miRTarBase - #MIRT169058 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol IRF4   
Synonyms LSIRF, MUM1, NF-EM5, SHEP8
Description interferon regulatory factor 4
Transcript NM_002460   
Expression
Putative miRNA Targets on IRF4
3'UTR of IRF4
(miRNA target sites are highlighted)
>IRF4|NM_002460|3'UTR
   1 AAAATGTCAAGATGAGTGGTTTTCTTTTTCCTTTTTTTTTTTTTTTTTTTGATACGGGGATACGGGGTCTTGCTCTGTCT
  81 CCCAGGCTGGAGTGCAGTGACACAATCTCAGCTCACTGTGACCTCCGCCTCCTGGGTTCAAGAGACTCTCCTGCCTCAGC
 161 CTCCCTGGTAGCTGGGATTACAGGTGTGAGCCACTGCACCCACCCAAGACAAGTGATTTTCATTGTAAATATTTGACTTT
 241 AGTGAAAGCGTCCAATTGACTGCCCTCTTACTGTTTTGAGGAATTCAGAAGTGGAGATTTCAGTTCAGCGGTTGAGGAGA
 321 ATTGCGGCGAGACAAGCATGGAAAATCAGTGACATCTGATTGGCAGATGAGCTTATTTCAAAAGGAAGGGTGGCTTTGCA
 401 TTTCTTGTGTTCTGTAGACTGCCATCATTGATGATCACTGTGAAAATTGACCAAGTGATGTGTTTACATTTACTGAAATG
 481 CGCTCTTTAATTTGTTGTAGATTAGGTCTTGCTGGAAGACAGAGAAAACTTGCCTTTCAGTATTGACACTGACTAGAGTG
 561 ATGACTGCTTGTAGGTATGTCTGTGCCATTTCTCAGGGAAGTAAGATGTAAATTGAAGAAGCCTCACACGTAAAAGAAAT
 641 GTATTAATGTATGTAGGAGCTGCAGTTCTTGTGGAAGACACTTGCTGAGTGAAGGAAATGAATCTTTGACTGAAGCCGTG
 721 CCTGTAGCCTTGGGGAGGCCCATCCCCCACCTGCCAGCGGTTTCCTGGTGTGGGTCCCTCTGCCCCGCCCTCCTTCCCAT
 801 TGGCTTTCTCTCCTTGGCCTTTCCTGGAAGCCAGTTAGTAAACTTCCTATTTTCTTGAGTCAAAAAACATGAGCGCTACT
 881 CTTGGATGGGACATTTTTGTCTGTCCTACAATCTAGTAATGTCTAAGTAATGGTTAAGTTTTCTTGTTTCTGCATCTTTT
 961 TGACCCTCATTCTTTAGAGATGCTAAAATTCTTCGCATAAAGAAGAAGAAATTAAGGAACATAAATCTTAATACTTGAAC
1041 TGTTGCCCTTCTGTCCAAGTACTTAACTATCTGTTCCCTTCCTCTGTGCCACGCTCCTCTGTTTGTTTGGCTGTCCAGCG
1121 ATCAGCCATGGCGACACTAAAGGAGGAGGAGCCGGGGACTCCCAGGCTGGAGAGCACTGCCAGGACCCACCACTGGAAGC
1201 AGGATGGAGCTGACTACGGAACTGCACACTCAGTGGGCTGTTTCTGCTTATTTCATCTGTTCTATGCTTCCTCGTGCCAA
1281 TTATAGTTTGACAGGGCCTTAAAATTACTTGGCTTTTTCCAAATGCTTCTATTTATAGAATCCCAAAGACCTCCACTTGC
1361 TTAAGTATACCTATCACTTACATTTTTGTGGTTTTGAGAAAGTACAGCAGTAGACTGGGGCGTCACCTCCAGGCCGTTTC
1441 TCATACTACAGGATATTTACTATTACTCCCAGGATCAGCAGAAGATTGCGTAGCTCTCAAATGTGTGTTCCTGCTTTTCT
1521 AATGGATATTTTAAATTCATTCAACAAGCACCTAGTAAGTGCCTGCTGTATCCCTACATTACACAGTTCAGCCTTTATCA
1601 AGCTTAGTGAGCAGTGAGCACTGAAACATTATTTTTTAATGTTTAAAAAGTTTCTAATATTAAAGTCAGAATATTAATAC
1681 AATTAATATTAATATTAACTACAGAAAAGACAAACAGTAGAGAACAGCAAAAAAATAAAAAGGATCTCCTTTTTTCCCAG
1761 CCCAAATTCTCCTCTCTAAAAGTGTCCACAAGAAGGGGTGTTTATTCTTCCAACACATTTCACTTTTCTGTAAATATACA
1841 TAAACTTAAAAAGAAAACCTCATGGAGTCATCTTGCACACACTTTCATGCAGTGCTCTTTGTAGCTAACAGTGAAGATTT
1921 ACCTCGTTCTGCTCAGAGGCCTTGCTGTGGAGCTCCACTGCCATGTACCCAGTAGGGTTTGACATTTCATTAGCCATGCA
2001 ACATGGATATGTATTGGGCAGCAGACTGTGTTTCGTGAACTGCAGTGATGTATACATCTTATAGATGCAAAGTATTTTGG
2081 GGTATATTATCCTAAGGGAAGATAAAGATGATATTAAGAACTGCTGTTTCACGGGGCCCTTACCTGTGACCCTCTTTGCT
2161 GAAGAATATTTAACCCCACACAGCACTTCAAAGAAGCTGTCTTGGAAGTCTGTCTCAGGAGCACCCTGTCTTCTTAATTC
2241 TCCAAGCGGATGCTCCATTTCAATTGCTTTGTGACTTCTTCTTCTTTGTTTTTTTAAATATTATGCTGCTTTAACAGTGG
2321 AGCTGAATTTTCTGGAAAATGCTTCTTGGCTGGGGCCACTACCTCCTTTCCTATCTTTACATCTATGTGTATGTTGACTT
2401 TTTAAAATTCTGAGTGATCCAGGGTATGACCTAGGGAATGAACTAGCTATGAAATACTCAGGGTTAGGAATCCTAGCACT
2481 TGTCTCAGGACTCTGAAAAGGAACGGCTTCCTCATTCCTTGTCTTGATAAAGTGGAATTGGCAAACTAGAATTTAGTTTG
2561 TACTCAGTGGACAGTGCTGTTGAAGATTTGAGGACTTGTTAAAGAGCACTGGGTCATATGGAAAAAATGTATGTGTCTCC
2641 CAGGTGCATTTCTTGGTTTATGTCTTGTTCTTGAGATTTTGTATATTTAGGAAAACCTCAAGCAGTAATTAATATCTCCT
2721 GGAACACTATAGAGAACCAAGTGACCGACTCATTTACAACTGAAACCTAGGAAGCCCCTGAGTCCTGAGCGAAAACAGGA
2801 GAGTTAGTCGCCCTACAGAAAACCCAGCTAGACTATTGGGTATGAACTAAAAAGAGACTGTGCCATGGTGAGAAAAATGT
2881 AAAATCCTACAGTGAAATGAGCAGCCCTTACAGTATTGTTACCACCAAGGGCAGGTAGGTATTAGTGTTTGAAAAAGCTG
2961 GTCTTTGAGCGAGGGCATAAATACAGCTAGCCCCAGGGGTGGAACAACTCTGGGAGTCTTGGGTACTCGCACCTCTTGGC
3041 TTTGTTGATGCTCCGCCAGGAAGGCCACTTGTGTGTGCGTGTCAGTTACTTTTTTAGTAACAATTCAGATCCAGTGTAAA
