miRTarBase - #MIRT154392 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDS2   
Synonyms -
Description CDP-diacylglycerol synthase 2
Transcript NM_003818   
Expression
Putative miRNA Targets on CDS2
3'UTR of CDS2
(miRNA target sites are highlighted)
>CDS2|NM_003818|3'UTR
   1 GGGCCACCCAGGGCCAGGAGAACAGGAACAGAACTGAGCAGGGGCAGGTCTCCAAGGCAAGCCCAGCTGGTGTGACTTAG
  81 ACAATGACGAGGCTTCAACTCACTGTCTTTTTTTTTTTTTTTTGGAGGGTATTTTTTATTTGTGGGTTCAAAAAATCTGT
 161 ATATACAGTCTATGTGTTTAGAATTTGTGTTGTAAGTAAACTACAGCTTTGAGTTGGAAAGAAGTCACGGGTTGTAAAAC
 241 CATTTGGATTTTTTTAAAACAAAAGTATTAATAATCTGGAAGACAGTGTTGCCCAGGTCAGGAGTGTTTTCTTGGTGGTT
 321 CCAGCCCCCATCAATTGAACTGTTTCTGGGCTCAGTCAGACACAGACATTCATCTGTGTCTGACCAAATCAGGGGACTTC
 401 CCCACCTGTGGTGGGAGGCACAGCTTAGATGTTTTGTACACCTGGTCTTTTCTAGAAATCCCTGCTTGGAGCTGCAGAAG
 481 GGTTGCCTTCTGTAGGTCGGAGGAATGGAGGCTTACTAACCAGGTAAGCCTTCTATGCATCCACACCAAAATCCTGCAGA
 561 ATGTAAGTAAGCTCTGCTTTATAAGATGGGTTCACCTTCATCGCAGACTGAAAGTTTCAGTTTTTATTTTTTTCAGAAAG
 641 CACGAAAAATTATTTATAATAGTCTGGAGAAAAAACACACTGTAATATTTCAAGTGTATGCAGTAGAATGTACTGTAACT
 721 GAGCCCTTTCCCACATGTCTAGGCTCCAATGTCTCCTGTAGGTCCACCTAACTGTGTGTTTTCAGGGACAATGCCATCCA
 801 TGTTTGTGCTGTAGACTTGCTGCTGCTGAATCCTTTCTGGGGACTTTCTCATCGGGCAGGGAGCAGAGGGCTTCTCGTTC
 881 ATGCACCCTTTGCCTGAACACCCATGTAGCTGCTGTGTTGTGTATATATTACTCTTAAGAGGAGTGTGTGTGTCTGTGTT
 961 TGTTTTAAAAGTCACTTATTTCTTACAGTGATTTCAATTGCACCATGACTTCTTCACTAAAACCACAAAGTCCTGCTTAA
1041 AACTATGGAAAACCTAACCTGATTAGAGCCTTGACTATTTTGAAGATTAAATGCACACTTTTTATATAATGTGACCAGTT
1121 TAAATGTAGTTTGTATTGTACTGGGGGACCTTTCGTTGTTGTTGTTTGCTTAAACTGTGATTTTTTTTCCCCTCCCTAAT
1201 TTCAGGGGTGAGATTGACTTTGGGAAGACAGATTAGTTCTTTGTCAGGCCAACAAGTGATGGAGTGCGGGAGAGAGAACT
1281 TGGCACCCAAATATATCAAACTATTCCGTGCCGTGGATGTTTTCATTGCCAACGAGGGTGTAATGATTTGCTTCTGCACC
1361 TTGGTCTAGTGCTGGTTTGTGGTGTTTTTGTTTGTAAATTAGCCTCACTGCCTCCCTGAAAGTGCACAGTCAGCCCAGGT
1441 CTCTAGAGTGTCCAGCAGAGGATGGAGCCCTCGGGATGTTTCAGCTCACACATCCTTGAGTGACTTCCCATATGTGTGTG
1521 GGGCTGAAGCGGCTTCTTTCCGCTGAACTTTTATTTCCATTTCAGCCTCGTGGCTTCTCTTATTCAGGTCCAAGGCCCCT
1601 TAAAAACAAAACATATTATCGCAAGGGCTTTCATTTCAGTATTGGCTGTGTCACTGGCAGGATGCATCACTCTCCAGGGC
1681 CTCTTTTTCGGAGCTACTCCCAATTCCACTCTTCTGTGATTCTGGCTGAGCAAGTTCATGCCGGTAGAGGCTCATTAAGT
1761 GAGGTCCTGGGCACCCCCCAAACAGGAAGTGTTTTCAGGCCCTTACATGCTTATCCTTAAGGTGAGTAGGTATCTCAGCA
1841 GCACACCCGAACAGTAAAGGTGATCAATAACGAAACTGTAGTTTTCAGATTGAAGAATGAACCTGGATCACCAAACTAGA
1921 TACCGAAAGGGCTCCTCATTTGTCTCTTTTGTCCCATTGTGGGCATATGGTGGGCTCCTTGAGAGGAGGGAGTCTCAGCT
2001 GGGGCCTGGCTGCAGAGACCTGCTCTTGAATAGGGCTGCCTTTGGGATCAGGGAGCCGAGCATACTGGGCAAGGCTCATC
2081 ATGTTCCTTTGTGGAAGTGGTTACTTGGTGGGGGTGGGGTGGGGAAGGGGGGTCTAGGAAGCCGAAGCTGAGTGCGCACT
2161 AGAGCTGCTAGCAGGCAGGCCAGAGGGTCAGCTTGTGTTTTATTTTCTGATTTCTCCTGCATGCTTTCTGGAGATGAGGA
2241 TTTTTTGTCAGGTAGCTAGGAGAGCACTGCCACCTTGTGTCCATATAGCACAATGTTTCTCTTTCCTATTCACAGACAAG
2321 ATTCAAGAAACCATTTTTACGTGTGTACATTCAAATCTTCATGAATGGCATCACTTGCTTTAGACCCATTTTTTTTTTAT
2401 TGGTCAGAAATAAAATGTGACTGCAACTGTGTGCCCTCCCTTGTCGTGAATTCCCTGTTTATCACTTCCATGCATGGTTT
2481 TATGCTTCTCATTTGTTTATGTATTCATGAATACTGCATAGTCCTGATTCAGAGACTTTTGCTTTGCTTTCCAACTTGTA
2561 TCCCTACATTCTCACAACAGCCTTCTTACCTCGGGTGAGAGTCATGAGCACCTTACCAGGCAGGGAGCTTCCCCAGGATA
2641 GTGTGGTGGAGTCAGGACTCACTCCATCCTGCACTTTACCCACAGGACACCTGGAGGGTCCCCCAGCCCTGCTTGCTTTT
2721 GTGAACGTCGTGTGAGTACACCGAGGTGTTGCAGCTTTCCTTCCCTCTAGCTCAGGAGGCCTGGCCTGAGCCAGGTTGGA
2801 GCTTAAATTGCTGTTGGCTCCTGCCTGGTGGAACAAGGGGGTCATAGAAACCAGGGCTGATGGGCACCCCCCAGCCCCTG
2881 GGAGCTCTGCTCATGACCGCTCACAGGGTACCGAGTCTTTGCCTTTTGTGTGTGCGCATGCTGCCCTCTTAACTGCTTTT
2961 AGTATTCAGAAAGGTTCCATTTATGTTTTACTCCTGAAAGTGAAACCCTCTTAGGCAACTTGTTTCATATTCTGGGCATT
3041 TTAGTAGCTACAGTATTTTGCATTTAAAATGTAATTACTCTTAGTATTGTACAGCCCTATAATGTATGAGAACTAGTTTC
3121 ACATCCTTTGAAACTAATCTCTTTCATTGGGGAGGATACAACTTTTGACTTTACACAGGTGGACTTTGAATCCATTTTTA
3201 TAGAATTTTTTTCCACTGTAACTTGACCTATATTATGCAAGAAAATCCCAAAAATATGTTTTAAGGGAGACTACACAGAC
3281 CTTGTGATTTGGTCTGAGCTAGTTGCTGAGTTGACTGGAGCCTTATTTGAATGGATCTTTGAGTTGAGATCTTCACACTG
3361 TCAGTGAGCCCTTGGCTCAGCCCTTGTCACCTGTTTGTATGGGGACCATGTTTCCCAAAGCTCAGGTTCATCTCCACTAT
3441 TGACAGAGTCGGGTAGTGGGAGAGTATAAGTGACTTGAGACAGAGTGTCCTTGCTCAGAAAACTGTGAAGCAGGGGTCTT
3521 GTTAGTTACAAAGCCAGTCCTAGTTGCATGTCCAAGGGGGTAGATTTTCATCACCCTACTAAATGTGGTATGTCACTGCT
3601 GAAGCCTTTTCCTGTTTTAGTAATATCTTAGGCACTATTGTCTTTTGTCTTCCAGAGTAACATATCTGGGCCCACCTTTC
3681 TTGCACACTGTGATTATGTGCTAAGAAAAGGGTGGAGTTGGGAGGACAATTTCACTTGAACAGGTTTCTGTTCTTCTGAG
3761 GTCAGGGTGGGGAGGATGTCCAGGTGACTTTTATGGACACATTGCAAGACAGTAAGCCGCGGATGGACTCTCACTTGTGC
3841 TTTGGAACACTGGACTCCAAAGAGCAGGTGGAACAAACTCTGGCCTGAAGATGATGGCTAATACTCAGGCAGAGCCCCGT
3921 ATTCTTCCCTGACTTGGTCAAAACAAACTTCCTTTTCCCTTGATCACCCTGCACGCAGCTGCCCAGCTTCCAGTTTTTAA
4001 AGAGATGAACAGCTCTCACTTCCTGACTCAGTTTCTCTTGTTGGGTGGGGGCCTTGTGCCACAACCTGCATGGGGTGCTA
4081 GGGTTTAAACCAAGTGGTCACGAAGGATTCTTATCTCAGGGCTCTGCCTGGCCCACCTTCTCTTGGGCCTGGACTCTCCT
4161 TATCCACATCCCTGCAGAAGGTGGGCCCTATTCTCAGAAGAGTCCTGGCTGCTGTTGCCATCTGAATGCGCCCTTCCCTT
4241 TCAGGTTGACCAGCAGTGGCCTTACCTGGCCTCTCAGGTGGATGGAGGCTGTTCTCATCTGGGGCTGTCTCTTGATTAAG
4321 GCTGTCACCTGTTTGTATAGGGACCATGTTTCCCAACGCACTTTGAGTGCAGTTTAGGAGGTATCCTTTGGATGCTGAAG
4401 TGTTGGGATTTTGAGGACATGCGGATGATTTATGAGAATAGAGGGGCAGAGTTTGTGAAGTCTAGGGTTTTTTGTCCAGT
4481 GGGTTTCAAATTTGTTGGCTGTTTAAAGACCCTGTCTCCTCCCCCACCCTCCCCTTCCTTTTCCCATCAAATGCCTACCT
4561 ACTGAGGCGCCTTCTCTTTTTATTCTTGAGCCAATGAGATATCAGTGTGTTTATTAATAAGGATTGCAATAGTATAGTGC
4641 TTAATATGTGCCAGGCATAGTGCTAAGGGTTTACATACGTTATCCCTTTTAATCCAGAAAACAGCCTTTGATTAGGTATT
4721 GTTGTCTCCATTTTATAGATGAGGAAACTGAGGCAGTATGACTGAGGCCGAGAGCAGTGGTTAAGACAGACTTTGGGATC
4801 AAATCACCCTAGGTGCGGGCAGGTTTCTAGGCTGCTCTAAGCTTCTACCTTGAAGGCAGTTGGGTCTGATAATAGTACCT
