAGCTG
4401 TTAATCGAGCTGTTATCTCCATGGTATTACTTGCTAAATGCACTGATTTCATAAGTATGTGGAATCCTTTTCCTTTTGAA
4481 TCTGTATATCATATATAAGACTGAATCTACTTAATAAACACTGAACAACAAACCGAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGG-UAAUACACGACGAu 5'
            ||| ||| |  | |||||||| 
Target 5' tgCAATACCTACCA-GTGCTGCTa 3'
1388 - 1410 155.00 -19.40
2
miRNA  3' guGUUUGGUAA----UACACGACGAu 5'
            ||: :||||    |  ||||||| 
Target 5' acCAGTTCATTTTCAAAATGCTGCTt 3'
3184 - 3209 154.00 -13.00
3
miRNA  3' gugUUUGG-UAAUACACGACGAu 5'
             |:|||  ||||  |||||| 
Target 5' gagAGACCTCTTATTGGCTGCTg 3'
3719 - 3741 135.00 -16.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28718327 18 COSMIC
COSN26575050 19 COSMIC
COSN31575929 23 COSMIC
COSN31550177 30 COSMIC
COSN31959093 51 COSMIC
COSN26647266 55 COSMIC
COSN30172841 90 COSMIC
COSN31538993 116 COSMIC
COSN31575990 124 COSMIC
COSN9125798 169 COSMIC
COSN30597028 172 COSMIC
COSN31594590 192 COSMIC
COSN25180603 193 COSMIC
COSN26730050 270 COSMIC
COSN8898441 330 COSMIC
COSN28844661 336 COSMIC
COSN30751385 367 COSMIC
COSN9125797 374 COSMIC
COSN31570576 404 COSMIC
COSN31556425 581 COSMIC
COSN30539935 627 COSMIC
COSN21981524 680 COSMIC
COSN1869749 975 COSMIC
COSN5968766 1120 COSMIC
COSN20116392 1351 COSMIC
COSN17220371 1872 COSMIC
COSN7089214 2077 COSMIC
COSN29976784 2242 COSMIC
COSN20116388 2633 COSMIC
COSN22736061 2965 COSMIC
COSN20116378 3808 COSMIC
COSN16382523 3839 COSMIC
COSN5968765 4183 COSMIC
COSN29326311 4281 COSMIC
COSN26313979 4388 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs980864582 1 dbSNP
rs759305982 7 dbSNP
rs776479949 8 dbSNP
rs867919106 9 dbSNP
rs770782194 12 dbSNP
rs746955555 18 dbSNP
rs773244243 19 dbSNP
rs772319246 20 dbSNP
rs1459643721 21 dbSNP
rs563943986 23 dbSNP
rs779063979 27 dbSNP
rs1287090271 28 dbSNP
rs768920742 30 dbSNP
rs1441501591 32 dbSNP
rs1327677407 36 dbSNP
rs1368447007 36 dbSNP
rs749406674 38 dbSNP
rs545820363 40 dbSNP
rs1454342733 42 dbSNP
rs1254437265 43 dbSNP
rs775877396 44 dbSNP
rs1450202676 45 dbSNP
rs1289688701 48 dbSNP
rs907185695 49 dbSNP
rs992407879 51 dbSNP
rs533426847 55 dbSNP
rs1259588208 56 dbSNP
rs1469308730 57 dbSNP
rs1466709922 72 dbSNP
rs1251584194 75 dbSNP
rs1015464818 79 dbSNP
rs1468313471 79 dbSNP
rs1410410874 80 dbSNP
rs1417502601 81 dbSNP
rs962378798 83 dbSNP
rs1418584899 84 dbSNP
rs1451415348 90 dbSNP
rs1014904798 99 dbSNP
rs1188552703 101 dbSNP
rs1392106021 104 dbSNP
rs1445618558 110 dbSNP
rs984888906 112 dbSNP
rs1298442064 122 dbSNP
rs1375114146 135 dbSNP
rs887823645 140 dbSNP
rs1287174970 144 dbSNP
rs1281222651 145 dbSNP
rs1334903663 147 dbSNP
rs1049259656 148 dbSNP
rs191891712 150 dbSNP
rs1321543768 151 dbSNP
rs1234923305 153 dbSNP
rs1479784610 155 dbSNP
rs1176778853 159 dbSNP
rs756167827 163 dbSNP
rs76752983 164 dbSNP
rs1311158867 165 dbSNP
rs1237765513 166 dbSNP
rs374212206 167 dbSNP
rs996050637 167 dbSNP
rs1365364344 177 dbSNP
rs1296754323 182 dbSNP
rs1428599600 184 dbSNP
rs1342228633 189 dbSNP
rs1334509158 191 dbSNP
rs901670410 192 dbSNP
rs1173562386 193 dbSNP
rs1204795986 193 dbSNP
rs1215604109 193 dbSNP
rs1256849466 193 dbSNP
rs1275570033 193 dbSNP
rs1281270102 193 dbSNP
rs1306117493 193 dbSNP
rs1307019706 193 dbSNP
rs1355582908 193 dbSNP
rs1379118285 193 dbSNP
rs1416062447 193 dbSNP
rs1486722945 193 dbSNP
rs1491011677 193 dbSNP
rs386393630 193 dbSNP
rs774612473 193 dbSNP
rs867512673 193 dbSNP