3121 CTTCCGTTCATTGCTCTCCAGTCACATGCCCCCACTTCCCCACAGGTGAAAGTTTTTCTGAAAGTGTTGGGATTGGTTAA
3201 GGTCTTTATTTGTATTACGTATCTCCCCAAGTCCTCTGTGGCCAGCTGCATCTGTCTGAATGGTGCGTGAAGGCTCTCAG
3281 ACCTTACACACCATTTTGTAAGTTATGTTTTACATGCCCCGTTTTTGAGACTGATCTCGATGCAGGTGGATCTCCTTGAG
3361 ATCCTGATAGCCTGTTACAGGAATGAAGTAAAGGTCAGTTTTTTTTTGTATTGATTTTCACAGCTTTGAGGAACATGCAT
3441 AAGAAATGTAGCTGAAGTAGAGGGGACGTGAGAGAAGGGCCAGGCCGGCAGGCCAACCCTCCTCCAATGGAAATTCCCGT
3521 GTTGCTTCAAACTGAGACAGATGGGACTTAACAGGCAATGGGGTCCACTTCCCCCTCTTCAGCATCCCCCGTACCCCACT
3601 TTCTGCTGAAAGAACTGCCAGCAGGTAGGACCCCAGAGGCCCCCAAATGAAAGCTTGAATTTCCCCTACTGGCTCTGCGT
3681 TTTGCTGAGATCTGTAGGAAAGGATGCTTCACAAACTGAGGTAGATAATGCTATGCTGTCGTTGGTATACATCATGAATT
3761 TTTATGTAAATTGCTCTGCAAAGCAAATTGATATGTTTGATAAATTTATGTTTTTAGGTAAATAAAAACTTTTAAAAATT
3841 TGTTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||| :||||  ||||||| 
Target 5' ttTAAA-TATTA--TGCTGCTt 3'
2293 - 2311 159.00 -10.20
2
miRNA  3' gugUUUG--GUAAUAC---ACGACGAu 5'
             |:|:  :|||| |   |||||:| 
Target 5' taaAGATGATATTAAGAACTGCTGTTt 3'
2103 - 2129 137.00 -9.40
3
miRNA  3' guGUU--UGG-UAAUACAC-GACGAu 5'
            |||  ||| | || ||| ||||| 
Target 5' aaCAAGCACCTAGTAAGTGCCTGCTg 3'
1543 - 1568 134.00 -14.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30491628 19 COSMIC
COSN19670950 25 COSMIC
COSN30453191 30 COSMIC
COSN19747287 59 COSMIC
COSN20075598 64 COSMIC
COSN30451964 82 COSMIC
COSN30119638 128 COSMIC
COSN2161948 209 COSMIC
COSN8514326 307 COSMIC
COSN20091330 358 COSMIC
COSN31534135 425 COSMIC
COSN26595708 468 COSMIC
COSN28761691 482 COSMIC
COSN6320584 609 COSMIC
COSN28727984 649 COSMIC
COSN31517912 669 COSMIC
COSN32057428 787 COSMIC
COSN6320592 848 COSMIC
COSN9783023 980 COSMIC
COSN29211310 1185 COSMIC
COSN16112134 1228 COSMIC
COSN6320606 1365 COSMIC
COSN9783043 1416 COSMIC
COSN27822408 1652 COSMIC
COSN21224930 1692 COSMIC
COSN2161994 1721 COSMIC
COSN16700243 1883 COSMIC
COSN9783067 2005 COSMIC
COSN20102301 2234 COSMIC
COSN20687909 2304 COSMIC
COSN20370652 2355 COSMIC
COSN4927767 2427 COSMIC
COSN2162021 2917 COSMIC
COSN20347117 3036 COSMIC
COSN4927771 3130 COSMIC
COSN32056150 3287 COSMIC
COSN7882909 3401 COSMIC
COSN20102304 3408 COSMIC
COSN21990208 3482 COSMIC
COSN21807712 3511 COSMIC
COSN29925234 3558 COSMIC
COSN17182222 3585 COSMIC
COSN26265538 3599 COSMIC
COSN31959976 3654 COSMIC
COSN6320646 3734 COSMIC
rs1050976 482 GWAS
rs12211228 1236 GWAS
rs9391997 1522 GWAS
rs1050979 2820 GWAS
rs2316515 3251 GWAS
rs872071 3467 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771002555 6 dbSNP
rs774316362 7 dbSNP
rs1287784618 9 dbSNP
rs1035245196 10 dbSNP
rs371515441 12 dbSNP
rs1270267136 13 dbSNP
rs775475599 14 dbSNP
rs768455849 15 dbSNP
rs761407099 16 dbSNP
rs764758706 17 dbSNP
rs749865619 18 dbSNP
rs768122834 19 dbSNP
rs753619697 20 dbSNP
rs1381521944 21 dbSNP
rs372253512 24 dbSNP
rs765054639 25 dbSNP
rs80055768 25 dbSNP
rs778312933 26 dbSNP
rs757398829 27 dbSNP
rs752639312 30 dbSNP
rs758429920 30 dbSNP
rs1491546943 31 dbSNP
rs779235356 31 dbSNP
rs1257267027 32 dbSNP
rs1426339732 32 dbSNP
rs1447002276 32 dbSNP
rs1478191313 32 dbSNP
rs566047868 32 dbSNP
rs746192253 32 dbSNP
rs751835173 32 dbSNP
rs777939962 32 dbSNP
rs780451390 32 dbSNP
rs745933211 33 dbSNP
rs772199151 34 dbSNP
rs779912209 35 dbSNP
rs746955792 36 dbSNP
rs768404476 37 dbSNP
rs892240419 38 dbSNP
rs1358476778 39 dbSNP
rs776317163 40 dbSNP
rs1319364805 44 dbSNP
rs1229114103 45 dbSNP
rs1257729979 51 dbSNP
rs931741232 52 dbSNP
rs1200973466 53 dbSNP
rs1194962267 55 dbSNP
rs866384612 56 dbSNP
rs866955429 57 dbSNP
rs1131442 59 dbSNP
rs1394103348 60 dbSNP
rs1256781959 62 dbSNP
rs1404095825 63 dbSNP
rs1336337228 64 dbSNP
rs189617307 65 dbSNP
rs570237434 66 dbSNP
rs1402544493 69 dbSNP
rs1026714048 75 dbSNP