4881 TCTTCCTGGGGTGGTTGTGAGGATATAACGAGGTAATGCATGTAAGCATTTAGTACCATGCCTGGCACATAGTAAGCACT
4961 CAATAAATGGTAGTTACTTTTGTTGAGCTCAGCTGGTAGTTTGACCTCCGTTGGTGCAATGCCAGAGATGGGATTGTCAG
5041 CCACCACACTGCCACCACCCTGCACACAGTCTGGGTCCCTCCGAGAGAAGCACGCCAACCTTAACATCCCCTACAGCATC
5121 TTGGTGCTTCACACACCATTTAGGAGGCCACCCTAACGAGGCAAGAGGACATGGGGGTGTGCAGAAGTTCTGTTCTTAGT
5201 GAGAATGGCTGGCCTGAGAATCCAGCTCACCTCCTCTGCCCACAGTCTGGACTGCTTGTGGGAAGGCCATCTCCTCCTGT
5281 CTGGTGGTACCTCCACTCTGGGCAGGGAGGGCCTGTCTGTGACTCGCTCTGGACCCCACTTCCCGCTCTGGCCAAGGGCT
5361 GTCTTCTGTGCACATAGCTCAGGAGCCTGCAGCAGTTCCCTGTATGGGTGGATGTCCTCAGGGGCCAAGAAGAGAAGAAT
5441 GGGGACAACAGAAACCTGCTTTGTAGGGGATTATGTAGACTAAAAGCCTAGAAGTTCTGCCCACATCCTTATGACGCAGC
5521 CAATCTGGAGCTTCATGTTTCCTTCTAAAAGTAGTAACCGGGTAGAAGTGGGTGACCCATTGAGGACACATGATGTGAGG
5601 TATTTCTGCCGGATTCTAGGTTAGCAAAGACTCAAATGGGTGACTCATGAATGAAGGGAGAACAGGCACAGGACTTAATG
5681 AAAAGAGTTTCTTGAACTTAGTTTTCTGAATGGGGGTGGGGAGTTGGGGCACGTGTGTGTAAGGGGAGGCTGCCTCACTT
5761 TGAAGGAATGGTGTTGGCTAACAGGATCCATGAAATTCCTAGGTCAGTTGAATAATAACTGAACTACTGGTTTGACTGTG
5841 GATTATTTCCTGGGTATTAGTGGGACCCAACAGCACATTGCTATTAATAGTATGGAAATAATGGTCCCTCTGTTTCATTG
5921 AATTGCTGAAGTAATGATAATGCCATGAACCAGGAGAAGATGGTTGTGGGGGTTTCTAGGAAGCAGCTGCTGTGACAGGC
6001 CAATCCCAGGCTTGCCCCCGAGCCCTCCTGTCCTTCTGGGTTTGTGTTTGCCTTGCCTGGTGCTTCCTCCCTCATTGTGT
6081 TGTTGAATAGACCTAGGCAGCCTTGTATCCATAGAAAGCCTCCACTGCTGGGCCGGGGAGGGGGTTGTGGTAAGGGCCCT
6161 CTGGAAATCAAGCAGAGAATGCCTTTGCAGTGGTCTCCCGGGCATTGGGCAGGGCCTAGCCTTTTGCAGCCCCCAGAGGA
6241 CCTTGCCTGCATAAAGCACTCAGAAGGGTTAGCCACCTGGTGATTTTGTCTCTAGTGAAACTGTGTTTGCCGATAATCAT
6321 CCACATAGCCACCTCTGTCCTCGCAGTTTGGATGCCTTTTTTTGACACCTGCGCTAGGTTCTTGTATGCTGGCTTTTCTT
6401 AAAGGAACAGCAGAGTAGAAAAGAGGTTGAGAATGTTTTCTAGCAGGCAGAATGTGCATACATGTTTTCATGAGTGTCCT
6481 TTGGGTGCTGTTTCTTTTAAATCCTCTGTGCACAGGGCTCTGGCCTTTAGTAAACTGTTTTTCTGTCTTACGTCATGCTG
6561 ACTGGGTGCTAGGGGCTGATTACAAAGGGGAAGAGTTGAACAGACATCAGGGGCCGATGAAACCAAAGGACTAGGAGTCA
6641 GGAGAACAAGTCAGGGATTAGGAGACAGCGGTTTGGTTTATTGTTATCCAGCTGGAGGACTCCTAGGGGCAGCAGCAGGA
6721 GGAATACCAGGGCCACGGAGGGGCCAGGAGTCTCACAGTGGAGGGCAGACTCTAACAGATGCCAGCTGAACGCTCGCTGG
6801 CCCTGGATGTCATACGAGTTGGGGACCAGAAATCTGGGCTCAGAGAACCCGTCCAGGGAGATTTGAAGCCATGGGTTATC
6881 TTCTAGAGTTGATACTGATAATATATTTTAATTTTTATTGATGTTTAATACCTTCTGAAACAGGAGGGTAAGATCAGATG
6961 GGAAGCCCCTCTGTTGAAGGATCTTGGGAACCTTGGTGGTTTTTTTTTTTTTTTTGGTTTTTTTTTTTTGATCGAGCTGT
7041 GGACATCCTTCTTAATTCGATTCTGAGGATTTGTTTAACTAAAAAGTTCCCAAACACAGAAAGGGCCTCCCCACCTGCTT
7121 TGGGGAGCTGTCTGTGCTGGGAGTGCCAGGCATCCCATGGGACCCATCACTGCCAGTGTCTGTGCCTCCCAGAGGTCAGC
7201 CGTGTCTGCCCTGGCTCTGTCTCCTCTGTGACAGGGCAGAGCATTTCTGGTCAGTTTCTCCATGGTGCCTCCCACCCCTT
7281 TGTAAAGTGGATGGACATGATGGAATTCAGTTGTCTCACCCTGATAGCCTGGGTGTTGATATTCACTTTACCCGCACTCA
7361 GACACAGGCGACCTTGAAGCAGTTCTCGGTGTGTAGAGTCCACGTGACAGTCCCCACAGCCTCCCCAGATAGCTGTGTGC
7441 CTGTGCGCTACTGCTGTGCCATTTTCCCAACTTGGCGTTTCACTAAATGCAGCTGATCTCTCTCTCTGTGCACTCGTGAT
7521 CCATGTTGAACAATACATGTAGGTTCTTTTTCCACGCAATGTAAGAACATGATATACTGTACGTTGGAAAGCATTTACCT
7601 TATTTATATACCTGAATGTTCCTACTACACAAATAAACATATATTAAATTCTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|:||  ||:  ||||||| 
Target 5' tgTAGAC--TTG-CTGCTGCTg 3'
810 - 828 147.00 -13.00
2
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || ||: ||||||:| 
Target 5' gagtgtCCTTTGGGTGCTGTTt 3'
6472 - 6493 144.00 -13.50
3
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||||||  | || ||||| 
Target 5' ctaAAACCACAAAGTCCTGCTt 3'
1017 - 1038 139.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN25905025 12 COSMIC
COSN30586755 36 COSMIC
COSN30180166 40 COSMIC
COSN31592699 118 COSMIC
COSN1250501 124 COSMIC
COSN20079694 124 COSMIC
COSN20093684 127 COSMIC
COSN28872082 138 COSMIC
COSN18716787 139 COSMIC
COSN31600420 158 COSMIC
COSN22285894 263 COSMIC
COSN16994191 289 COSMIC
COSN31534399 360 COSMIC
COSN21546647 368 COSMIC
COSN26637892 775 COSMIC
COSN31562572 947 COSMIC
COSN16131404 996 COSMIC
COSN19531518 1019 COSMIC
COSN5445659 1102 COSMIC
COSN5765699 1443 COSMIC
COSN19082548 1715 COSMIC
COSN17930320 1780 COSMIC
COSN25903016 2116 COSMIC
COSN20719007 2145 COSMIC
COSN7096674 2192 COSMIC
COSN21943663 2239 COSMIC
COSN195675 2291 COSMIC
COSN5445661 2465 COSMIC
COSN20608671 2619 COSMIC
COSN24996552 3317 COSMIC
COSN25397751 3428 COSMIC
COSN4970583 3984 COSMIC
COSN5973864 4103 COSMIC
COSN7096685 4157 COSMIC
COSN1875842 4261 COSMIC
COSN21809755 4727 COSMIC
COSN22094804 4753 COSMIC
COSN32062496 4799 COSMIC
COSN16532397 4892 COSMIC
COSN8995579 5090 COSMIC
COSN16695223 5176 COSMIC
COSN31658699 5451 COSMIC
COSN21158740 5616 COSMIC
COSN29455619 5687 COSMIC
COSN4970585 5692 COSMIC
COSN15927244 5842 COSMIC
COSN21836415 6241 COSMIC
COSN27296226 6313 COSMIC
COSN27121222 6419 COSMIC
COSN15051770 6553 COSMIC
COSN27811845 6676 COSMIC
COSN16284943 7014 COSMIC
COSN16287269 7016 COSMIC
COSN14563023 7203 COSMIC
COSN14531848 7318 COSMIC
COSN5973875 7392 COSMIC
COSN32063360 7517 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs971821941 2 dbSNP
rs746071406 3 dbSNP
rs370840326 4 dbSNP
rs373995252 6 dbSNP
rs1301371769 7 dbSNP
rs752051902 7 dbSNP
rs749858431 8 dbSNP
rs757385853 8 dbSNP
rs1361149421 10 dbSNP
rs965682104 14 dbSNP
rs769070167 15 dbSNP
rs774804634 16 dbSNP
rs747661716 25 dbSNP
rs202125562 27 dbSNP
rs377586394 29 dbSNP
rs772908896 31 dbSNP
rs370518772 32 dbSNP
rs1302815322 33 dbSNP
rs760242299 35 dbSNP
rs781384929 40 dbSNP
rs1209053774 41 dbSNP
rs1465923664 44 dbSNP
rs1280056167 45 dbSNP
rs1402218813 47 dbSNP
rs766244332 49 dbSNP
rs201416938 50 dbSNP
rs759334380 51 dbSNP
rs1466882800 61 dbSNP
rs575819305 62 dbSNP