rs1272429131 194 dbSNP
rs1324367071 194 dbSNP
rs1360363562 195 dbSNP
rs1375007079 195 dbSNP
rs1388753881 195 dbSNP
rs1388604269 196 dbSNP
rs1304567483 201 dbSNP
rs1172083407 202 dbSNP
rs1350363829 204 dbSNP
rs544392323 207 dbSNP
rs1010129143 208 dbSNP
rs891469019 210 dbSNP
rs1284521782 211 dbSNP
rs1228566827 218 dbSNP
rs1358069529 220 dbSNP
rs1239460534 224 dbSNP
rs1054092169 229 dbSNP
rs6057583 230 dbSNP
rs1312920991 231 dbSNP
rs6057582 232 dbSNP
rs573906564 238 dbSNP
rs145067613 239 dbSNP
rs1439048116 242 dbSNP
rs540393376 246 dbSNP
rs1318798312 250 dbSNP
rs750955868 257 dbSNP
rs1423943590 261 dbSNP
rs1400755788 264 dbSNP
rs1320910910 265 dbSNP
rs1382616981 269 dbSNP
rs1737887 270 dbSNP
rs757891913 271 dbSNP
rs752236350 273 dbSNP
rs1373628575 274 dbSNP
rs764863723 277 dbSNP
rs557850410 278 dbSNP
rs759230082 279 dbSNP
rs1194273617 287 dbSNP
rs766673725 296 dbSNP
rs940925961 298 dbSNP
rs1365018670 300 dbSNP
rs36184637 301 dbSNP
rs770272633 307 dbSNP
rs1261608593 308 dbSNP
rs984750289 311 dbSNP
rs539849417 312 dbSNP
rs1348658746 314 dbSNP
rs958520593 316 dbSNP
rs569170514 319 dbSNP
rs1217681359 320 dbSNP
rs1245748622 320 dbSNP
rs1344494840 321 dbSNP
rs1271001189 322 dbSNP
rs1432577424 324 dbSNP
rs1324499157 326 dbSNP
rs1297468940 331 dbSNP
rs148425684 334 dbSNP
rs1159830572 337 dbSNP
rs535602358 338 dbSNP
rs1177012846 340 dbSNP
rs1171127549 341 dbSNP
rs1409044612 343 dbSNP
rs1457230062 348 dbSNP
rs1471803330 348 dbSNP
rs981381276 349 dbSNP
rs1397192561 350 dbSNP
rs1419730972 351 dbSNP
rs1439129781 352 dbSNP
rs1411952679 361 dbSNP
rs1371440187 368 dbSNP
rs1336607480 369 dbSNP
rs568263532 375 dbSNP
rs1328194482 377 dbSNP
rs374921459 379 dbSNP
rs1416581824 384 dbSNP
rs1164399031 386 dbSNP
rs1273707466 387 dbSNP
rs1336741081 397 dbSNP
rs546645154 399 dbSNP
rs779311706 401 dbSNP
rs1266361598 406 dbSNP
rs1416195641 409 dbSNP
rs1184826466 417 dbSNP
rs1483151230 429 dbSNP
rs1249066574 431 dbSNP
rs1250633868 432 dbSNP
rs1014931209 437 dbSNP
rs1420675619 437 dbSNP
rs974812324 447 dbSNP
rs1456801012 449 dbSNP
rs1163045026 451 dbSNP
rs1397584607 455 dbSNP
rs1005251508 461 dbSNP
rs1327101479 465 dbSNP
rs1349999145 468 dbSNP
rs1201745680 472 dbSNP
rs966289915 473 dbSNP
rs1452900587 474 dbSNP
rs1018751002 475 dbSNP
rs1227723678 476 dbSNP
rs879334527 477 dbSNP
rs1010577970 479 dbSNP
rs1332378747 484 dbSNP
rs1289943421 485 dbSNP
rs1339823705 486 dbSNP
rs1197222283 487 dbSNP
rs1027710681 490 dbSNP
rs891671424 492 dbSNP
rs900653164 498 dbSNP
rs1041064954 502 dbSNP
rs944969139 506 dbSNP
rs1187440544 512 dbSNP
rs1440091903 520 dbSNP
rs528160943 521 dbSNP
rs543447767 525 dbSNP
rs570557817 529 dbSNP
rs1041402198 530 dbSNP
rs576699329 535 dbSNP
rs1370216371 549 dbSNP
rs1461343403 552 dbSNP
rs551885184 554 dbSNP
rs1435529025 555 dbSNP
rs753869339 557 dbSNP
rs1400088568 558 dbSNP
rs1044146724 561 dbSNP
rs1013937311 562 dbSNP
rs1161758087 571 dbSNP
rs1473126177 576 dbSNP
rs1311878644 587 dbSNP
rs530465288 602 dbSNP
rs1326855618 604 dbSNP
rs1229368278 614 dbSNP
rs562800783 615 dbSNP
rs35090395 616 dbSNP
rs1056605533 621 dbSNP
rs36057544 627 dbSNP
rs1234488696 631 dbSNP
rs1281913103 633 dbSNP
rs34617565 637 dbSNP
rs1478714198 638 dbSNP
rs550867479 654 dbSNP
rs35201274 655 dbSNP
rs1200431103 657 dbSNP
rs940944410 666 dbSNP
rs1246827939 667 dbSNP
rs34674105 684 dbSNP
rs1449193498 689 dbSNP
rs908159000 692 dbSNP
rs937215956 705 dbSNP
