miRTarBase - #MIRT179008 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PAFAH1B2   
Synonyms HEL-S-303
Description platelet activating factor acetylhydrolase 1b catalytic subunit 2
Transcript NM_002572   
Other Transcripts NM_001184746 , NM_001184747 , NM_001184748   
Expression
Putative miRNA Targets on PAFAH1B2
3'UTR of PAFAH1B2
(miRNA target sites are highlighted)
>PAFAH1B2|NM_002572|3'UTR
   1 CTGGCTCTTATCAGTGTTAATAGCATCTCAGCTTCCTCAGATCAGTTCTATCACTGGCACTACAGAATCCTTCTCTTTCT
  81 TAAGGCACTTTGCATTGTAGAATGTTCCTGGATGTTCATATCTAGTGTTTGAAGGGGAGGAGGGATTTAAACTGGTCCTG
 161 TACATAGAAGGTTTGTTTGACAGAGGAGAAAAATTAGCCAAGGAAGATTGTTGTTTAAATTCATTTGAAACCAGAAGGGG
 241 ACTTTTTAGTTGTATGTGTAACACATTCATTGAATTATTATCACTGTTTTCTTGGGACAACATCAAGCCTAAATACTGAA
 321 CAATATGAAGATTCTTTTCTTGGCCTTTCTGTGGATTATGTCATATATAATAATTATCAGAATCATTCTACTTGGCTTTA
 401 AAACATGTTTTCTCCAATTTTTTTAAGGTTCATAATTTAGCCTTTTGTTTTTATGTTGCTTAGATTCTTATGTATACTGA
 481 ATATTTTATTAACATGTAGCATCAGGTTGAACATGCTTGTCATTGATATATGGAAGATGCTATAGTTAGAAGTGAATTTG
 561 TTCTGCTTTCTTAATCTTTTCCATGCTTAGCAGTGAAAAACAGGTTTTGCCCCAGTAGAGGGATTCTTTGGAGGGTATTA
 641 TTTTTTATGCTGCTGAATATCATGTCTATAATAGACCCGTGCATGCAGCCTTTCCTCCTTATTCCCCTTCATGCCCCCCT
 721 TTCCCCTTCATTCCCCCCGCCACCCCGTTTTTTTTTTTTTTTTTTTTTTTTTGGTTCTTGTTGACATTACAAGCTTTTAA
 801 CACATTTTTGACCTAGGAGCCCTGTTGCTGGAAGTATAGTCTCCAGCCAGTTACTCTCATGATAGTACTGCTATAAAACT
 881 CATTCTTGTGTGGTGTTCTGTGCTATAGATTCTGTGTATTGCTGTTCATATTCGGAGTTCTGGTTTTGTTTTTCCCTTAA
 961 AACCTGTTAACAGTTTTTTTTGGGGGTGGGGGGATTCAGAACTCTTGTTTCCCATTCCATAGCACCTGACATTATTTCAA
1041 GTTTTATAATATCTTAAGGTGTATATTTTATTTTTTTTATTGGCTTAGTTGTTTTTTGTTTTGTTTTGTTTGAGATGGAG
1121 TTTCACTGTTGCCCAGGCTGGGGTGCAATGGTGTGATCTTGGCTCACTGCAGCCTCCACCTCCCGAGTTCAAATGATTCT
1201 CCTGCCTCAGCTTCCTGAGTAGCTGGGATTACAGGTGCATGCCACCATGCCCGGCTAATTTTTATATTTTTATTAGAGAC
1281 GGGATTTCGCCATGTTAACCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCCCGCCTTGGCCTCCCAAAGTGCTG
1361 GGATTACAGGCATGAGCCACCGTGCCTGGCCTTATTGGCTTAGTTTTTAAATTATCCTCCAAAAATTTTGGGCCTTTTTC
1441 TGTGGGGAAACAAGTGAAGCTGCTCTTCAGCATAGACACTACCTTTATCCCATCATTTTAGTAAAAACTAGGTTTGTTTC
1521 ACTTCTGAGGTGTCTTATTAATGTACTTCATCTGAGAATTTGTTGATCTTAATGTTCGAGCTATATAAGAACTGCCATTA
1601 AAAAAAATGGGATAATAGATGATTTTATCAGTATACCTGTGGAATATGTACAAACTGGATCTATAGATATTTTGAACTGG
1681 ACCAGGTGGGTATTGAAGTAACCCATCAAAATATGCTCTGCAGTGATTCCGCTTAATGTTTAAATTCAGTAACGTACTTG
1761 AAAGGCAAATTTCAGTGCTTTTGTATGTTGGAGGAGGGCTTACTGATGCGTGCTAAGACCGATTTCTGATTGAGGGATGA
1841 ACCTTGGGCTCATTTTTTTCTTGTGAAGTCTCTTTCTAGAAAATTTTTTGGTTTTGTTCTTTTTAAAAAATACATACTTT