rs953438807 70 dbSNP
rs1168219863 80 dbSNP
rs949831940 88 dbSNP
rs566011535 89 dbSNP
rs865838029 91 dbSNP
rs1378216676 93 dbSNP
rs1201073308 99 dbSNP
rs1437980866 104 dbSNP
rs11477708 108 dbSNP
rs1237768108 108 dbSNP
rs1241720516 108 dbSNP
rs1287483288 108 dbSNP
rs79005883 108 dbSNP
rs1399321566 111 dbSNP
rs980501376 125 dbSNP
rs77534359 126 dbSNP
rs879164060 127 dbSNP
rs536725442 128 dbSNP
rs554896558 129 dbSNP
rs1342333516 130 dbSNP
rs879083689 132 dbSNP
rs879006229 139 dbSNP
rs576566865 141 dbSNP
rs878935590 143 dbSNP
rs1220739209 145 dbSNP
rs763508961 146 dbSNP
rs1317757373 147 dbSNP
rs537786875 153 dbSNP
rs1350924576 156 dbSNP
rs1201527225 162 dbSNP
rs559255841 164 dbSNP
rs1441206358 169 dbSNP
rs1186163018 173 dbSNP
rs148444736 186 dbSNP
rs376747167 186 dbSNP
rs1331964142 188 dbSNP
rs1478579050 197 dbSNP
rs1191124682 210 dbSNP
rs780589428 229 dbSNP
rs550642175 230 dbSNP
rs1480677530 243 dbSNP
rs909320617 251 dbSNP
rs1033532148 257 dbSNP
rs1399923385 266 dbSNP
rs1379790548 268 dbSNP
rs1413874586 269 dbSNP
rs749636642 271 dbSNP
rs893111691 273 dbSNP
rs997265601 277 dbSNP
rs3746676 286 dbSNP
rs1443390425 292 dbSNP
rs370213630 301 dbSNP
rs1203918172 307 dbSNP
rs541002269 308 dbSNP
rs1486997709 310 dbSNP
rs987053101 316 dbSNP
rs1240346809 325 dbSNP
rs1015706245 326 dbSNP
rs1340127497 327 dbSNP
rs1234349674 328 dbSNP
rs961554064 335 dbSNP
rs1340896948 337 dbSNP
rs373120596 340 dbSNP
rs372714470 343 dbSNP
rs971822292 353 dbSNP
rs1200424722 355 dbSNP
rs1286081534 356 dbSNP
rs920358714 361 dbSNP
rs937713918 368 dbSNP
rs1053443065 372 dbSNP
rs1421663982 375 dbSNP
rs774485960 381 dbSNP
rs762108925 396 dbSNP
rs893568677 399 dbSNP
rs1009320065 404 dbSNP
rs1473300786 409 dbSNP
rs1213995782 417 dbSNP
rs1192043573 419 dbSNP
rs1477788106 420 dbSNP
rs991572054 422 dbSNP
rs1264602725 426 dbSNP
rs915792965 433 dbSNP
rs1020746232 443 dbSNP
rs559372544 451 dbSNP
rs1200688894 455 dbSNP
rs1045715563 469 dbSNP
rs924419663 470 dbSNP
rs934496443 471 dbSNP
rs1159137938 472 dbSNP
rs879058279 472 dbSNP
rs901044414 475 dbSNP
rs1054515212 478 dbSNP
rs1339744948 480 dbSNP
rs998502811 483 dbSNP
rs574483819 484 dbSNP
rs1421523518 487 dbSNP
rs1348226401 497 dbSNP
rs893217004 498 dbSNP
rs1406175851 499 dbSNP
rs541900510 500 dbSNP
rs1168963289 506 dbSNP
rs1465494815 510 dbSNP
rs953485652 512 dbSNP
rs1387595249 520 dbSNP
rs996819221 529 dbSNP
rs563385060 530 dbSNP
rs1050187902 536 dbSNP
rs986149776 537 dbSNP
rs891160548 555 dbSNP
rs1008420961 557 dbSNP
rs1197640941 562 dbSNP
rs1451838132 568 dbSNP
rs531291947 572 dbSNP
rs16990718 586 dbSNP
rs961502439 590 dbSNP
rs1317117434 597 dbSNP
rs996093597 603 dbSNP
rs1258573758 619 dbSNP
rs1027374001 621 dbSNP
rs951891149 636 dbSNP
rs919424470 641 dbSNP
rs991296484 642 dbSNP
rs915574994 644 dbSNP
rs192605496 645 dbSNP
rs926911509 645 dbSNP
rs1284709658 646 dbSNP
rs1488587602 647 dbSNP
rs1211320826 648 dbSNP
rs377160221 650 dbSNP
rs1422379478 663 dbSNP
rs139435606 664 dbSNP
rs1053391316 674 dbSNP
rs1450889573 677 dbSNP
rs532392860 678 dbSNP
rs771763847 686 dbSNP
rs924534430 689 dbSNP
rs914952185 696 dbSNP
rs945124352 698 dbSNP
rs1239870414 716 dbSNP
rs1437773726 735 dbSNP
rs1310352493 736 dbSNP
rs1042153344 738 dbSNP
rs1379806050 739 dbSNP
rs1350206812 743 dbSNP
rs370375427 747 dbSNP
rs998053520 748 dbSNP
rs535974201 750 dbSNP
rs1007533351 755 dbSNP
rs1359059775 761 dbSNP
rs765693956 764 dbSNP
rs1414525892 768 dbSNP
rs551387702 773 dbSNP
rs963415330 774 dbSNP
rs536383533 779 dbSNP
rs932720134 785 dbSNP
rs1380583705 786 dbSNP
rs185604094 789 dbSNP
rs1482192615 790 dbSNP
rs570149993 792 dbSNP
rs971278152 801 dbSNP
rs1321860826 806 dbSNP
rs982314063 809 dbSNP
rs1246532061 812 dbSNP
rs544134397 823 dbSNP
rs145170759 827 dbSNP
rs959617126 847 dbSNP
rs1309469696 848 dbSNP
rs1198988764 852 dbSNP
rs989729979 854 dbSNP
rs897420566 855 dbSNP
rs1177990696 862 dbSNP
rs1249892874 866 dbSNP
rs1417199659 871 dbSNP
rs577642214 877 dbSNP
rs1027565945 878 dbSNP
rs1366875095 892 dbSNP
rs959603554 896 dbSNP
rs1421772799 899 dbSNP
rs73586501 903 dbSNP
rs922395330 918 dbSNP
rs1476158469 921 dbSNP
rs1022737561 930 dbSNP
rs933791242 931 dbSNP
rs1464512447 947 dbSNP
rs1488695106 949 dbSNP
rs750949597 952 dbSNP
rs971020834 955 dbSNP
rs143949213 976 dbSNP
rs889663712 987 dbSNP
rs1397209054 991 dbSNP
rs1309987057 998 dbSNP
rs552999815 1010 dbSNP
rs1278194115 1024 dbSNP
rs574371177 1028 dbSNP
rs541564921 1029 dbSNP
rs990116941 1035 dbSNP
rs1362059514 1039 dbSNP
rs1290197455 1044 dbSNP
rs563357273 1046 dbSNP
rs1259724964 1051 dbSNP
rs1165186006 1052 dbSNP
rs148664719 1055 dbSNP
rs1421380026 1059 dbSNP
rs993512661 1078 dbSNP
rs1026785973 1092 dbSNP
rs112348943 1103 dbSNP
rs113927874 1107 dbSNP
rs1189647882 1108 dbSNP
rs1256443773 1115 dbSNP
rs1488268034 1117 dbSNP
rs1266304947 1125 dbSNP
rs932524482 1130 dbSNP
rs985486499 1131 dbSNP
rs6116683 1134 dbSNP
rs944009140 1135 dbSNP
rs1265809057 1136 dbSNP
rs1453833824 1137 dbSNP
rs192957660 1142 dbSNP
rs897195838 1144 dbSNP
rs528401951 1148 dbSNP
rs1366429447 1153 dbSNP
rs1397860893 1155 dbSNP
rs3746677 1155 dbSNP
rs1169784969 1156 dbSNP
rs1462457527 1165 dbSNP
rs977798944 1169 dbSNP
rs895278931 1172 dbSNP
rs922311488 1176 dbSNP
rs368483864 1181 dbSNP
rs3833325 1181 dbSNP
rs933760458 1181 dbSNP
rs1456669413 1189 dbSNP
rs559533578 1192 dbSNP
rs911053095 1193 dbSNP
rs941205271 1195 dbSNP
rs1038267506 1197 dbSNP
rs1170207652 1198 dbSNP
rs1360201843 1200 dbSNP
rs1374326442 1211 dbSNP
rs1468059156 1213 dbSNP
rs1012427822 1214 dbSNP
rs1398543281 1214 dbSNP
rs530054620 1219 dbSNP