rs1269942915 709 dbSNP
rs1175745311 714 dbSNP
rs372009391 716 dbSNP
rs930660767 721 dbSNP
rs529419201 722 dbSNP
rs1385619129 724 dbSNP
rs1437099690 734 dbSNP
rs1491156200 739 dbSNP
rs1491392168 740 dbSNP
rs1275460727 742 dbSNP
rs1440280276 743 dbSNP
rs766515340 746 dbSNP
rs1260766591 749 dbSNP
rs562158985 750 dbSNP
rs1207321863 755 dbSNP
rs1247860497 756 dbSNP
rs1469187486 758 dbSNP
rs966121341 760 dbSNP
rs1265560876 763 dbSNP
rs971339774 766 dbSNP
rs907758473 767 dbSNP
rs1323220159 774 dbSNP
rs540855433 776 dbSNP
rs1159930719 779 dbSNP
rs1458805887 784 dbSNP
rs983482843 786 dbSNP
rs1387688879 798 dbSNP
rs756319262 801 dbSNP
rs952011720 802 dbSNP
rs1027763600 808 dbSNP
rs750696474 837 dbSNP
rs1415785445 839 dbSNP
rs1425463464 841 dbSNP
rs1192383870 848 dbSNP
rs146233818 861 dbSNP
rs397942099 861 dbSNP
rs988698861 865 dbSNP
rs573233854 869 dbSNP
rs956056137 892 dbSNP
rs564649260 894 dbSNP
rs545865963 898 dbSNP
rs1000049556 902 dbSNP
rs752363551 902 dbSNP
rs964909572 902 dbSNP
rs1215975459 903 dbSNP
rs1263977779 904 dbSNP
rs1488286200 911 dbSNP
rs1177983038 922 dbSNP
rs548032244 928 dbSNP
rs144511170 929 dbSNP
rs1471632353 930 dbSNP
rs1022559352 931 dbSNP
rs1258694181 935 dbSNP
rs1411179991 937 dbSNP
rs1461859960 937 dbSNP
rs187262095 938 dbSNP
rs1166657196 939 dbSNP
rs895530702 940 dbSNP
rs1457148046 941 dbSNP
rs1298394346 942 dbSNP
rs1281313650 947 dbSNP
rs1009882541 949 dbSNP
rs1025104640 950 dbSNP
rs892803286 958 dbSNP
rs1356661360 960 dbSNP
rs535767796 960 dbSNP
rs1037187031 964 dbSNP
rs1230466072 969 dbSNP
rs1311100738 971 dbSNP
rs574822261 973 dbSNP
rs1205538782 979 dbSNP
rs1277013216 984 dbSNP
rs1482170095 985 dbSNP
rs1204565104 996 dbSNP
rs1054169643 998 dbSNP
rs937102786 999 dbSNP
rs1005085682 1002 dbSNP
rs764484705 1003 dbSNP
rs886594032 1003 dbSNP
rs949892689 1005 dbSNP
rs1372053232 1008 dbSNP
rs907812511 1014 dbSNP
rs1306882127 1018 dbSNP
rs1049366016 1020 dbSNP
rs552872258 1021 dbSNP
rs1301570511 1022 dbSNP
rs1378961227 1031 dbSNP
rs1450654721 1037 dbSNP
rs1300222717 1039 dbSNP
rs1359372684 1040 dbSNP
rs1340309086 1046 dbSNP
rs534867801 1049 dbSNP
rs570447140 1050 dbSNP
rs751461839 1059 dbSNP
rs1444199066 1066 dbSNP
rs974707534 1076 dbSNP
rs1391522103 1078 dbSNP
rs1235646102 1084 dbSNP
rs763948335 1085 dbSNP
rs964809328 1089 dbSNP
rs1168707592 1098 dbSNP
rs1019419266 1101 dbSNP
rs1447341714 1102 dbSNP
rs1259589187 1105 dbSNP
rs762456397 1107 dbSNP
rs1167566067 1108 dbSNP
rs1039013709 1117 dbSNP
rs967263654 1119 dbSNP
rs762554983 1121 dbSNP
rs775133526 1122 dbSNP
rs1258474297 1133 dbSNP
rs1432025843 1134 dbSNP
rs1322983338 1142 dbSNP
rs912012712 1143 dbSNP
rs181772269 1147 dbSNP
rs1304405790 1148 dbSNP
rs1345779718 1151 dbSNP
rs1347281219 1151 dbSNP
rs536602056 1157 dbSNP
rs1184610292 1158 dbSNP
rs1001130979 1160 dbSNP
rs569334088 1165 dbSNP
rs1249730658 1167 dbSNP
rs368285426 1171 dbSNP
rs550828928 1172 dbSNP
rs1246947476 1179 dbSNP
rs528120535 1181 dbSNP
rs1045875712 1189 dbSNP
rs949936958 1191 dbSNP
rs1307371426 1193 dbSNP
rs907697762 1195 dbSNP
rs529526825 1196 dbSNP
rs1162001463 1216 dbSNP
rs969915521 1221 dbSNP
rs1380409102 1223 dbSNP
rs1311863464 1235 dbSNP
rs1386963134 1254 dbSNP
rs775030746 1256 dbSNP
rs930554423 1265 dbSNP
rs920487306 1266 dbSNP
rs1333050066 1270 dbSNP
rs1434504110 1272 dbSNP
rs974754950 1273 dbSNP
rs562432063 1274 dbSNP
rs190077687 1275 dbSNP
rs1326929554 1281 dbSNP