1921 TTTGAATGTATCATGTCTTCATTAACAACAGAAAATCCACATGGTGTTTACTAAACTTGTTTACGACATTAAAAATTTCC
2001 TTTTTATTTTTAGTAGCCCAGGTTGAGTTTTTCACAAGAGATTTTTTTCTTAGCTGAGGTATAGTTGTATAGCAAGAAGA
2081 ATTAAGCCAGATTTTTGTGTGTGGAAAGACAGTTTTCTATCCACGTCTTTTTCTGTTTGTCAGAAGGTGGGAGTATGGTC
2161 CAAATAAATCCATTAGGTTACTCCTGCAGCATGCGCTTTTAGCTTCTCTCTTGACTGAGGATCAAATATCCCTTTGTGAG
2241 CTGGCCCTCAGCTCCTTTGCTCATGTGTACAAACCTCAGATGTTACTACATTTTATATCTACCAGAGCTATTCAAGCAAT
2321 AGTATTTGAACCACTAGCCTTTTAAATAAAATTCTGCCCCATTACTGATGTGCAGATATTGAGTTCACTTTCATTTTTTG
2401 CCAGATTTCTTTGCACTACTTTAGGTAAAAATAGTTAATCTATTTTTCTTTGACATCCTAGTTTGCGTCAGTGACAGAAC
2481 TTACTGCTTAGTCTTTGTACTTTTTAAAAAATCTATAAATTTAATGCACTGTCCAAGTGAAATGTCCTAGTTGTCATTGT
2561 GATTAAGGGGCCAACTTTCCAGGCAGCTAGCAGAGATACTATTCTCTTCCTCTCCCAGCAAATTTGTATTCCTTCGCCCA
2641 CGCATTCCTGCTATACTAGATGGCAGCCAGTGATGGAACTATAAAGATGTCTGTGGTCATATGTTGAATGTGGCAGCTTG
2721 AAGATGTACTGCCACGGGTGATCTAGGGCAGGCTGTCTTCCAGTCCATGTGTTCTCGGTCGCCGTAGACAGCGCTCTGGC
2801 TACCACCGTGAGGCTACTTGAACTGTCAGGGGCATCTGCCTAAACCAGAATCTTTTGTCAGAAACCTTAACCCAACAAAA
2881 CAAATCTTGAGTAGCTCATGCCCGGCTCTTAGGAATTTTGTCTGTTTAAAAAAAAAAAAAAAAAAAAAGTCCAACTTACT
2961 TTATTTTATTTTTTTAACCTAGTCACTGTTTACAATTGTATGCTAAAGCCTGAAATATTGTCTGTGCTGTGGTGTATGAG
3041 CATTGCCAACTTTATATTTATTGCAGTGAAGAAGAAACTAAAAATATATGGAAATGAGGAGCATGTCCAAGCTCCTAAAT
3121 CCGTGTGGGTGCATGTGGGAGAAGTGAGTTAGGGCCTCTTGAAAGGAGGCTTTTTGGAGAGGGGTCCCCCAGGTTTCTTG
3201 GTGTTCCTGCTTGGGGATCACTGCTGCTAGCTGACTGGACCTCCCCATTGGAAGTTTGTGATTTTGCTTTGGCAAAGTTT
3281 CATTGACTAGTAGAACTCATTCTGTTTTAGTGTATATTTCAATATAAATGTAAACATTTTGCTCAAAAAAAAAAAAAAAA
3361 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGU--AAUACACGACGAu 5'
               |::|  || | ||||||| 
Target 5' agggtATTATTTTTTATGCTGCTg 3'
632 - 655 151.00 -11.60
2
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  || |  ||||||| 
Target 5' gcttggggATCA-CTGCTGCTa 3'
3209 - 3229 141.00 -11.60
3
miRNA  3' guGUUU--GGUA-AUACACGACGAu 5'
            :|:|  |::| ||| |||||:| 
Target 5' taTAGATTCTGTGTAT-TGCTGTTc 3'
904 - 927 137.00 -12.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26987814 12 COSMIC
COSN19729854 24 COSMIC
COSN31488577 30 COSMIC
COSN509867 37 COSMIC
COSN26569469 76 COSMIC
COSN31496220 98 COSMIC
COSN19417258 316 COSMIC
COSN20583172 345 COSMIC
COSN28201761 366 COSMIC
COSN15779005 537 COSMIC
COSN28609441 731 COSMIC
COSN6406209 748 COSMIC
COSN15606501 752 COSMIC
COSN10078853 754 COSMIC
COSN10078854 755 COSMIC
COSN5896205 1132 COSMIC
COSN1515487 1701 COSMIC
COSN22973301 1755 COSMIC
COSN6987799 2482 COSMIC