rs1166271601 76 dbSNP
rs952190478 84 dbSNP
rs984864281 85 dbSNP
rs1190006751 86 dbSNP
rs192507789 88 dbSNP
rs964499016 94 dbSNP
rs1242978408 96 dbSNP
rs1474886489 106 dbSNP
rs1458842513 114 dbSNP
rs899474334 118 dbSNP
rs1367175268 120 dbSNP
rs1215179511 121 dbSNP
rs549377281 127 dbSNP
rs569588406 128 dbSNP
rs1267150864 132 dbSNP
rs976002151 136 dbSNP
rs767217694 144 dbSNP
rs923190947 147 dbSNP
rs111502183 149 dbSNP
rs1004088365 161 dbSNP
rs1337807887 167 dbSNP
rs36051076 167 dbSNP
rs1297894481 177 dbSNP
rs1326884709 202 dbSNP
rs759982164 205 dbSNP
rs1409487996 207 dbSNP
rs1392002957 211 dbSNP
rs1412056884 214 dbSNP
rs988525513 221 dbSNP
rs555626339 222 dbSNP
rs914217126 224 dbSNP
rs947178839 227 dbSNP
rs993291296 228 dbSNP
rs1044086674 232 dbSNP
rs905377843 233 dbSNP
rs148645823 238 dbSNP
rs1324848454 242 dbSNP
rs1226970438 250 dbSNP
rs978779101 251 dbSNP
rs765780529 253 dbSNP
rs1057136869 255 dbSNP
rs1353069190 256 dbSNP
rs1278012110 273 dbSNP
rs896758538 274 dbSNP
rs4959248 285 dbSNP
rs759275021 287 dbSNP
rs185376510 310 dbSNP
rs375277275 311 dbSNP
rs1006310837 316 dbSNP
rs1421909028 317 dbSNP
rs543890133 320 dbSNP
rs1017665400 326 dbSNP
rs964560675 327 dbSNP
rs975939817 329 dbSNP
rs1030567354 330 dbSNP
rs1445988484 332 dbSNP
rs1263857437 333 dbSNP
rs557434683 339 dbSNP
rs1193443943 348 dbSNP
rs1374480590 352 dbSNP
rs1041153851 357 dbSNP
rs1223397470 361 dbSNP
rs55788549 372 dbSNP
rs190278564 378 dbSNP
rs1435896853 382 dbSNP
rs62389398 384 dbSNP
rs181522247 392 dbSNP
rs1048089348 395 dbSNP
rs914246513 408 dbSNP
rs1414661309 412 dbSNP
rs1050975 415 dbSNP
rs1319194181 416 dbSNP
rs1004117852 422 dbSNP
rs1479828379 428 dbSNP
rs1424185729 432 dbSNP
rs979834879 439 dbSNP
rs545215784 448 dbSNP
rs895626725 450 dbSNP
rs938415458 453 dbSNP
rs1014342189 458 dbSNP
rs1443172832 466 dbSNP
rs1265235919 480 dbSNP
rs1050976 482 dbSNP
rs1236405903 483 dbSNP
rs1322899988 484 dbSNP
rs896638448 495 dbSNP
rs929611439 499 dbSNP
rs979196101 501 dbSNP
rs1360559966 503 dbSNP
rs1032961581 506 dbSNP
rs1449217578 507 dbSNP
rs750163826 508 dbSNP
rs549837113 521 dbSNP
rs956303914 534 dbSNP
rs1334306968 542 dbSNP
rs1048404889 545 dbSNP
rs989000027 556 dbSNP
rs532869349 566 dbSNP
rs912064698 574 dbSNP
rs1418720104 575 dbSNP
rs1182196326 576 dbSNP
rs141513891 588 dbSNP
rs569591347 595 dbSNP
rs1252767524 602 dbSNP
rs764135698 614 dbSNP
rs1017601354 623 dbSNP
rs900619018 624 dbSNP
rs1206731425 627 dbSNP
rs1272960260 628 dbSNP
rs1385404768 630 dbSNP
rs528867450 630 dbSNP
rs1176063420 631 dbSNP
rs932400512 631 dbSNP
rs1030205908 632 dbSNP
rs186655777 633 dbSNP
rs1159243708 634 dbSNP
rs956028210 641 dbSNP
rs868503698 644 dbSNP
rs1353808973 648 dbSNP
rs7768807 649 dbSNP
rs534873545 650 dbSNP
rs1325564487 655 dbSNP
rs1036909891 660 dbSNP
rs895726959 664 dbSNP
rs751143131 672 dbSNP
rs968374476 680 dbSNP
rs979761196 695 dbSNP
rs1014545675 696 dbSNP
rs1442898756 701 dbSNP
rs1304739176 705 dbSNP
rs140017346 707 dbSNP
rs926948630 711 dbSNP
rs1289977487 714 dbSNP
rs761675106 714 dbSNP
rs1000208382 717 dbSNP
rs959815422 718 dbSNP
rs956001532 719 dbSNP
rs1371945724 724 dbSNP
rs1293676579 725 dbSNP
rs551605330 733 dbSNP
rs1469170756 739 dbSNP
rs375531161 740 dbSNP
rs1019189039 744 dbSNP
rs929429876 746 dbSNP
rs1047986591 748 dbSNP
rs1364548838 749 dbSNP
rs1161522502 758 dbSNP
rs571460911 759 dbSNP
rs537580541 760 dbSNP
rs942248947 769 dbSNP
rs1200252205 775 dbSNP
rs41301859 776 dbSNP
rs778234132 779 dbSNP
rs557669192 784 dbSNP
rs1486386016 787 dbSNP
rs6596980 788 dbSNP
rs953938761 791 dbSNP
rs536673629 799 dbSNP
rs1224824293 809 dbSNP
rs115931740 812 dbSNP
rs1302495804 814 dbSNP
rs1400587452 817 dbSNP
rs1386827584 825 dbSNP
rs891640297 836 dbSNP
rs1286966544 839 dbSNP