rs151226067 1233 dbSNP
rs570108077 1236 dbSNP
rs1400211706 1237 dbSNP
rs1438089462 1240 dbSNP
rs906952241 1244 dbSNP
rs531007621 1250 dbSNP
rs1217723892 1254 dbSNP
rs1031332519 1258 dbSNP
rs552840358 1260 dbSNP
rs558713342 1261 dbSNP
rs571048964 1265 dbSNP
rs955761151 1268 dbSNP
rs990454728 1269 dbSNP
rs1021561700 1272 dbSNP
rs953983717 1275 dbSNP
rs1011048775 1277 dbSNP
rs1254322578 1278 dbSNP
rs1337327429 1280 dbSNP
rs376154035 1281 dbSNP
rs1022474465 1283 dbSNP
rs184515327 1301 dbSNP
rs966942302 1302 dbSNP
rs188840903 1304 dbSNP
rs1417980433 1308 dbSNP
rs1029329796 1309 dbSNP
rs756969325 1313 dbSNP
rs944125361 1314 dbSNP
rs1367088399 1316 dbSNP
rs972827431 1320 dbSNP
rs1187404412 1326 dbSNP
rs780751639 1333 dbSNP
rs941142842 1334 dbSNP
rs1487057442 1335 dbSNP
rs1435401527 1339 dbSNP
rs931356366 1341 dbSNP
rs1205361641 1343 dbSNP
rs973908304 1353 dbSNP
rs1263480124 1355 dbSNP
rs77805175 1356 dbSNP
rs181309279 1365 dbSNP
rs1299509355 1366 dbSNP
rs575574723 1369 dbSNP
rs1046093403 1373 dbSNP
rs1339950588 1388 dbSNP
rs1358176107 1389 dbSNP
rs1429624689 1395 dbSNP
rs1319148029 1397 dbSNP
rs6116684 1403 dbSNP
rs1402688480 1415 dbSNP
rs1293862700 1416 dbSNP
rs755635179 1418 dbSNP
rs374504723 1419 dbSNP
rs906520653 1420 dbSNP
rs1420638262 1422 dbSNP
rs1192147812 1425 dbSNP
rs1217405371 1427 dbSNP
rs1476517449 1428 dbSNP
rs113805579 1429 dbSNP
rs756810975 1431 dbSNP
rs780532008 1437 dbSNP
rs1002608918 1438 dbSNP
rs1052896486 1439 dbSNP
rs1212831252 1445 dbSNP
rs891431652 1448 dbSNP
rs1011255243 1451 dbSNP
rs1021927823 1464 dbSNP
rs1055192154 1474 dbSNP
rs544454982 1479 dbSNP
rs1317327446 1483 dbSNP
rs1270864690 1486 dbSNP
rs1433033359 1492 dbSNP
rs1329563441 1499 dbSNP
rs1323212532 1510 dbSNP
rs1442028969 1514 dbSNP
rs1397149111 1515 dbSNP
rs1169115321 1516 dbSNP
rs575023722 1519 dbSNP
rs1420911836 1522 dbSNP
rs6085025 1525 dbSNP
rs1288289520 1531 dbSNP
rs879565224 1532 dbSNP
rs1244606196 1542 dbSNP
rs140379455 1543 dbSNP
rs1019399110 1547 dbSNP
rs965215000 1548 dbSNP
rs1196622142 1553 dbSNP
rs902721708 1554 dbSNP
rs35911658 1557 dbSNP
rs999777008 1559 dbSNP
rs1216394649 1560 dbSNP
rs1189844915 1561 dbSNP
rs1342981824 1566 dbSNP
rs751724403 1570 dbSNP
rs918689816 1571 dbSNP
rs955052917 1574 dbSNP
rs867478402 1578 dbSNP
rs1006988453 1580 dbSNP
rs1377989596 1584 dbSNP
rs1446561334 1587 dbSNP
rs952786353 1589 dbSNP
rs16990725 1591 dbSNP
rs368055426 1593 dbSNP
rs973854422 1597 dbSNP
rs918422890 1600 dbSNP
rs572695032 1607 dbSNP
rs1396558985 1608 dbSNP
rs1454459985 1608 dbSNP
rs144141819 1613 dbSNP
rs1469494442 1614 dbSNP
rs146799297 1621 dbSNP
rs1206546400 1630 dbSNP
rs928555731 1639 dbSNP
rs779272262 1640 dbSNP
rs1324997740 1656 dbSNP
rs939344037 1658 dbSNP
rs1055050687 1663 dbSNP
rs748277301 1667 dbSNP
rs1223561728 1671 dbSNP
rs1374525221 1673 dbSNP
rs1046709227 1675 dbSNP
rs1446496808 1678 dbSNP
rs1448961629 1686 dbSNP
rs117556296 1690 dbSNP
rs935504524 1691 dbSNP
rs1053252593 1694 dbSNP
rs867029598 1699 dbSNP
rs542238835 1700 dbSNP
rs1011620283 1702 dbSNP
rs563520991 1704 dbSNP
rs1042728722 1706 dbSNP
rs1219757325 1708 dbSNP
rs1272975770 1715 dbSNP
rs1000129024 1735 dbSNP
rs1051322263 1743 dbSNP
rs1471757130 1744 dbSNP
rs1256770723 1745 dbSNP
rs1458579601 1747 dbSNP
rs891377500 1754 dbSNP
rs773353470 1774 dbSNP
rs1017946845 1775 dbSNP
rs1317852514 1776 dbSNP
rs1006751763 1777 dbSNP
rs962411006 1778 dbSNP
rs1019515326 1779 dbSNP
rs1294504903 1782 dbSNP
rs1025428850 1783 dbSNP
rs1469124507 1785 dbSNP
rs760806431 1788 dbSNP
rs1286720514 1799 dbSNP
rs1452636645 1804 dbSNP
rs1345470299 1819 dbSNP
rs993967621 1825 dbSNP
rs183986023 1832 dbSNP
rs1403278785 1833 dbSNP
rs1165576830 1835 dbSNP
rs1163905546 1845 dbSNP
rs928530429 1849 dbSNP
rs140508849 1850 dbSNP
rs984645695 1853 dbSNP
rs1329308397 1854 dbSNP
rs1219815847 1855 dbSNP
rs916571727 1865 dbSNP
rs571060618 1866 dbSNP
rs528656770 1868 dbSNP
rs2295510 1872 dbSNP
rs1336237248 1875 dbSNP
rs1381557904 1877 dbSNP
rs1381201377 1887 dbSNP
rs1362222963 1891 dbSNP
rs568708137 1893 dbSNP
rs1438366196 1907 dbSNP
rs1293036084 1917 dbSNP
rs1165511779 1921 dbSNP
rs1052620123 1923 dbSNP
rs915435646 1925 dbSNP
rs947150086 1926 dbSNP
rs1043229196 1929 dbSNP
rs1429262072 1932 dbSNP
rs1421847975 1933 dbSNP
rs1189701798 1934 dbSNP
rs1051711330 1935 dbSNP
rs891329781 1939 dbSNP
rs889433278 1946 dbSNP
rs1007147394 1955 dbSNP
rs1226043390 1958 dbSNP
rs1307581870 1960 dbSNP
rs1437787049 1961 dbSNP
rs150430322 1963 dbSNP
rs1369908655 1964 dbSNP
rs898151380 1966 dbSNP
rs1442878027 1967 dbSNP
rs189261022 1968 dbSNP
rs1471594157 1969 dbSNP
rs901097516 1978 dbSNP
rs1462504927 1979 dbSNP
rs1356388588 2001 dbSNP
rs1171961354 2015 dbSNP
rs1288526081 2018 dbSNP
rs1395963605 2023 dbSNP
rs1195891020 2029 dbSNP
rs1186856419 2034 dbSNP
rs1438293065 2035 dbSNP
rs1250361835 2045 dbSNP
rs1196889877 2054 dbSNP
rs1480649918 2055 dbSNP
rs994529345 2058 dbSNP
rs1025466913 2059 dbSNP
rs1346661787 2063 dbSNP
rs1303774177 2064 dbSNP
rs1168288763 2067 dbSNP
rs1395626188 2068 dbSNP
rs568502465 2068 dbSNP
rs34915502 2070 dbSNP
rs1306154042 2076 dbSNP
rs577251397 2078 dbSNP
rs1398613099 2079 dbSNP
rs1311111965 2082 dbSNP
rs1023743453 2087 dbSNP
rs1361014449 2088 dbSNP
rs969349121 2093 dbSNP
rs1413148783 2100 dbSNP
rs1312434372 2107 dbSNP
rs1341380516 2110 dbSNP
rs958603901 2111 dbSNP
rs1183102721 2114 dbSNP
rs1220801476 2115 dbSNP
rs1268824270 2116 dbSNP
rs149196199 2117 dbSNP
rs1220363088 2121 dbSNP
rs1212620136 2127 dbSNP
rs1280525033 2127 dbSNP
rs201362541 2127 dbSNP
rs6133193 2129 dbSNP
rs540397035 2131 dbSNP