rs992548502 1282 dbSNP
rs528723994 1290 dbSNP
rs1290245022 1292 dbSNP
rs564381076 1298 dbSNP
rs1452988584 1301 dbSNP
rs1196290027 1302 dbSNP
rs1245696871 1307 dbSNP
rs1166901044 1320 dbSNP
rs1424154818 1327 dbSNP
rs1185040170 1329 dbSNP
rs1015372848 1335 dbSNP
rs1004352602 1338 dbSNP
rs1410432350 1342 dbSNP
rs987959600 1343 dbSNP
rs1166116061 1344 dbSNP
rs1185574227 1349 dbSNP
rs1484787118 1357 dbSNP
rs966939541 1359 dbSNP
rs1021550115 1360 dbSNP
rs1254264405 1360 dbSNP
rs1355238234 1361 dbSNP
rs67549403 1362 dbSNP
rs989571317 1364 dbSNP
rs1196392032 1367 dbSNP
rs372923363 1367 dbSNP
rs1227653013 1368 dbSNP
rs1348562935 1368 dbSNP
rs574826666 1368 dbSNP
rs71299231 1368 dbSNP
rs1033861424 1370 dbSNP
rs1248905652 1371 dbSNP
rs1480379627 1372 dbSNP
rs1250100145 1376 dbSNP
rs1472583118 1377 dbSNP
rs886626218 1379 dbSNP
rs1370599825 1380 dbSNP
rs1472001068 1384 dbSNP
rs1162986415 1386 dbSNP
rs1391049494 1388 dbSNP
rs1431788086 1393 dbSNP
rs1306277927 1395 dbSNP
rs1001183333 1414 dbSNP
rs1409207364 1417 dbSNP
rs1027789667 1423 dbSNP
rs1242373258 1423 dbSNP
rs1283344456 1436 dbSNP
rs1024096745 1443 dbSNP
rs1014412221 1445 dbSNP
rs995090357 1449 dbSNP
rs1201578631 1450 dbSNP
rs1047598611 1451 dbSNP
rs1441147567 1453 dbSNP
rs542887020 1455 dbSNP
rs575679622 1456 dbSNP
rs944751469 1457 dbSNP
rs1351878399 1466 dbSNP
rs1307347005 1467 dbSNP
rs890432565 1468 dbSNP
rs563686579 1472 dbSNP
rs1404309942 1476 dbSNP
rs41289862 1496 dbSNP
rs1335903483 1497 dbSNP
rs925797906 1503 dbSNP
rs1365653711 1508 dbSNP
rs978528213 1509 dbSNP
rs948555797 1510 dbSNP
rs1294915024 1521 dbSNP
rs1340958343 1523 dbSNP
rs1458313598 1526 dbSNP
rs1393675866 1528 dbSNP
rs1257174238 1538 dbSNP
rs1343508166 1544 dbSNP
rs1200374848 1548 dbSNP
rs1249106503 1552 dbSNP
rs915863525 1553 dbSNP
rs3833319 1555 dbSNP
rs397840832 1555 dbSNP
rs1186966919 1556 dbSNP
rs1473455563 1557 dbSNP
rs1375981838 1558 dbSNP
rs993141887 1562 dbSNP
rs1464538745 1564 dbSNP
rs943421865 1574 dbSNP
rs553910174 1575 dbSNP
rs945453711 1576 dbSNP
rs1318249459 1579 dbSNP
rs913962157 1595 dbSNP
rs777678051 1596 dbSNP
rs1418543631 1597 dbSNP
rs958189204 1600 dbSNP
rs1248456651 1606 dbSNP
rs982559217 1608 dbSNP
rs1211733734 1611 dbSNP
rs1331781400 1614 dbSNP
rs1207263650 1616 dbSNP
rs1033918480 1626 dbSNP
rs41289860 1633 dbSNP
rs969785523 1643 dbSNP
rs1265404222 1648 dbSNP
rs1024399818 1649 dbSNP
rs1182925131 1656 dbSNP
rs1412659674 1661 dbSNP
rs1273111746 1671 dbSNP
rs1212206059 1686 dbSNP
rs1331731369 1687 dbSNP
rs1260925655 1697 dbSNP
rs577662719 1699 dbSNP
rs1237932319 1707 dbSNP
rs1333655212 1708 dbSNP
rs1013882437 1709 dbSNP
rs1294893972 1709 dbSNP
rs1229775807 1712 dbSNP
rs11480196 1719 dbSNP
rs534481212 1719 dbSNP
rs1306817703 1720 dbSNP
rs1026055197 1721 dbSNP
rs1488255619 1723 dbSNP
rs1441024461 1724 dbSNP
rs1026732641 1725 dbSNP
rs995038107 1726 dbSNP
rs1424156677 1727 dbSNP
rs533896753 1727 dbSNP
rs551853002 1727 dbSNP
rs796908614 1727 dbSNP
rs1323890630 1731 dbSNP
rs1458594135 1732 dbSNP
rs576971201 1733 dbSNP
rs1230414804 1736 dbSNP
rs749866565 1740 dbSNP
rs1039002320 1753 dbSNP
rs1359010145 1756 dbSNP
rs1017877417 1761 dbSNP
rs1229394431 1767 dbSNP
rs1276942596 1779 dbSNP
rs1157811535 1782 dbSNP
rs1202412898 1787 dbSNP
rs1232258173 1789 dbSNP
rs867492135 1790 dbSNP
rs1253753425 1800 dbSNP
rs1362291818 1801 dbSNP
rs1009538083 1802 dbSNP
rs1391529997 1806 dbSNP