rs939632382 841 dbSNP
rs1344840937 843 dbSNP
rs1177197750 844 dbSNP
rs114301817 856 dbSNP
rs1395538998 858 dbSNP
rs1199293644 860 dbSNP
rs917179944 862 dbSNP
rs1203769941 868 dbSNP
rs1462786554 869 dbSNP
rs1296266145 870 dbSNP
rs1263406487 872 dbSNP
rs543066120 875 dbSNP
rs1391902654 877 dbSNP
rs1044634939 878 dbSNP
rs968635381 879 dbSNP
rs1001397458 880 dbSNP
rs1282131881 884 dbSNP
rs1219159826 887 dbSNP
rs188462828 891 dbSNP
rs563755296 893 dbSNP
rs959932186 894 dbSNP
rs150882331 900 dbSNP
rs1381474707 906 dbSNP
rs1197391614 911 dbSNP
rs1000240851 912 dbSNP
rs1054437109 916 dbSNP
rs1273392240 920 dbSNP
rs992597476 930 dbSNP
rs1224162818 934 dbSNP
rs1010232304 938 dbSNP
rs1018928500 943 dbSNP
rs966723235 965 dbSNP
rs918300627 968 dbSNP
rs374904638 972 dbSNP
rs543149951 978 dbSNP
rs1419249707 982 dbSNP
rs117762046 984 dbSNP
rs528945822 992 dbSNP
rs368959717 995 dbSNP
rs776118956 996 dbSNP
rs952206670 998 dbSNP
rs750519743 999 dbSNP
rs1459751499 1000 dbSNP
rs909674004 1009 dbSNP
rs961099724 1010 dbSNP
rs548971147 1018 dbSNP
rs1418791484 1033 dbSNP
rs942301094 1048 dbSNP
rs1226667159 1053 dbSNP
rs1383222549 1056 dbSNP
rs1316981931 1057 dbSNP
rs1167978787 1060 dbSNP
rs180974601 1070 dbSNP
rs1392067300 1074 dbSNP
rs1399197708 1077 dbSNP
rs1166639778 1082 dbSNP
rs1462358429 1085 dbSNP
rs61225369 1087 dbSNP
rs1299792685 1091 dbSNP
rs927128146 1093 dbSNP
rs933290495 1094 dbSNP
rs1165923335 1097 dbSNP
rs1373601435 1100 dbSNP
rs1442329030 1100 dbSNP
rs935872169 1110 dbSNP
rs1413576478 1120 dbSNP
rs528439057 1121 dbSNP
rs891900110 1129 dbSNP
rs553058165 1132 dbSNP
rs1042904646 1133 dbSNP
rs367942941 1142 dbSNP
rs7757384 1154 dbSNP
rs1001408776 1155 dbSNP
rs1307256851 1158 dbSNP
rs1228659948 1160 dbSNP
rs1034194801 1162 dbSNP
rs895494913 1173 dbSNP
rs1014310837 1178 dbSNP
rs1277339371 1188 dbSNP
rs1025298267 1203 dbSNP
rs1029211958 1205 dbSNP
rs1210184341 1214 dbSNP
rs1305265127 1215 dbSNP
rs114595725 1218 dbSNP
rs116527520 1219 dbSNP
rs1016445909 1223 dbSNP
rs185050968 1227 dbSNP
rs12211228 1236 dbSNP
rs961131382 1241 dbSNP
rs1180487770 1242 dbSNP
rs779877499 1244 dbSNP
rs536308936 1253 dbSNP
rs1271002795 1256 dbSNP
rs553335363 1265 dbSNP
rs572898114 1271 dbSNP
rs987905504 1274 dbSNP
rs754834841 1281 dbSNP
rs980168965 1291 dbSNP
rs778917257 1294 dbSNP
rs747555876 1298 dbSNP
rs191084757 1313 dbSNP
rs1403684067 1316 dbSNP
rs1349662322 1324 dbSNP
rs904371088 1327 dbSNP
rs937145451 1337 dbSNP
rs935901667 1338 dbSNP
rs1382331018 1344 dbSNP
rs989970234 1347 dbSNP
rs771767398 1356 dbSNP
rs1055653750 1361 dbSNP
rs1430853975 1365 dbSNP
rs184069935 1368 dbSNP
rs1383083813 1371 dbSNP
rs1014166585 1372 dbSNP
rs1242470079 1374 dbSNP
rs1300286980 1391 dbSNP
rs1448885605 1392 dbSNP
rs74389255 1397 dbSNP
rs1208404513 1400 dbSNP
rs1324341630 1409 dbSNP
rs1285351548 1415 dbSNP
rs1222212416 1417 dbSNP
rs1367536954 1417 dbSNP
rs1271071925 1419 dbSNP
rs1433368254 1421 dbSNP
rs886740389 1422 dbSNP
rs544813537 1423 dbSNP
rs1281741452 1428 dbSNP
rs1470032788 1429 dbSNP
rs1016665262 1431 dbSNP
rs1173705377 1433 dbSNP
rs1314004656 1436 dbSNP
rs777563874 1437 dbSNP
rs974931858 1444 dbSNP
rs1029150046 1449 dbSNP
rs901846400 1450 dbSNP
rs746699751 1451 dbSNP
rs771255143 1453 dbSNP
rs955163515 1454 dbSNP
rs987737036 1463 dbSNP
rs1486324111 1467 dbSNP
rs1461981721 1468 dbSNP
rs1804286 1469 dbSNP
rs913226297 1489 dbSNP
rs187034106 1490 dbSNP
rs1453632939 1491 dbSNP
rs1312084576 1495 dbSNP
rs1274352261 1498 dbSNP
rs888059834 1500 dbSNP
rs1006452051 1504 dbSNP
rs1337817611 1505 dbSNP
rs1297414486 1506 dbSNP
rs1174159388 1516 dbSNP
rs1427227955 1519 dbSNP
rs9391997 1522 dbSNP
rs1384556485 1532 dbSNP
rs1334035499 1539 dbSNP
rs763379706 1545 dbSNP
rs937407073 1553 dbSNP