rs77407209 2133 dbSNP
rs577683865 2134 dbSNP
rs75789066 2134 dbSNP
rs11376563 2135 dbSNP
rs79995762 2135 dbSNP
rs915400887 2144 dbSNP
rs946900167 2145 dbSNP
rs761564481 2151 dbSNP
rs1384585017 2152 dbSNP
rs544171703 2155 dbSNP
rs180751229 2156 dbSNP
rs530880043 2157 dbSNP
rs1432883096 2158 dbSNP
rs752076670 2166 dbSNP
rs757768176 2167 dbSNP
rs1474573400 2168 dbSNP
rs900880057 2169 dbSNP
rs796431346 2185 dbSNP
rs78604961 2187 dbSNP
rs888262197 2190 dbSNP
rs755552243 2192 dbSNP
rs1205491495 2198 dbSNP
rs1352591140 2201 dbSNP
rs1271124512 2213 dbSNP
rs894297501 2218 dbSNP
rs1023691152 2221 dbSNP
rs1295179866 2225 dbSNP
rs905280754 2233 dbSNP
rs1021471136 2237 dbSNP
rs1319290905 2238 dbSNP
rs1392740232 2240 dbSNP
rs968606248 2241 dbSNP
rs1004183985 2242 dbSNP
rs1361371185 2247 dbSNP
rs1164494243 2251 dbSNP
rs564539222 2252 dbSNP
rs1003669619 2263 dbSNP
rs1474174110 2270 dbSNP
rs765882936 2282 dbSNP
rs1193463424 2284 dbSNP
rs550855699 2285 dbSNP
rs988394347 2286 dbSNP
rs1212888764 2287 dbSNP
rs1437804929 2288 dbSNP
rs1468833708 2290 dbSNP
rs528700329 2294 dbSNP
rs1277049988 2298 dbSNP
rs1212864231 2300 dbSNP
rs1338836376 2302 dbSNP
rs1270921596 2306 dbSNP
rs143328476 2309 dbSNP
rs956756466 2319 dbSNP
rs968217945 2321 dbSNP
rs986715253 2323 dbSNP
rs1346357789 2325 dbSNP
rs1232862513 2328 dbSNP
rs1303094861 2329 dbSNP
rs114773445 2334 dbSNP
rs1397309029 2339 dbSNP
rs942443319 2341 dbSNP
rs187362634 2342 dbSNP
rs1395184964 2346 dbSNP
rs1168084981 2348 dbSNP
rs975581692 2352 dbSNP
rs1392922098 2353 dbSNP
rs148345903 2355 dbSNP
rs1454590651 2373 dbSNP
rs929649163 2386 dbSNP
rs1046946075 2388 dbSNP
rs1248325501 2389 dbSNP
rs931544778 2389 dbSNP
rs909798672 2395 dbSNP
rs568512657 2399 dbSNP
rs1452032411 2400 dbSNP
rs1207436053 2401 dbSNP
rs1200754153 2403 dbSNP
rs1251012046 2404 dbSNP
rs1345992071 2406 dbSNP
rs1044918811 2411 dbSNP
rs1453759718 2413 dbSNP
rs1173057923 2417 dbSNP
rs1303031330 2433 dbSNP
rs748521537 2438 dbSNP
rs760232070 2446 dbSNP
rs1381052982 2447 dbSNP
rs1421740542 2455 dbSNP
rs1157117734 2456 dbSNP
rs1336919414 2457 dbSNP
rs886755733 2465 dbSNP
rs758758395 2469 dbSNP
rs892445271 2472 dbSNP
rs539005158 2473 dbSNP
rs551074359 2474 dbSNP
rs1325970334 2475 dbSNP
rs1369373769 2477 dbSNP
rs1009997518 2480 dbSNP
rs1435027731 2481 dbSNP
rs1427042776 2482 dbSNP
rs1175316617 2484 dbSNP
rs1469539891 2494 dbSNP
rs894245072 2498 dbSNP
rs2295511 2499 dbSNP
rs968700411 2500 dbSNP
rs1042865411 2501 dbSNP
rs1314262373 2504 dbSNP
rs866604049 2508 dbSNP
rs1007807050 2512 dbSNP
rs1223618478 2519 dbSNP
rs1290809258 2520 dbSNP
rs1352020247 2520 dbSNP
rs776178095 2525 dbSNP
rs747210310 2529 dbSNP
rs966212893 2531 dbSNP
rs1031617669 2541 dbSNP
rs1415040860 2542 dbSNP
rs771086696 2543 dbSNP
rs976443137 2550 dbSNP
rs922363796 2555 dbSNP
rs533637319 2561 dbSNP
rs951041276 2567 dbSNP
rs1399955568 2569 dbSNP
rs1408551212 2571 dbSNP
rs1161295060 2573 dbSNP
rs546260234 2574 dbSNP
rs1256932385 2576 dbSNP
rs1236422710 2578 dbSNP
rs1188812010 2586 dbSNP
rs1259710503 2586 dbSNP
rs1356643666 2589 dbSNP
rs1211374610 2590 dbSNP
rs17785402 2593 dbSNP
rs112593797 2594 dbSNP
rs1447948480 2595 dbSNP
rs745989279 2596 dbSNP
rs1270505507 2603 dbSNP
rs1232033333 2607 dbSNP
rs975529238 2611 dbSNP
rs1045026093 2617 dbSNP
rs1238862528 2618 dbSNP
rs1420890432 2628 dbSNP
rs1292102227 2630 dbSNP
rs926429109 2635 dbSNP
rs1380874493 2642 dbSNP
rs952879337 2643 dbSNP
rs1363388961 2645 dbSNP
rs1322409330 2651 dbSNP
rs1389153219 2651 dbSNP
rs1458631891 2652 dbSNP
rs983425627 2653 dbSNP
rs1165739511 2667 dbSNP
rs1165330593 2675 dbSNP
rs768694975 2676 dbSNP
rs938322454 2678 dbSNP
rs1056799698 2682 dbSNP
rs1486374521 2684 dbSNP
rs1461362762 2690 dbSNP
rs1212261381 2694 dbSNP
rs915626182 2698 dbSNP
rs1468426237 2701 dbSNP
rs1274414661 2705 dbSNP
rs192206395 2727 dbSNP
rs892544934 2728 dbSNP
rs761661854 2730 dbSNP
rs115679878 2731 dbSNP
rs903879063 2733 dbSNP
rs575726181 2743 dbSNP
rs147533038 2744 dbSNP
rs1459444964 2749 dbSNP
rs1352868590 2753 dbSNP
rs1008612372 2755 dbSNP
rs117040381 2758 dbSNP
rs573320030 2771 dbSNP
rs964080028 2776 dbSNP
rs1291197371 2779 dbSNP
rs997643413 2784 dbSNP
rs181714474 2788 dbSNP
rs562354261 2797 dbSNP
rs982591776 2798 dbSNP
rs1259850999 2801 dbSNP
rs1027099384 2810 dbSNP
rs1342424497 2811 dbSNP
rs1276403116 2813 dbSNP
rs952960708 2822 dbSNP
rs529417361 2829 dbSNP
rs909520552 2841 dbSNP
rs962398017 2845 dbSNP
rs772859819 2854 dbSNP
rs926543428 2858 dbSNP
rs939125588 2859 dbSNP
rs1371156287 2860 dbSNP
rs1297649681 2861 dbSNP
rs1430549848 2862 dbSNP
rs1372580501 2866 dbSNP
rs1172013712 2867 dbSNP
rs1249954506 2868 dbSNP
rs992407026 2870 dbSNP
rs1201532507 2875 dbSNP
rs1190405723 2879 dbSNP
rs913777847 2883 dbSNP
rs993528188 2885 dbSNP
rs945437354 2887 dbSNP
rs948419644 2888 dbSNP
rs1043848018 2892 dbSNP
rs1253438319 2894 dbSNP
rs1208314465 2897 dbSNP
rs903825030 2899 dbSNP
rs1375247770 2900 dbSNP
rs1042760315 2904 dbSNP
rs1460955066 2905 dbSNP
rs943393533 2906 dbSNP
rs1039223150 2907 dbSNP
rs552402790 2911 dbSNP
rs1297084831 2913 dbSNP
rs902111782 2914 dbSNP
rs1315049984 2917 dbSNP
rs185897318 2930 dbSNP
rs997757890 2931 dbSNP
rs1410440886 2935 dbSNP
rs1026895936 2936 dbSNP
rs371569910 2937 dbSNP
rs1310629276 2939 dbSNP
rs890319900 2941 dbSNP
rs1363667385 2946 dbSNP
rs1160553936 2952 dbSNP
rs1472608379 2958 dbSNP
rs1413559345 2961 dbSNP
rs1004355970 2963 dbSNP
rs1038992579 2970 dbSNP
rs1256501066 2980 dbSNP
rs528789353 2994 dbSNP
rs1279890634 3002 dbSNP
rs1016695825 3009 dbSNP
rs996862703 3017 dbSNP
rs962346402 3025 dbSNP