rs1427282634 1812 dbSNP
rs1201006283 1813 dbSNP
rs1360254763 1818 dbSNP
rs1450738541 1821 dbSNP
rs1301516527 1822 dbSNP
rs890336770 1823 dbSNP
rs3746611 1825 dbSNP
rs1300068277 1826 dbSNP
rs945371488 1828 dbSNP
rs536767467 1829 dbSNP
rs914019258 1829 dbSNP
rs1192361511 1831 dbSNP
rs936882360 1833 dbSNP
rs1466506844 1834 dbSNP
rs1261098752 1840 dbSNP
rs1397155362 1843 dbSNP
rs962552592 1850 dbSNP
rs926786342 1853 dbSNP
rs1204942753 1854 dbSNP
rs980930719 1855 dbSNP
rs756229674 1858 dbSNP
rs1185443028 1864 dbSNP
rs1425238991 1869 dbSNP
rs918152602 1870 dbSNP
rs558911702 1887 dbSNP
rs1416716947 1898 dbSNP
rs1257402873 1899 dbSNP
rs1405873430 1899 dbSNP
rs992932530 1902 dbSNP
rs950395268 1923 dbSNP
rs1026107065 1924 dbSNP
rs1430209932 1925 dbSNP
rs1346582084 1926 dbSNP
rs1275579961 1927 dbSNP
rs934750371 1927 dbSNP
rs1220919424 1932 dbSNP
rs963088928 1932 dbSNP
rs1322676193 1936 dbSNP
rs1209123027 1937 dbSNP
rs1269722001 1948 dbSNP
rs1444979396 1950 dbSNP
rs1214626158 1959 dbSNP
rs1017450413 1961 dbSNP
rs1478712649 1971 dbSNP
rs1317294474 1975 dbSNP
rs904657616 1983 dbSNP
rs1007367518 1988 dbSNP
rs1429241579 1990 dbSNP
rs1043116698 1994 dbSNP
rs1380327799 1995 dbSNP
rs890378927 2002 dbSNP
rs1383057420 2003 dbSNP
rs1386896504 2004 dbSNP
rs1400418688 2016 dbSNP
rs1175836260 2018 dbSNP
rs566395082 2019 dbSNP
rs1434436194 2029 dbSNP
rs1051676828 2031 dbSNP
rs1394605479 2032 dbSNP
rs1344816010 2037 dbSNP
rs1171871839 2038 dbSNP
rs1290052463 2041 dbSNP
rs1348238065 2044 dbSNP
rs1222900028 2045 dbSNP
rs1451835503 2048 dbSNP
rs1010008639 2050 dbSNP
rs892465844 2052 dbSNP
rs1267487835 2056 dbSNP
rs1287607535 2059 dbSNP
rs1184970041 2062 dbSNP
rs1243201983 2062 dbSNP
rs1362467680 2064 dbSNP
rs1192846081 2073 dbSNP
rs1469964353 2075 dbSNP
rs1164154560 2078 dbSNP
rs751787857 2083 dbSNP
rs1053833265 2098 dbSNP
rs1403756634 2100 dbSNP
rs1302691499 2102 dbSNP
rs948585068 2106 dbSNP
rs186352186 2111 dbSNP
rs1211223470 2112 dbSNP
rs1485155317 2116 dbSNP
rs764373335 2117 dbSNP
rs992778370 2118 dbSNP
rs1309751049 2129 dbSNP
rs11472592 2130 dbSNP
rs149935468 2130 dbSNP
rs535891137 2131 dbSNP
rs1441249567 2138 dbSNP
rs1229985003 2145 dbSNP
rs1284504363 2149 dbSNP
rs1358045723 2153 dbSNP
rs926671572 2154 dbSNP
rs1269585732 2159 dbSNP
rs1224963072 2165 dbSNP
rs1342218311 2168 dbSNP
rs1249068059 2171 dbSNP
rs1437687911 2175 dbSNP
rs1188692133 2183 dbSNP
rs1342084891 2183 dbSNP
rs1239562650 2187 dbSNP
rs750608822 2188 dbSNP
rs568650067 2189 dbSNP
rs1415572559 2192 dbSNP
rs1390918506 2198 dbSNP
rs567606930 2200 dbSNP
rs1375101462 2205 dbSNP
rs1311069802 2209 dbSNP
rs1166189790 2211 dbSNP
rs1394256253 2212 dbSNP
rs1390693446 2216 dbSNP
rs1411741426 2227 dbSNP
rs1334641360 2229 dbSNP
rs1420827751 2229 dbSNP
rs918186384 2233 dbSNP
rs181256712 2235 dbSNP
rs982893502 2241 dbSNP
rs1313901929 2243 dbSNP
rs1474621197 2252 dbSNP
rs1229975536 2257 dbSNP
rs1365417990 2257 dbSNP
rs1249050128 2260 dbSNP
rs952349323 2270 dbSNP
rs1201522549 2271 dbSNP
rs1420416563 2276 dbSNP
rs1189138467 2277 dbSNP
rs950396569 2280 dbSNP
rs1248915344 2281 dbSNP
rs1474639690 2281 dbSNP
rs1451490461 2288 dbSNP
rs1191134029 2290 dbSNP
rs1161666677 2291 dbSNP
rs1372567804 2295 dbSNP
rs919700832 2297 dbSNP
rs781410679 2300 dbSNP
rs528629212 2301 dbSNP
rs973022987 2305 dbSNP
rs964891217 2309 dbSNP
rs529434443 2319 dbSNP
rs188435406 2321 dbSNP