rs1408206247 1555 dbSNP
rs542351930 1566 dbSNP
rs1163998998 1569 dbSNP
rs1436842570 1577 dbSNP
rs547679471 1579 dbSNP
rs15640 1592 dbSNP
rs1181781572 1606 dbSNP
rs768984596 1606 dbSNP
rs559339773 1613 dbSNP
rs867615954 1615 dbSNP
rs866508597 1616 dbSNP
rs1046944210 1649 dbSNP
rs1306327413 1655 dbSNP
rs1304767640 1658 dbSNP
rs1274295539 1660 dbSNP
rs1370402007 1661 dbSNP
rs979814480 1666 dbSNP
rs1312488356 1670 dbSNP
rs886788521 1671 dbSNP
rs1227428571 1678 dbSNP
rs1222097157 1680 dbSNP
rs1252101589 1681 dbSNP
rs1283656576 1682 dbSNP
rs78361121 1686 dbSNP
rs1038024617 1688 dbSNP
rs899613254 1700 dbSNP
rs1426342849 1702 dbSNP
rs990001464 1708 dbSNP
rs1271558887 1721 dbSNP
rs913066922 1728 dbSNP
rs1423524532 1729 dbSNP
rs1467841175 1732 dbSNP
rs996589551 1742 dbSNP
rs1029614468 1744 dbSNP
rs954861972 1748 dbSNP
rs147755767 1754 dbSNP
rs1468543292 1758 dbSNP
rs140709145 1759 dbSNP
rs1490935720 1761 dbSNP
rs932047321 1770 dbSNP
rs1408070614 1776 dbSNP
rs967367365 1779 dbSNP
rs867480247 1782 dbSNP
rs887756240 1785 dbSNP
rs1162321462 1794 dbSNP
rs942265268 1796 dbSNP
rs925941571 1799 dbSNP
rs1036583029 1809 dbSNP
rs1349744522 1812 dbSNP
rs898072788 1815 dbSNP
rs1393329269 1817 dbSNP
rs958822856 1819 dbSNP
rs1025544295 1822 dbSNP
rs906978199 1841 dbSNP
rs1001661137 1848 dbSNP
rs1440642918 1848 dbSNP
rs530792172 1855 dbSNP
rs1161324409 1856 dbSNP
rs563222890 1863 dbSNP
rs949888216 1874 dbSNP
rs1047440619 1878 dbSNP
rs908482827 1879 dbSNP
rs1011455743 1883 dbSNP
rs1020191662 1889 dbSNP
rs144644488 1898 dbSNP
rs1171260324 1910 dbSNP
rs1485968267 1922 dbSNP
rs1262147191 1924 dbSNP
rs750617202 1926 dbSNP
rs529126391 1927 dbSNP
rs1263294019 1932 dbSNP
rs923070028 1938 dbSNP
rs1214022768 1940 dbSNP
rs1401951561 1948 dbSNP
rs1343580817 1954 dbSNP
rs760841802 1958 dbSNP
rs1050832225 1962 dbSNP
rs1382598286 1967 dbSNP
rs890632279 1968 dbSNP
rs1362858081 1971 dbSNP
rs1290830032 1972 dbSNP
rs1435934734 1980 dbSNP
rs986175792 1985 dbSNP
rs909222669 1989 dbSNP
rs530261419 1994 dbSNP
rs1471206768 1997 dbSNP
rs1376468703 2002 dbSNP
rs1198539819 2004 dbSNP
rs1009041857 2009 dbSNP
rs1233439255 2011 dbSNP
rs942046348 2012 dbSNP
rs1036363123 2014 dbSNP
rs1020850335 2020 dbSNP
rs1185202709 2021 dbSNP
rs1243156241 2023 dbSNP
rs1205023703 2027 dbSNP
rs1342735857 2028 dbSNP
rs570574765 2035 dbSNP
rs145752540 2036 dbSNP
rs1309003295 2038 dbSNP
rs1293252291 2050 dbSNP
rs1433098616 2052 dbSNP
rs766623484 2053 dbSNP
rs1337430681 2061 dbSNP
rs753513417 2063 dbSNP
rs1400221948 2070 dbSNP
rs566563707 2083 dbSNP
rs1463006928 2090 dbSNP
rs1032979288 2094 dbSNP
rs958667069 2097 dbSNP
rs905334023 2104 dbSNP
rs1167113274 2109 dbSNP
rs1001291801 2114 dbSNP
rs1385512161 2115 dbSNP
rs1055436434 2126 dbSNP
rs991998457 2133 dbSNP
rs1254917102 2134 dbSNP
rs1393310645 2144 dbSNP
rs1408619637 2145 dbSNP
rs1328733246 2146 dbSNP
rs892879621 2147 dbSNP
rs917317167 2153 dbSNP
rs1272134404 2168 dbSNP
rs971870195 2182 dbSNP
rs982665661 2187 dbSNP
rs908368215 2190 dbSNP
rs1247310638 2193 dbSNP
rs148958555 2200 dbSNP
rs765074729 2202 dbSNP
rs1354981289 2209 dbSNP
rs920938492 2213 dbSNP
rs932305812 2221 dbSNP
rs1051304389 2226 dbSNP
rs558503377 2227 dbSNP
rs10530949 2229 dbSNP
rs35957122 2229 dbSNP
rs945105703 2244 dbSNP
rs1367323975 2248 dbSNP
rs1286236526 2249 dbSNP
rs569215355 2257 dbSNP
rs538106906 2264 dbSNP
rs972086690 2275 dbSNP
rs919220753 2278 dbSNP
rs949678370 2278 dbSNP
rs903323482 2281 dbSNP
rs1354521554 2282 dbSNP
rs1283603837 2284 dbSNP
rs1273584811 2289 dbSNP
rs1352815758 2307 dbSNP
rs926819784 2309 dbSNP
rs938215763 2312 dbSNP
rs1484008553 2315 dbSNP
rs752747602 2318 dbSNP
rs866890081 2321 dbSNP
rs757950661 2334 dbSNP
rs1366575236 2335 dbSNP