rs1185582674 3027 dbSNP
rs1228953930 3033 dbSNP
rs1331206802 3039 dbSNP
rs1291483947 3040 dbSNP
rs550869778 3053 dbSNP
rs562806541 3054 dbSNP
rs749112497 3056 dbSNP
rs1232824457 3061 dbSNP
rs1341284212 3063 dbSNP
rs1336411989 3070 dbSNP
rs1380816805 3072 dbSNP
rs1384734836 3075 dbSNP
rs1033560531 3079 dbSNP
rs1321748078 3083 dbSNP
rs1226660498 3085 dbSNP
rs1416388880 3095 dbSNP
rs865843182 3097 dbSNP
rs1004752091 3098 dbSNP
rs1368618564 3100 dbSNP
rs137952466 3104 dbSNP
rs565331354 3107 dbSNP
rs1426468099 3113 dbSNP
rs118074285 3114 dbSNP
rs1209170678 3115 dbSNP
rs945244123 3117 dbSNP
rs1466197990 3123 dbSNP
rs1255597561 3124 dbSNP
rs1271261242 3127 dbSNP
rs1213082554 3129 dbSNP
rs979902700 3132 dbSNP
rs1194808224 3135 dbSNP
rs190308096 3142 dbSNP
rs925374342 3145 dbSNP
rs1427245252 3147 dbSNP
rs943339784 3148 dbSNP
rs143368283 3151 dbSNP
rs1392900804 3159 dbSNP
rs6053188 3160 dbSNP
rs1404204245 3162 dbSNP
rs182595893 3163 dbSNP
rs1390854763 3173 dbSNP
rs901890866 3174 dbSNP
rs1460127368 3176 dbSNP
rs753314674 3183 dbSNP
rs1435982737 3189 dbSNP
rs925660317 3192 dbSNP
rs538162241 3195 dbSNP
rs1250986127 3196 dbSNP
rs1198111482 3201 dbSNP
rs1048004294 3204 dbSNP
rs1452198826 3205 dbSNP
rs1374431511 3214 dbSNP
rs1400265568 3217 dbSNP
rs886577393 3217 dbSNP
rs1006406286 3229 dbSNP
rs911710542 3233 dbSNP
rs1275689959 3236 dbSNP
rs765758805 3240 dbSNP
rs1359671428 3242 dbSNP
rs1230995896 3273 dbSNP
rs1369284774 3274 dbSNP
rs1303254540 3276 dbSNP
rs1017054209 3300 dbSNP
rs1333377002 3302 dbSNP
rs1324955721 3305 dbSNP
rs556520475 3306 dbSNP
rs1001985526 3321 dbSNP
rs1369498014 3322 dbSNP
rs1431356392 3337 dbSNP
rs1313893195 3339 dbSNP
rs73588505 3350 dbSNP
rs960391132 3353 dbSNP
rs753151631 3359 dbSNP
rs1347403150 3362 dbSNP
rs932598815 3365 dbSNP
rs372776920 3387 dbSNP
rs1248452588 3393 dbSNP
rs1485061581 3396 dbSNP
rs150538331 3403 dbSNP
rs1048432101 3404 dbSNP
rs1268612475 3406 dbSNP
rs1346054287 3409 dbSNP
rs372483093 3410 dbSNP
rs888476621 3431 dbSNP
rs1455993383 3440 dbSNP
rs1220246182 3442 dbSNP
rs1347742193 3446 dbSNP
rs578019512 3451 dbSNP
rs538919267 3452 dbSNP
rs1349369022 3455 dbSNP
rs966907710 3461 dbSNP
rs1411246688 3467 dbSNP
rs1373277016 3476 dbSNP
rs1333257992 3480 dbSNP
rs554811536 3486 dbSNP
rs1427106032 3490 dbSNP
rs1343076813 3491 dbSNP
rs1156747533 3493 dbSNP
rs1014395428 3512 dbSNP
rs139496708 3518 dbSNP
rs1184490697 3519 dbSNP
rs377233101 3521 dbSNP
rs1373057429 3522 dbSNP
rs1237180987 3526 dbSNP
rs374812206 3537 dbSNP
rs4815770 3544 dbSNP
rs149724972 3545 dbSNP
rs867203061 3561 dbSNP
rs1282717271 3563 dbSNP
rs1228338482 3564 dbSNP
rs1330481978 3565 dbSNP
rs1288391784 3574 dbSNP
rs1229769962 3584 dbSNP
rs186870509 3586 dbSNP
rs1301322726 3588 dbSNP
rs1376499977 3622 dbSNP
rs1370431099 3624 dbSNP
rs964762740 3626 dbSNP
rs747194536 3630 dbSNP
rs988565041 3631 dbSNP
rs923260877 3632 dbSNP
rs933348376 3634 dbSNP
rs911643087 3638 dbSNP
rs944499046 3641 dbSNP
rs974574950 3647 dbSNP
rs1161448400 3658 dbSNP
rs1474275942 3661 dbSNP
rs1413264995 3663 dbSNP
rs1048421180 3664 dbSNP
rs1182697526 3667 dbSNP
rs1473949004 3677 dbSNP
rs921810476 3684 dbSNP
rs930536475 3687 dbSNP
rs190916180 3688 dbSNP
rs942157966 3693 dbSNP
rs182741081 3696 dbSNP
rs906067501 3707 dbSNP
rs1319409177 3711 dbSNP
rs562729304 3713 dbSNP
rs533488059 3718 dbSNP
rs1434169944 3720 dbSNP
rs144562972 3720 dbSNP
rs6038088 3721 dbSNP
rs906081045 3727 dbSNP
rs1418178976 3731 dbSNP
rs1165192929 3734 dbSNP
rs188957351 3742 dbSNP
rs1013255930 3745 dbSNP
rs1021257512 3749 dbSNP
rs966645778 3751 dbSNP
rs1407260477 3754 dbSNP
rs1417716893 3765 dbSNP
rs1000384724 3768 dbSNP
rs1033708658 3769 dbSNP
rs1250373830 3769 dbSNP
rs1192340996 3771 dbSNP
rs1488469103 3784 dbSNP
rs563701717 3790 dbSNP
rs549078154 3791 dbSNP
rs1264318146 3793 dbSNP
rs1001230305 3802 dbSNP
rs1323133123 3815 dbSNP
rs1272062996 3818 dbSNP
rs1325063335 3819 dbSNP
rs567221922 3820 dbSNP
rs964542339 3821 dbSNP
rs974768902 3822 dbSNP
rs1366866324 3824 dbSNP
rs923375145 3835 dbSNP
rs781440534 3848 dbSNP
rs954832143 3851 dbSNP
rs1168203125 3861 dbSNP
rs965791827 3872 dbSNP
rs983477698 3878 dbSNP
rs1392442600 3883 dbSNP
rs139019564 3884 dbSNP
rs1433110597 3886 dbSNP
rs907899005 3892 dbSNP
rs1371419963 3895 dbSNP
rs942292367 3896 dbSNP
rs1249117495 3897 dbSNP
rs1037989952 3902 dbSNP
rs531414709 3906 dbSNP
rs1342491053 3908 dbSNP
rs1337484736 3911 dbSNP
rs984698633 3917 dbSNP
rs1273040353 3918 dbSNP
rs1230875456 3919 dbSNP
rs139296325 3920 dbSNP
rs1301909864 3927 dbSNP
rs1054844040 3937 dbSNP
rs1205956598 3940 dbSNP
rs939999496 3947 dbSNP
rs1037448315 3964 dbSNP
rs1401134362 3975 dbSNP
rs917283314 3976 dbSNP
rs950134928 3977 dbSNP
rs1465868692 3983 dbSNP
rs1044483174 3987 dbSNP
rs896245437 3992 dbSNP
rs571456780 4006 dbSNP
rs906027036 4010 dbSNP
rs1230728056 4018 dbSNP
rs538980422 4023 dbSNP
rs1409105868 4027 dbSNP
rs1180873044 4028 dbSNP
rs577313402 4041 dbSNP
rs1000332175 4044 dbSNP
rs745932423 4045 dbSNP
rs1198454122 4047 dbSNP
rs193242913 4048 dbSNP
rs1013787667 4054 dbSNP
rs769833994 4061 dbSNP
rs902201295 4066 dbSNP
rs1009869578 4072 dbSNP
rs566865845 4072 dbSNP
rs1287804070 4075 dbSNP
rs1182154936 4076 dbSNP
rs1019016508 4079 dbSNP
rs1419578415 4095 dbSNP
rs6116685 4102 dbSNP
rs1403386617 4103 dbSNP
rs995906714 4108 dbSNP
rs964489897 4115 dbSNP
rs1163980128 4121 dbSNP
rs555850005 4122 dbSNP
rs1030337286 4123 dbSNP
rs954808743 4135 dbSNP
rs951837420 4143 dbSNP
rs1256568289 4144 dbSNP
rs1202035262 4149 dbSNP
rs985034889 4150 dbSNP
rs1267445281 4151 dbSNP
rs983978128 4156 dbSNP