rs1292903989 2325 dbSNP
rs552668232 2328 dbSNP
rs1017322673 2331 dbSNP
rs1277141285 2332 dbSNP
rs1293637241 2334 dbSNP
rs955092270 2345 dbSNP
rs764014469 2347 dbSNP
rs1203438411 2357 dbSNP
rs1269102653 2360 dbSNP
rs1007836846 2366 dbSNP
rs762784218 2370 dbSNP
rs1261181888 2382 dbSNP
rs1433825936 2390 dbSNP
rs1201033214 2394 dbSNP
rs1291722659 2395 dbSNP
rs753038079 2398 dbSNP
rs531005759 2402 dbSNP
rs752730017 2403 dbSNP
rs1412427846 2405 dbSNP
rs904520152 2406 dbSNP
rs1043146480 2412 dbSNP
rs1397333777 2413 dbSNP
rs563822368 2413 dbSNP
rs1386874994 2415 dbSNP
rs764808173 2422 dbSNP
rs139368634 2430 dbSNP
rs183712783 2436 dbSNP
rs1289445199 2439 dbSNP
rs146381951 2439 dbSNP
rs1260388826 2440 dbSNP
rs938525034 2441 dbSNP
rs1211724448 2447 dbSNP
rs1266843454 2449 dbSNP
rs1000799192 2450 dbSNP
rs908488820 2457 dbSNP
rs1047000501 2459 dbSNP
rs759995337 2459 dbSNP
rs6058697 2464 dbSNP
rs142250599 2466 dbSNP
rs919566335 2469 dbSNP
rs772711241 2485 dbSNP
rs975171109 2508 dbSNP
rs1458045007 2514 dbSNP
rs896644091 2515 dbSNP
rs1363165568 2517 dbSNP
rs1047638856 2527 dbSNP
rs2145841 2528 dbSNP
rs1309153304 2529 dbSNP
rs930212590 2530 dbSNP
rs761369620 2532 dbSNP
rs1306683164 2542 dbSNP
rs963755177 2545 dbSNP
rs1248411928 2552 dbSNP
rs1212820646 2555 dbSNP
rs920149933 2559 dbSNP
rs910724922 2568 dbSNP
rs1252460074 2569 dbSNP
rs988086035 2570 dbSNP
rs1175288828 2571 dbSNP
rs954894931 2580 dbSNP
rs1185042671 2582 dbSNP
rs770495226 2594 dbSNP
rs954737741 2598 dbSNP
rs1278968400 2601 dbSNP
rs999044861 2604 dbSNP
rs968709605 2613 dbSNP
rs1168593803 2627 dbSNP
rs1030173384 2628 dbSNP
rs558316030 2632 dbSNP
rs543240376 2633 dbSNP
rs150891059 2636 dbSNP
rs72531395 2636 dbSNP
rs36115369 2638 dbSNP
rs11473402 2639 dbSNP
rs11474732 2639 dbSNP
rs1275147199 2647 dbSNP
rs1309236727 2652 dbSNP
rs1012964053 2653 dbSNP
rs1392802008 2662 dbSNP
rs1240885548 2665 dbSNP
rs1161764225 2668 dbSNP
rs1443586701 2671 dbSNP
rs575728738 2672 dbSNP
rs1420993625 2677 dbSNP
rs1427332816 2682 dbSNP
rs549317994 2684 dbSNP
rs760445478 2686 dbSNP
rs1003148108 2687 dbSNP
rs1455237404 2691 dbSNP
rs774568701 2695 dbSNP
rs1335094930 2715 dbSNP
rs896521880 2721 dbSNP
rs1436060228 2734 dbSNP
rs1047243225 2735 dbSNP
rs930097963 2753 dbSNP
rs1047029456 2754 dbSNP
rs11538729 2773 dbSNP
rs1294786210 2794 dbSNP
rs1324098358 2795 dbSNP
rs1205362003 2803 dbSNP
rs1260964236 2811 dbSNP
rs1038615635 2812 dbSNP
rs554284200 2815 dbSNP
rs1243406888 2816 dbSNP
rs11538730 2817 dbSNP
rs749767414 2824 dbSNP
rs780574819 2826 dbSNP
rs910213212 2827 dbSNP
rs1243597119 2829 dbSNP
rs986167512 2829 dbSNP
rs1216248726 2834 dbSNP
rs1428990190 2838 dbSNP
rs1317686951 2843 dbSNP
rs191323258 2844 dbSNP
rs1222140324 2850 dbSNP
rs1350200315 2873 dbSNP
rs942380435 2874 dbSNP
rs535832373 2875 dbSNP
rs769811912 2885 dbSNP
rs1294144756 2887 dbSNP
rs1346094430 2899 dbSNP
rs1225240665 2904 dbSNP
rs1281223356 2904 dbSNP
rs550084517 2907 dbSNP
rs933511356 2914 dbSNP
rs1369470374 2927 dbSNP
rs749062221 2928 dbSNP
rs924761599 2943 dbSNP
rs977658546 2944 dbSNP
rs370980497 2945 dbSNP
rs1290931979 2947 dbSNP
rs1444884865 2952 dbSNP
rs1214485983 2961 dbSNP
rs1431947090 2964 dbSNP
rs1268951214 2975 dbSNP
rs1490995051 2977 dbSNP
rs1197886495 2983 dbSNP
rs1268694871 2987 dbSNP
rs1470723749 2988 dbSNP
rs1344221853 2991 dbSNP
rs1156571268 2996 dbSNP
rs968909302 2999 dbSNP
rs933088250 3003 dbSNP