rs1208028198 2341 dbSNP
rs1454878987 2342 dbSNP
rs191954703 2342 dbSNP
rs894501753 2343 dbSNP
rs1041384321 2347 dbSNP
rs1480757221 2363 dbSNP
rs183330713 2364 dbSNP
rs1012943797 2374 dbSNP
rs1450042975 2390 dbSNP
rs1289457867 2397 dbSNP
rs997450577 2399 dbSNP
rs868480579 2402 dbSNP
rs1030701126 2409 dbSNP
rs1266384415 2418 dbSNP
rs542742007 2420 dbSNP
rs746548527 2425 dbSNP
rs1189162900 2427 dbSNP
rs1371023492 2429 dbSNP
rs1474606703 2430 dbSNP
rs889038418 2431 dbSNP
rs1346709495 2437 dbSNP
rs187292345 2449 dbSNP
rs143115691 2458 dbSNP
rs971541091 2460 dbSNP
rs545036929 2464 dbSNP
rs756902290 2467 dbSNP
rs1458550217 2469 dbSNP
rs564829331 2477 dbSNP
rs1157792431 2482 dbSNP
rs191745031 2489 dbSNP
rs1470192726 2492 dbSNP
rs1431393500 2495 dbSNP
rs544177406 2496 dbSNP
rs780909578 2497 dbSNP
rs1477561610 2504 dbSNP
rs1172394777 2505 dbSNP
rs749600670 2506 dbSNP
rs1246202879 2512 dbSNP
rs182474429 2521 dbSNP
rs186804354 2528 dbSNP
rs768325467 2533 dbSNP
rs547101332 2535 dbSNP
rs932541224 2536 dbSNP
rs78252705 2539 dbSNP
rs912205307 2543 dbSNP
rs1362589957 2548 dbSNP
rs945183849 2562 dbSNP
rs776690592 2573 dbSNP
rs1452756447 2577 dbSNP
rs903376068 2580 dbSNP
rs151195617 2593 dbSNP
rs1413899578 2595 dbSNP
rs1419944541 2596 dbSNP
rs938246778 2606 dbSNP
rs1054534447 2609 dbSNP
rs1388577450 2612 dbSNP
rs140374480 2621 dbSNP
rs1461801740 2624 dbSNP
rs1013578251 2632 dbSNP
rs1208628586 2634 dbSNP
rs552155218 2640 dbSNP
rs192168561 2641 dbSNP
rs1201706532 2642 dbSNP
rs185750178 2643 dbSNP
rs1259167291 2649 dbSNP
rs1231110324 2652 dbSNP
rs554949295 2653 dbSNP
rs773239690 2661 dbSNP
rs1804287 2663 dbSNP
rs1192835166 2677 dbSNP
rs1380700855 2685 dbSNP
rs1300628687 2690 dbSNP
rs1249026365 2697 dbSNP
rs1451788343 2700 dbSNP
rs866835536 2710 dbSNP
rs1172295945 2711 dbSNP
rs1309570968 2712 dbSNP
rs1355040860 2712 dbSNP
rs907157683 2713 dbSNP
rs1395056921 2717 dbSNP
rs1427558730 2718 dbSNP
rs1466582019 2724 dbSNP
rs1168193811 2728 dbSNP
rs568665788 2731 dbSNP
rs1415983442 2733 dbSNP
rs1015658229 2737 dbSNP
rs1382993571 2738 dbSNP
rs962554781 2739 dbSNP
rs760751851 2747 dbSNP
rs766533707 2748 dbSNP
rs1482258857 2752 dbSNP
rs534150703 2758 dbSNP
rs1274450934 2759 dbSNP
rs1222752531 2760 dbSNP
rs1028144707 2761 dbSNP
rs1016121311 2776 dbSNP
rs1373492275 2778 dbSNP
rs954019635 2780 dbSNP
rs145553686 2791 dbSNP
rs1331630623 2792 dbSNP
rs1349643659 2797 dbSNP
rs912239359 2810 dbSNP
rs1258432138 2811 dbSNP
rs1050979 2820 dbSNP
rs1162707436 2825 dbSNP
rs1412842111 2831 dbSNP
rs1184958357 2832 dbSNP
rs977831812 2837 dbSNP
rs1208955718 2838 dbSNP
rs925059631 2841 dbSNP
rs936411410 2843 dbSNP
rs1054586910 2854 dbSNP
rs1252867187 2855 dbSNP
rs1220427163 2857 dbSNP
rs1316983207 2858 dbSNP
rs768966449 2859 dbSNP
rs1269537511 2861 dbSNP
rs1226443178 2864 dbSNP
rs982543635 2879 dbSNP
rs1283643942 2886 dbSNP
rs1877175 2896 dbSNP
rs1365285374 2912 dbSNP
rs959635072 2913 dbSNP
rs1362131991 2914 dbSNP
rs1469735146 2915 dbSNP
rs1877176 2916 dbSNP
rs1046369432 2920 dbSNP
rs1456049014 2924 dbSNP
rs575121812 2926 dbSNP
rs907213548 2930 dbSNP
rs1004191654 2932 dbSNP
rs544531858 2953 dbSNP
rs1435248936 2961 dbSNP
rs1265794669 2962 dbSNP
rs898607921 2971 dbSNP
rs1324983518 2972 dbSNP
rs1207619032 2973 dbSNP
rs924381575 2977 dbSNP
rs1206319811 2979 dbSNP
rs933073407 2980 dbSNP
rs1051882267 2988 dbSNP
rs1235374062 2991 dbSNP
rs758371338 3002 dbSNP
rs1310210023 3003 dbSNP
rs9392502 3011 dbSNP
rs1304855016 3015 dbSNP
rs529974605 3020 dbSNP
rs1366205637 3029 dbSNP
rs751054240 3029 dbSNP
rs1433015652 3030 dbSNP
rs138169828 3036 dbSNP
rs756883949 3042 dbSNP
rs1303931010 3046 dbSNP
rs1008160173 3051 dbSNP
rs1468082652 3053 dbSNP
rs867145742 3054 dbSNP
rs190275816 3055 dbSNP
rs535002697 3056 dbSNP