rs962262620 4157 dbSNP
rs574086525 4159 dbSNP
rs184760821 4168 dbSNP
rs73893915 4176 dbSNP
rs1313637676 4177 dbSNP
rs1315262442 4187 dbSNP
rs577772214 4194 dbSNP
rs187528369 4196 dbSNP
rs973630632 4200 dbSNP
rs1365027378 4208 dbSNP
rs1321809763 4211 dbSNP
rs560589167 4214 dbSNP
rs927534065 4224 dbSNP
rs1457271444 4229 dbSNP
rs937459990 4230 dbSNP
rs1293093679 4231 dbSNP
rs992989338 4235 dbSNP
rs917445841 4251 dbSNP
rs1368742448 4270 dbSNP
rs1185141750 4275 dbSNP
rs771848459 4282 dbSNP
rs1216889880 4294 dbSNP
rs114672710 4297 dbSNP
rs772911538 4305 dbSNP
rs902148377 4312 dbSNP
rs1040670990 4313 dbSNP
rs936358730 4321 dbSNP
rs1357298746 4322 dbSNP
rs542288286 4327 dbSNP
rs1259123535 4336 dbSNP
rs1341934424 4341 dbSNP
rs1298924393 4342 dbSNP
rs560922540 4347 dbSNP
rs900433213 4357 dbSNP
rs732817 4358 dbSNP
rs758981684 4359 dbSNP
rs1165120617 4376 dbSNP
rs1476342128 4377 dbSNP
rs1389298526 4381 dbSNP
rs764668206 4392 dbSNP
rs78660111 4403 dbSNP
rs79181201 4404 dbSNP
rs753199406 4418 dbSNP
rs1418711764 4421 dbSNP
rs146502839 4423 dbSNP
rs571469379 4424 dbSNP
rs1015168776 4426 dbSNP
rs1203306061 4429 dbSNP
rs532302464 4433 dbSNP
rs114650868 4436 dbSNP
rs1343419356 4438 dbSNP
rs1274783187 4439 dbSNP
rs1413209865 4442 dbSNP
rs1312640440 4444 dbSNP
rs1231841453 4448 dbSNP
rs1327457669 4460 dbSNP
rs764705594 4461 dbSNP
rs1304484618 4464 dbSNP
rs1433332433 4468 dbSNP
rs1407585350 4474 dbSNP
rs1369638766 4475 dbSNP
rs1308401010 4478 dbSNP
rs192047611 4494 dbSNP
rs1034385601 4495 dbSNP
rs1268877189 4505 dbSNP
rs1411459495 4506 dbSNP
rs1422890816 4510 dbSNP
rs1339336085 4519 dbSNP
rs958943347 4520 dbSNP
rs1234337444 4521 dbSNP
rs993103866 4526 dbSNP
rs1180154825 4527 dbSNP
rs1472384133 4529 dbSNP
rs1401645822 4534 dbSNP
rs1345269986 4540 dbSNP
rs917411934 4552 dbSNP
rs1441081014 4567 dbSNP
rs936073630 4569 dbSNP
rs946220123 4570 dbSNP
rs1326335197 4573 dbSNP
rs79341417 4577 dbSNP
rs555521214 4595 dbSNP
rs913371701 4599 dbSNP
rs184235050 4603 dbSNP
rs189795796 4613 dbSNP
rs1357233707 4621 dbSNP
rs902100630 4628 dbSNP
rs140522342 4630 dbSNP
rs1050083288 4631 dbSNP
rs887490785 4632 dbSNP
rs544540395 4635 dbSNP
rs1397018995 4641 dbSNP
rs900215824 4645 dbSNP
rs1006365894 4649 dbSNP
rs1433089364 4659 dbSNP
rs6085026 4664 dbSNP
rs1237229422 4669 dbSNP
rs1188759434 4670 dbSNP
rs180993113 4675 dbSNP
rs1385963728 4676 dbSNP
rs1402754029 4679 dbSNP
rs545169231 4680 dbSNP
rs1284463459 4683 dbSNP
rs1225093821 4699 dbSNP
rs1326330829 4703 dbSNP
rs1283377368 4705 dbSNP
rs1453177772 4706 dbSNP
rs897624065 4712 dbSNP
rs1318494861 4721 dbSNP
rs890273399 4736 dbSNP
rs142763591 4740 dbSNP
rs1024809157 4741 dbSNP
rs969284860 4747 dbSNP
rs1403806510 4770 dbSNP
rs980686929 4771 dbSNP
rs1034307952 4781 dbSNP
rs1014977070 4788 dbSNP
rs184471908 4795 dbSNP
rs1232931333 4801 dbSNP
rs1188513988 4803 dbSNP
rs1465787010 4806 dbSNP
rs543295590 4811 dbSNP
rs990624969 4813 dbSNP
rs1288719537 4817 dbSNP
rs1279708089 4818 dbSNP
rs560767797 4819 dbSNP
rs1361356385 4830 dbSNP
rs994961845 4832 dbSNP
rs1034333395 4849 dbSNP
rs1290691770 4850 dbSNP
rs1362654816 4850 dbSNP
rs1352423690 4861 dbSNP
rs768356868 4873 dbSNP
rs1203116271 4880 dbSNP
rs151069492 4882 dbSNP
rs913336267 4884 dbSNP
rs1388685724 4885 dbSNP
rs1283341451 4886 dbSNP
rs1468840981 4890 dbSNP
rs958724923 4894 dbSNP
rs1450635193 4898 dbSNP
rs1215558345 4904 dbSNP
rs967913179 4910 dbSNP
rs115832519 4911 dbSNP
rs1487236935 4914 dbSNP
rs1024996812 4922 dbSNP
rs111535554 4925 dbSNP
rs967531686 4941 dbSNP
rs1222740641 4943 dbSNP
rs1490749430 4949 dbSNP
rs978000296 4951 dbSNP
rs543552116 4961 dbSNP
rs1307943231 4973 dbSNP
rs1297637645 4991 dbSNP
rs1217512391 4992 dbSNP
rs926175161 4993 dbSNP
rs529933556 4996 dbSNP
rs1303892208 5000 dbSNP
rs1406963269 5004 dbSNP
rs756158691 5010 dbSNP
rs141007361 5011 dbSNP
rs1050689604 5023 dbSNP
rs931669745 5030 dbSNP
rs1356719730 5033 dbSNP
rs1433164119 5040 dbSNP
rs1423817139 5041 dbSNP
rs1051650970 5045 dbSNP
rs941719347 5046 dbSNP
rs911806827 5047 dbSNP
rs1249177900 5049 dbSNP
rs547302260 5049 dbSNP
rs559491828 5050 dbSNP
rs1252956534 5056 dbSNP
rs1328433334 5057 dbSNP
rs1392930782 5064 dbSNP
rs1207913285 5075 dbSNP
rs138570405 5078 dbSNP
rs1036602517 5079 dbSNP
rs1348797047 5083 dbSNP
rs529993107 5084 dbSNP
rs897574830 5092 dbSNP
rs548420560 5094 dbSNP
rs899022639 5095 dbSNP
rs1375953499 5096 dbSNP
rs1337130817 5099 dbSNP
rs559892717 5109 dbSNP
rs1465973220 5111 dbSNP
rs150215830 5115 dbSNP
rs1278723017 5116 dbSNP
rs1055902637 5122 dbSNP
rs894457115 5133 dbSNP
rs1014673431 5134 dbSNP
rs537814491 5135 dbSNP
rs1409257460 5152 dbSNP
rs1024525415 5153 dbSNP
rs968025752 5158 dbSNP
rs1468004103 5160 dbSNP
rs1179971836 5163 dbSNP
rs1002056440 5166 dbSNP
rs147940319 5172 dbSNP
rs1033121007 5179 dbSNP
rs1011582079 5180 dbSNP
rs1267640233 5181 dbSNP
rs771872780 5182 dbSNP
rs1311009437 5193 dbSNP
rs1395818273 5199 dbSNP
rs1384090234 5202 dbSNP
rs1339300598 5224 dbSNP
rs1020755290 5231 dbSNP
rs957561060 5233 dbSNP
rs1198911980 5235 dbSNP
rs976206844 5236 dbSNP
rs989160211 5237 dbSNP
rs1411510809 5243 dbSNP
rs113318278 5248 dbSNP
rs539108179 5252 dbSNP
rs556338020 5258 dbSNP
rs909483985 5259 dbSNP
rs190555979 5270 dbSNP
rs941652014 5271 dbSNP
rs777736004 5275 dbSNP
rs1247484533 5280 dbSNP
rs1205852472 5286 dbSNP
rs953017284 5289 dbSNP
rs1263904483 5290 dbSNP
rs1036036932 5292 dbSNP
rs987536616 5299 dbSNP
rs911602715 5308 dbSNP
rs1317674055 5312 dbSNP
rs572595948 5313 dbSNP
rs532451122 5321 dbSNP
rs1389183463 5323 dbSNP
rs918951460 5327 dbSNP
rs62200450 5330 dbSNP