rs1367530835 3012 dbSNP
rs1406761631 3015 dbSNP
rs565670710 3016 dbSNP
rs922991593 3018 dbSNP
rs112692310 3020 dbSNP
rs1395205542 3042 dbSNP
rs781322419 3048 dbSNP
rs958718983 3053 dbSNP
rs537046735 3054 dbSNP
rs138013165 3056 dbSNP
rs139042140 3057 dbSNP
rs571091350 3058 dbSNP
rs1032258959 3062 dbSNP
rs757413135 3066 dbSNP
rs886953942 3067 dbSNP
rs969675260 3070 dbSNP
rs1023638217 3075 dbSNP
rs1025448402 3082 dbSNP
rs1485461030 3089 dbSNP
rs995424557 3092 dbSNP
rs569983837 3102 dbSNP
rs144977718 3103 dbSNP
rs6058696 3113 dbSNP
rs1006916 3119 dbSNP
rs781299896 3129 dbSNP
rs757731511 3131 dbSNP
rs1364911855 3143 dbSNP
rs1233663763 3144 dbSNP
rs113267309 3155 dbSNP
rs1441099027 3155 dbSNP
rs1315326143 3156 dbSNP
rs1384458579 3171 dbSNP
rs935069240 3174 dbSNP
rs924792620 3182 dbSNP
rs1290332493 3187 dbSNP
rs1340739868 3187 dbSNP
rs1198036303 3204 dbSNP
rs1271403667 3206 dbSNP
rs1437631244 3206 dbSNP
rs566682411 3209 dbSNP
rs1245238556 3217 dbSNP
rs1442956858 3232 dbSNP
rs3841373 3232 dbSNP
rs1373686846 3238 dbSNP
rs1475739483 3244 dbSNP
rs1286730198 3249 dbSNP
rs1416187961 3261 dbSNP
rs1394176122 3273 dbSNP
rs1050116617 3276 dbSNP
rs1337101623 3285 dbSNP
rs1407868420 3287 dbSNP
rs1449982626 3288 dbSNP
rs1313783747 3300 dbSNP
rs932952040 3302 dbSNP
rs1375686935 3303 dbSNP
rs947548378 3306 dbSNP
rs914852583 3307 dbSNP
rs991735197 3308 dbSNP
rs1311687735 3310 dbSNP
rs1432393739 3315 dbSNP
rs958974827 3316 dbSNP
rs1356206793 3321 dbSNP
rs764396657 3349 dbSNP
rs1035666224 3350 dbSNP
rs1171107220 3350 dbSNP
rs1460183071 3351 dbSNP
rs935200089 3354 dbSNP
rs925124914 3360 dbSNP
rs1189840393 3362 dbSNP
rs1448828139 3362 dbSNP
rs981940108 3374 dbSNP
rs951456442 3379 dbSNP
rs115684411 3381 dbSNP
rs1244944159 3389 dbSNP
rs1467965993 3390 dbSNP
rs11725 3397 dbSNP
rs992198563 3409 dbSNP
rs1383449973 3412 dbSNP
rs1253563418 3421 dbSNP
rs1340502008 3437 dbSNP
rs541103237 3437 dbSNP
rs532412472 3439 dbSNP
rs564882288 3444 dbSNP
rs1223219608 3456 dbSNP
rs1276629229 3456 dbSNP
rs1261534524 3462 dbSNP
rs1353063841 3467 dbSNP
rs546794767 3478 dbSNP
rs753395927 3488 dbSNP
rs1261099449 3492 dbSNP
rs1487943621 3498 dbSNP
rs1200050321 3508 dbSNP
rs1270849205 3515 dbSNP
rs1018228382 3519 dbSNP
rs1479338469 3538 dbSNP
rs1006788118 3551 dbSNP
rs41289858 3554 dbSNP
rs765973768 3562 dbSNP
rs190462502 3563 dbSNP
rs1050751344 3564 dbSNP
rs1007446569 3576 dbSNP
rs1298274231 3586 dbSNP
rs35030210 3590 dbSNP
rs1051770223 3591 dbSNP
rs1344103033 3610 dbSNP
rs1386592786 3613 dbSNP
rs554194230 3617 dbSNP
rs1308093756 3618 dbSNP
rs1337802799 3618 dbSNP
rs772961115 3620 dbSNP
rs997216070 3620 dbSNP
rs1260282197 3621 dbSNP
rs1352692405 3622 dbSNP
rs764328984 3627 dbSNP
rs1052016977 3628 dbSNP
rs935083022 3631 dbSNP
rs947578894 3639 dbSNP
rs763334394 3642 dbSNP
rs1056463105 3647 dbSNP
rs1420577120 3657 dbSNP
rs1179208871 3681 dbSNP
rs1379244877 3687 dbSNP
rs1424749117 3690 dbSNP
rs1164892274 3696 dbSNP
rs1364274666 3700 dbSNP
rs1043552065 3704 dbSNP
rs775913389 3707 dbSNP
rs561156733 3718 dbSNP
rs1399072542 3721 dbSNP
rs1389945518 3725 dbSNP
rs1422106943 3726 dbSNP
rs1383754254 3732 dbSNP
rs141853940 3751 dbSNP
rs1312989575 3755 dbSNP
rs571909707 3761 dbSNP
rs992480975 3763 dbSNP
rs1251732843 3770 dbSNP
rs1481501583 3774 dbSNP
rs3833318 3809 dbSNP
rs761190835 3809 dbSNP
rs1256781380 3817 dbSNP
rs981504147 3818 dbSNP
rs764796349 3823 dbSNP
rs1335972543 3824 dbSNP