rs745571942 3059 dbSNP
rs899071655 3060 dbSNP
rs1186337300 3066 dbSNP
rs1464022959 3067 dbSNP
rs1332253467 3072 dbSNP
rs1019926806 3074 dbSNP
rs1212150114 3079 dbSNP
rs559866046 3080 dbSNP
rs193183521 3082 dbSNP
rs1265234312 3090 dbSNP
rs1482241351 3116 dbSNP
rs756155641 3126 dbSNP
rs924943128 3127 dbSNP
rs993777617 3131 dbSNP
rs1300066051 3134 dbSNP
rs532514140 3135 dbSNP
rs1364534147 3136 dbSNP
rs1249084050 3139 dbSNP
rs552241242 3146 dbSNP
rs555959698 3147 dbSNP
rs1472282676 3148 dbSNP
rs531585583 3149 dbSNP
rs1398236748 3151 dbSNP
rs1400736636 3155 dbSNP
rs779284208 3156 dbSNP
rs1183014065 3158 dbSNP
rs1414385547 3161 dbSNP
rs567975411 3162 dbSNP
rs1430785187 3163 dbSNP
rs1372836860 3170 dbSNP
rs990491693 3172 dbSNP
rs1448557304 3174 dbSNP
rs916088138 3185 dbSNP
rs1189023853 3192 dbSNP
rs1421944909 3204 dbSNP
rs764206664 3215 dbSNP
rs1376668219 3216 dbSNP
rs772504849 3218 dbSNP
rs928904558 3219 dbSNP
rs1203214805 3220 dbSNP
rs1272286418 3220 dbSNP
rs1338987441 3226 dbSNP
rs1266070915 3228 dbSNP
rs2316514 3229 dbSNP
rs1338829703 3232 dbSNP
rs1395730584 3232 dbSNP
rs1010855615 3235 dbSNP
rs1022542881 3236 dbSNP
rs1409855558 3237 dbSNP
rs966917827 3237 dbSNP
rs1037067026 3245 dbSNP
rs978696893 3249 dbSNP
rs1391041637 3250 dbSNP
rs2316515 3251 dbSNP
rs1232299185 3257 dbSNP
rs995591652 3260 dbSNP
rs954635110 3263 dbSNP
rs1313063300 3267 dbSNP
rs987197965 3268 dbSNP
rs1473541086 3270 dbSNP
rs1249262329 3275 dbSNP
rs771110945 3277 dbSNP
rs910225080 3278 dbSNP
rs1050244674 3281 dbSNP
rs1483022612 3283 dbSNP
rs1400230590 3289 dbSNP
rs534463057 3290 dbSNP
rs150097398 3293 dbSNP
rs1008504435 3294 dbSNP
rs1181471359 3299 dbSNP
rs1331840964 3307 dbSNP
rs1286804609 3314 dbSNP
rs553335369 3315 dbSNP
rs1325075816 3319 dbSNP
rs573151598 3320 dbSNP
rs906329169 3321 dbSNP
rs1159265330 3322 dbSNP
rs1168092269 3328 dbSNP
rs999395837 3340 dbSNP
rs571055194 3358 dbSNP
rs1409697139 3359 dbSNP
rs1430338313 3361 dbSNP
rs1004045567 3363 dbSNP
rs1478216983 3371 dbSNP
rs1373082798 3377 dbSNP
rs775288126 3379 dbSNP
rs1201261042 3381 dbSNP
rs1450096120 3382 dbSNP
rs1252376287 3398 dbSNP
rs1209471758 3399 dbSNP
rs3842113 3399 dbSNP
rs398084699 3399 dbSNP
rs572818581 3399 dbSNP
rs575600001 3399 dbSNP
rs796847433 3399 dbSNP
rs201128980 3400 dbSNP
rs1380918745 3409 dbSNP
rs1398092570 3411 dbSNP
rs1293882890 3412 dbSNP
rs1341975503 3414 dbSNP
rs1229767995 3415 dbSNP
rs370631068 3419 dbSNP
rs1022242340 3422 dbSNP
rs1277452378 3424 dbSNP
rs1415025097 3439 dbSNP
rs538779996 3443 dbSNP
rs1170595495 3447 dbSNP
rs1477138050 3458 dbSNP
rs872071 3467 dbSNP
rs575226556 3469 dbSNP
rs1451373126 3482 dbSNP
rs1246334460 3484 dbSNP
rs1030244845 3487 dbSNP
rs1484369504 3488 dbSNP
rs1184491536 3494 dbSNP
rs928808872 3497 dbSNP
rs1247178770 3500 dbSNP
rs45580432 3508 dbSNP
rs972939404 3514 dbSNP
rs910341092 3516 dbSNP
rs1230250198 3519 dbSNP
rs919930782 3520 dbSNP
rs931280646 3534 dbSNP
rs1393226741 3537 dbSNP
rs1448578062 3539 dbSNP
rs1049734829 3545 dbSNP
rs1331892764 3550 dbSNP
rs1413357044 3553 dbSNP
rs761372765 3558 dbSNP
rs1169462271 3559 dbSNP
rs920228399 3570 dbSNP
rs929232388 3574 dbSNP
rs1186037006 3576 dbSNP
rs3191352 3578 dbSNP
rs1473385060 3580 dbSNP
rs1239703237 3583 dbSNP
rs1186101575 3590 dbSNP
rs944130794 3591 dbSNP
rs554517727 3592 dbSNP
rs1275875307 3593 dbSNP
rs902316678 3598 dbSNP
rs1360464534 3600 dbSNP
rs574655292 3600 dbSNP
rs927864050 3602 dbSNP
rs1050985 3604 dbSNP
rs1451166363 3610 dbSNP
rs1287979355 3616 dbSNP
rs1282325949 3631 dbSNP
rs1414165112 3639 dbSNP
rs999407244 3641 dbSNP
rs1054866383 3643 dbSNP
rs895265488 3647 dbSNP
rs946776513 3652 dbSNP
rs1170071208 3656 dbSNP
rs1032190109 3660 dbSNP
rs1416138679 3667 dbSNP