rs770776835 5334 dbSNP
rs1046152298 5340 dbSNP
rs200274819 5345 dbSNP
rs1423710066 5346 dbSNP
rs930480803 5349 dbSNP
rs111861880 5355 dbSNP
rs1002004167 5357 dbSNP
rs1447566951 5367 dbSNP
rs576119753 5376 dbSNP
rs1372443401 5386 dbSNP
rs1055848356 5389 dbSNP
rs1448844417 5396 dbSNP
rs34130515 5398 dbSNP
rs1265468389 5403 dbSNP
rs894570241 5421 dbSNP
rs1014374678 5425 dbSNP
rs1194161601 5431 dbSNP
rs1294401604 5432 dbSNP
rs1226726457 5435 dbSNP
rs543412098 5441 dbSNP
rs1046140990 5445 dbSNP
rs1486137946 5448 dbSNP
rs903205995 5459 dbSNP
rs1227469903 5471 dbSNP
rs1190476051 5475 dbSNP
rs1327706211 5477 dbSNP
rs1298610670 5479 dbSNP
rs1009936595 5482 dbSNP
rs1423729362 5483 dbSNP
rs1365869456 5484 dbSNP
rs1020283032 5487 dbSNP
rs1427581003 5490 dbSNP
rs999499067 5500 dbSNP
rs1375299314 5501 dbSNP
rs1033235568 5508 dbSNP
rs967395569 5509 dbSNP
rs1459982042 5516 dbSNP
rs997588969 5517 dbSNP
rs1271341153 5519 dbSNP
rs147114585 5524 dbSNP
rs1437647959 5532 dbSNP
rs1274264900 5538 dbSNP
rs1198054029 5546 dbSNP
rs1253727393 5552 dbSNP
rs1375647164 5554 dbSNP
rs181883591 5560 dbSNP
rs186138421 5561 dbSNP
rs1028485220 5563 dbSNP
rs1354660750 5569 dbSNP
rs1382579090 5572 dbSNP
rs1407712283 5573 dbSNP
rs1334922164 5574 dbSNP
rs772762438 5575 dbSNP
rs953247805 5580 dbSNP
rs1016892858 5591 dbSNP
rs987263278 5594 dbSNP
rs776210580 5595 dbSNP
rs961751993 5596 dbSNP
rs559289223 5597 dbSNP
rs8184346 5599 dbSNP
rs949081885 5611 dbSNP
rs1274061329 5612 dbSNP
rs1348842336 5613 dbSNP
rs1180322997 5618 dbSNP
rs1469862822 5625 dbSNP
rs1233813303 5628 dbSNP
rs1213362865 5641 dbSNP
rs1184494246 5649 dbSNP
rs1278626047 5650 dbSNP
rs920513374 5662 dbSNP
rs369214363 5665 dbSNP
rs1202438130 5668 dbSNP
rs1187494333 5672 dbSNP
rs937813056 5681 dbSNP
rs1053620518 5684 dbSNP
rs1221682734 5685 dbSNP
rs1427303384 5698 dbSNP
rs1349593505 5704 dbSNP
rs138514359 5714 dbSNP
rs1187860046 5716 dbSNP
rs1187367736 5717 dbSNP
rs991313278 5724 dbSNP
rs576116591 5726 dbSNP
rs893671930 5728 dbSNP
rs1338563363 5731 dbSNP
rs945297823 5732 dbSNP
rs1453404466 5733 dbSNP
rs190550970 5734 dbSNP
rs769308898 5735 dbSNP
rs143434074 5743 dbSNP
rs997536824 5745 dbSNP
rs12624765 5747 dbSNP
rs889211543 5748 dbSNP
rs1184724734 5752 dbSNP
rs1008090625 5753 dbSNP
rs762577010 5755 dbSNP
rs1213109463 5757 dbSNP
rs1446008721 5762 dbSNP
rs1284529799 5764 dbSNP
rs950157466 5767 dbSNP
rs538074389 5768 dbSNP
rs764500249 5769 dbSNP
rs963901779 5781 dbSNP
rs1045841892 5785 dbSNP
rs752182087 5786 dbSNP
rs6107592 5788 dbSNP
rs1384976914 5791 dbSNP
rs538802747 5806 dbSNP
rs970342614 5808 dbSNP
rs1430110841 5813 dbSNP
rs1381627351 5815 dbSNP
rs1296947871 5819 dbSNP
rs547821758 5825 dbSNP
rs981752187 5827 dbSNP
rs1236591314 5835 dbSNP
rs1301464252 5837 dbSNP
rs1311860408 5838 dbSNP
rs1216918690 5850 dbSNP
rs1184194313 5852 dbSNP
rs1054603803 5865 dbSNP
rs893383519 5866 dbSNP
rs1242290740 5872 dbSNP
rs1485172936 5877 dbSNP
rs1489744634 5878 dbSNP
rs1208726383 5881 dbSNP
rs1290756283 5888 dbSNP
rs1222969383 5891 dbSNP
rs181476298 5894 dbSNP
rs989661111 5900 dbSNP
rs1293387169 5904 dbSNP
rs1214009887 5907 dbSNP
rs774754699 5911 dbSNP
rs997096017 5916 dbSNP
rs915067127 5922 dbSNP
rs768004398 5934 dbSNP
rs750622109 5942 dbSNP
rs1191226559 5943 dbSNP
rs1304074054 5954 dbSNP
rs143012076 5957 dbSNP
rs1009034537 5958 dbSNP
rs1170392597 5968 dbSNP
rs73588512 5971 dbSNP
rs1051757536 5979 dbSNP
rs1187833524 5984 dbSNP
rs576836492 5990 dbSNP
rs889159250 5992 dbSNP
rs961976503 5999 dbSNP
rs1016787794 6001 dbSNP
rs1249449565 6007 dbSNP
rs899300775 6016 dbSNP
rs537723732 6017 dbSNP
rs1160988769 6018 dbSNP
rs558624379 6020 dbSNP
rs114347250 6021 dbSNP
rs1407098611 6025 dbSNP
rs1027357969 6026 dbSNP
rs1298004938 6028 dbSNP
rs970947941 6033 dbSNP
rs148187692 6037 dbSNP
rs991426255 6047 dbSNP
rs1467801315 6048 dbSNP
rs1428104080 6049 dbSNP
rs370686814 6053 dbSNP
rs959329549 6057 dbSNP
rs759898075 6058 dbSNP
rs186478894 6063 dbSNP
rs981907395 6068 dbSNP
rs191407200 6069 dbSNP
rs753840374 6075 dbSNP
rs755141635 6089 dbSNP
rs1054386327 6090 dbSNP
rs1225549276 6092 dbSNP
rs893164450 6094 dbSNP
rs932892584 6104 dbSNP
rs1306723459 6111 dbSNP
rs767825093 6112 dbSNP
rs868140845 6113 dbSNP
rs777682592 6117 dbSNP
rs1335343250 6118 dbSNP
rs977928794 6121 dbSNP
rs1049980007 6130 dbSNP
rs563129592 6135 dbSNP
rs76937866 6136 dbSNP
rs770666207 6144 dbSNP
rs1361717131 6145 dbSNP
rs1158023717 6147 dbSNP
rs1419489416 6153 dbSNP
rs545688452 6158 dbSNP
rs1049696965 6160 dbSNP
rs1228183001 6168 dbSNP
rs1181659956 6176 dbSNP
rs1008399037 6181 dbSNP
rs1243820744 6188 dbSNP
rs1470242127 6190 dbSNP
rs1484983890 6191 dbSNP
rs1211239884 6198 dbSNP
rs1040493424 6199 dbSNP
rs1260392273 6200 dbSNP
rs897564751 6201 dbSNP
rs182723727 6203 dbSNP
rs1319081513 6210 dbSNP
rs1027304327 6213 dbSNP
rs951718916 6216 dbSNP
rs910539715 6217 dbSNP
rs1384253183 6219 dbSNP
rs1336747366 6220 dbSNP
rs943375104 6221 dbSNP
rs1012809407 6228 dbSNP
rs1382277183 6230 dbSNP
rs532494184 6230 dbSNP
rs547587169 6231 dbSNP
rs187908021 6233 dbSNP
rs566137669 6235 dbSNP
rs374430411 6244 dbSNP
rs1231122751 6246 dbSNP
rs1472108606 6252 dbSNP
rs1362189912 6293 dbSNP
rs1161514473 6294 dbSNP
rs1165420116 6303 dbSNP
rs1443917822 6304 dbSNP
rs1189631585 6312 dbSNP
rs993633036 6313 dbSNP
rs1261187720 6324 dbSNP
rs1205910507 6326 dbSNP
rs1047884997 6343 dbSNP
rs745717131 6344 dbSNP
rs1290023474 6346 dbSNP
rs1222229451 6361 dbSNP
rs924480694 6362 dbSNP
rs956107991 6371 dbSNP
rs116811504 6373 dbSNP
rs914546466 6374 dbSNP
rs932673364 6389 dbSNP
rs959046307