rs185535757 3827 dbSNP
rs550180936 3835 dbSNP
rs918704754 3840 dbSNP
rs972691175 3845 dbSNP
rs746437358 3851 dbSNP
rs974135899 3855 dbSNP
rs962555011 3866 dbSNP
rs1423808492 3873 dbSNP
rs538304650 3875 dbSNP
rs1356725752 3878 dbSNP
rs1007228965 3884 dbSNP
rs955280908 3886 dbSNP
rs1007087788 3890 dbSNP
rs776558841 3895 dbSNP
rs999227887 3901 dbSNP
rs1029947893 3902 dbSNP
rs771090331 3903 dbSNP
rs1378514887 3908 dbSNP
rs1441322877 3914 dbSNP
rs80068367 3917 dbSNP
rs1296215805 3928 dbSNP
rs1309141820 3932 dbSNP
rs1162550076 3933 dbSNP
rs1257167102 3939 dbSNP
rs41289856 3941 dbSNP
rs999116634 3942 dbSNP
rs903640409 3950 dbSNP
rs1482649852 3952 dbSNP
rs1418650268 3969 dbSNP
rs1422304562 3977 dbSNP
rs1043845359 3980 dbSNP
rs1010580908 3986 dbSNP
rs1358733650 3990 dbSNP
rs893313364 3994 dbSNP
rs559304434 3995 dbSNP
rs1236855907 4007 dbSNP
rs1055926989 4012 dbSNP
rs1056268058 4013 dbSNP
rs1277398365 4026 dbSNP
rs778087385 4041 dbSNP
rs537598826 4050 dbSNP
rs879067430 4051 dbSNP
rs1046392298 4070 dbSNP
rs929985054 4072 dbSNP
rs1460177810 4074 dbSNP
rs972743425 4082 dbSNP
rs941330984 4089 dbSNP
rs918567571 4095 dbSNP
rs1243319031 4096 dbSNP
rs974170775 4106 dbSNP
rs1193559329 4110 dbSNP
rs758079800 4123 dbSNP
rs1481626842 4126 dbSNP
rs1424751236 4127 dbSNP
rs909991292 4127 dbSNP
rs1261007996 4129 dbSNP
rs911051120 4130 dbSNP
rs1161425410 4131 dbSNP
rs1343503660 4144 dbSNP
rs1417844919 4150 dbSNP
rs531621953 4157 dbSNP
rs1237694042 4160 dbSNP
rs1345994774 4165 dbSNP
rs985946845 4173 dbSNP
rs1350914622 4179 dbSNP
rs560903522 4190 dbSNP
rs1223992872 4201 dbSNP
rs1234866698 4206 dbSNP
rs570284285 4214 dbSNP
rs530724455 4221 dbSNP
rs563261208 4222 dbSNP
rs1490970380 4239 dbSNP
rs766024358 4241 dbSNP
rs1246457597 4242 dbSNP
rs760646584 4249 dbSNP
rs1179152558 4250 dbSNP
rs1378634060 4254 dbSNP
rs1439167316 4258 dbSNP
rs956303726 4258 dbSNP
rs1383769572 4265 dbSNP
rs1387415510 4268 dbSNP
rs1366171799 4273 dbSNP
rs1289712314 4280 dbSNP
rs999372773 4291 dbSNP
rs1426443256 4295 dbSNP
rs773303791 4301 dbSNP
rs1453123239 4306 dbSNP
rs999169926 4308 dbSNP
rs1022077421 4311 dbSNP
rs143718335 4312 dbSNP
rs1056720825 4330 dbSNP
rs1021882743 4333 dbSNP
rs1208573519 4335 dbSNP
rs1289687289 4339 dbSNP
rs1010613643 4340 dbSNP
rs1197181525 4348 dbSNP
rs1036931396 4350 dbSNP
rs894937023 4359 dbSNP
rs148865817 4360 dbSNP
rs1261958171 4368 dbSNP
rs1204233551 4375 dbSNP
rs1001740432 4388 dbSNP
rs907347249 4396 dbSNP
rs1046000246 4400 dbSNP
rs771933042 4406 dbSNP
rs1387161638 4407 dbSNP
rs542925722 4412 dbSNP
rs1281789116 4422 dbSNP
rs753877850 4423 dbSNP
rs1410354752 4439 dbSNP
rs1330584383 4445 dbSNP
rs1164038599 4449 dbSNP
rs1473853344 4450 dbSNP
rs1397736487 4451 dbSNP
rs1445539703 4453 dbSNP
rs985438256 4458 dbSNP
rs932746066 4459 dbSNP
rs1038342235 4467 dbSNP
rs1241910217 4480 dbSNP
rs941341078 4482 dbSNP
rs566071295 4486 dbSNP
rs1340623067 4489 dbSNP
rs1216708759 4501 dbSNP
rs745744257 4505 dbSNP
rs1256530052 4511 dbSNP
rs985929272 4514 dbSNP
rs1457540381 4522 dbSNP
rs1204536119 4532 dbSNP
rs547765471 4533 dbSNP
rs922681211 4534 dbSNP
rs532441016 4535 dbSNP
rs956187706 4537 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000359676.5 | 3UTR | UUCAUUUUCAAAAUGCUGCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000359676.5 | 3UTR | UUCAUUUUCAAAAUGCUGCUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911