rs893490150 3672 dbSNP
rs1012348762 3678 dbSNP
rs185112419 3679 dbSNP
rs970915596 3681 dbSNP
rs1218667050 3691 dbSNP
rs1050987 3712 dbSNP
rs981879113 3713 dbSNP
rs1000192675 3719 dbSNP
rs1221900137 3721 dbSNP
rs767100735 3725 dbSNP
rs559953854 3729 dbSNP
rs1029946179 3734 dbSNP
rs1287201207 3737 dbSNP
rs749920407 3738 dbSNP
rs576608996 3741 dbSNP
rs545920386 3742 dbSNP
rs1289932558 3743 dbSNP
rs1407744957 3746 dbSNP
rs149277271 3748 dbSNP
rs1007086869 3750 dbSNP
rs1297820928 3751 dbSNP
rs543236599 3756 dbSNP
rs972999966 3758 dbSNP
rs1351636783 3767 dbSNP
rs746254523 3768 dbSNP
rs1162888229 3775 dbSNP
rs1267796428 3777 dbSNP
rs1331865629 3780 dbSNP
rs1018440075 3787 dbSNP
rs1407797333 3792 dbSNP
rs1417670367 3792 dbSNP
rs1191398237 3795 dbSNP
rs964469743 3804 dbSNP
rs1250554663 3805 dbSNP
rs1210378956 3817 dbSNP
rs796460054 3822 dbSNP
rs1464996140 3830 dbSNP
rs920200522 3834 dbSNP
rs2316516 3840 dbSNP
rs1477659081 3842 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.66 7.7e-4 0.782 2.3e-5 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.395 2.5e-2 0.465 9.6e-3 25 Click to see details
GSE21032 Prostate cancer -0.214 2.6e-2 -0.199 3.6e-2 83 Click to see details
GSE38226 Liver fibrosis 0.392 3.9e-2 0.345 6.3e-2 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.298 1.0e-1 0.394 4.3e-2 20 Click to see details
GSE19783 ER- ER- breast cancer -0.141 1.1e-1 -0.155 8.6e-2 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.231 1.3e-1 -0.232 1.3e-1 25 Click to see details
GSE28260 Renal cortex and medulla 0.296 1.6e-1 0.357 1.2e-1 13 Click to see details
GSE19536 Breast cancer -0.083 2.1e-1 -0.098 1.7e-1 100 Click to see details
GSE19350 CNS germ cell tumors -0.25 2.2e-1 -0.392 1.0e-1 12 Click to see details
GSE17306 Multiple myeloma -0.094 2.6e-1 -0.164 1.3e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells -0.129 2.8e-1 -0.258 1.2e-1 23 Click to see details
GSE14794 Lymphoblastoid cells 0.061 2.8e-1 0.095 1.9e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.145 3.0e-1 0.021 4.7e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.068 3.0e-1 -0.006 4.8e-1 64 Click to see details
GSE28544 Breast cancer 0.105 3.1e-1 0.200 1.7e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.077 3.4e-1 -0.044 4.1e-1 32 Click to see details
GSE17498 Multiple myeloma -0.054 3.7e-1 -0.095 2.8e-1 40 Click to see details
GSE21849 B cell lymphoma -0.042 4.1e-1 -0.101 3.0e-1 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.036 4.3e-1 -0.005 4.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.036 4.3e-1 -0.005 4.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.387 0 0.339 0 68 Click to see details
STAD 0.524 0 0.574 0 32 Click to see details
KICH 0.531 0 0.502 0.01 25 Click to see details
BLCA 0.574 0.01 0.587 0.01 18 Click to see details
PCPG -0.985 0.06 -1.000 0.5 3 Click to see details
CESC -0.974 0.07 -1.000 0.5 3 Click to see details
PRAD -0.178 0.11 -0.101 0.24 50 Click to see details
PAAD 0.771 0.11 0.800 0.1 4 Click to see details
THCA 0.15 0.13 0.133 0.16 59 Click to see details
UCEC -0.243 0.16 -0.146 0.28 19 Click to see details
CHOL -0.37 0.16 -0.317 0.2 9 Click to see details
KIRP 0.166 0.18 0.089 0.31 32 Click to see details
BRCA 0.1 0.18 0.119 0.14 84 Click to see details
ESCA -0.289 0.19 -0.427 0.1 11 Click to see details
LUAD 0.228 0.24 0.266 0.2 12 Click to see details
COAD 0.123 0.39 -0.143 0.37 8 Click to see details
LIHC 0.038 0.4 0.080 0.29 49 Click to see details
LUSC 0.037 0.41 0.072 0.33 38 Click to see details
HNSC 0.032 0.42 -0.020 0.45 42 Click to see details
HNSC 0.032 0.42 -0.020 0.45 42 Click to see details
HNSC 0.032 0.42 -0.020 0.45 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 </