COSN8733754 2548 COSMIC
COSN27872404 2679 COSMIC
COSN32063543 2925 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1298947648 3 dbSNP
rs1321333005 8 dbSNP
rs771654363 9 dbSNP
rs759145577 10 dbSNP
rs185651296 12 dbSNP
rs1305322547 13 dbSNP
rs760891382 13 dbSNP
rs764472610 15 dbSNP
rs754241219 17 dbSNP
rs1252053345 19 dbSNP
rs757737498 21 dbSNP
rs374632211 22 dbSNP
rs1393144213 23 dbSNP
rs1208768780 28 dbSNP
rs1261978239 30 dbSNP
rs750494576 32 dbSNP
rs7938902 33 dbSNP
rs1258921326 37 dbSNP
rs1169179402 40 dbSNP
rs1451203662 44 dbSNP
rs1424737889 49 dbSNP
rs371397952 51 dbSNP
rs1197896901 54 dbSNP
rs1451877707 60 dbSNP
rs1446235553 64 dbSNP
rs554123990 69 dbSNP
rs1248208729 72 dbSNP
rs761057750 76 dbSNP
rs1231272911 83 dbSNP
rs1343406782 89 dbSNP
rs1471498731 90 dbSNP
rs1479606832 92 dbSNP
rs1437613796 107 dbSNP
rs1333096886 112 dbSNP
rs573666464 116 dbSNP
rs536284576 124 dbSNP
rs1309871834 125 dbSNP
rs1007036696 128 dbSNP
rs1412800832 134 dbSNP
rs1422954036 135 dbSNP
rs1018829901 137 dbSNP
rs556291976 144 dbSNP
rs766651558 146 dbSNP
rs1379110852 154 dbSNP
rs753955538 156 dbSNP
rs536722075 159 dbSNP
rs1157396486 162 dbSNP
rs1482490694 163 dbSNP
rs1000313850 165 dbSNP
rs1032759688 171 dbSNP
rs1206677638 208 dbSNP
rs1406355768 210 dbSNP
rs1325978334 211 dbSNP
rs1278512863 212 dbSNP
rs1220218468 228 dbSNP
rs576247497 234 dbSNP
rs1286796815 240 dbSNP
rs1228033166 241 dbSNP
rs150473023 243 dbSNP
rs1309995402 245 dbSNP
rs1445881302 253 dbSNP
rs1282242956 264 dbSNP
rs190577543 271 dbSNP
rs180788501 282 dbSNP
rs183925361 287 dbSNP
rs1349911654 288 dbSNP
rs979975015 292 dbSNP
rs1183777359 295 dbSNP
rs1471506709 301 dbSNP
rs780129348 303 dbSNP
rs1211468658 305 dbSNP
rs1444581788 306 dbSNP
rs578119156 309 dbSNP
rs768425853 321 dbSNP
rs1330132536 324 dbSNP
rs1290409699 325 dbSNP
rs974605006 326 dbSNP
rs77171490 327 dbSNP
rs930008271 337 dbSNP
rs1051028365 357 dbSNP
rs1473640857 358 dbSNP
rs1318362048 364 dbSNP
rs1456488929 366 dbSNP
rs761192597 373 dbSNP
rs560441124 376 dbSNP
rs1363257074 385 dbSNP
rs769113605 392 dbSNP
rs1473422769 408 dbSNP
rs1403197137 418 dbSNP
rs912834995 418 dbSNP
rs1410222316 419 dbSNP
rs1364174682 424 dbSNP
rs529246436 430 dbSNP
rs1302205016 433 dbSNP
rs1188371230 443 dbSNP
rs1465653098 458 dbSNP
rs1270358764 460 dbSNP
rs1219660087 464 dbSNP
rs1321277617 465 dbSNP
rs56284158 468 dbSNP
rs746811035 469 dbSNP
rs1370758070 470 dbSNP
rs540574927 471 dbSNP
rs1039874775 472 dbSNP
rs1384967408 475 dbSNP
rs1334601604 494 dbSNP
rs904058443 496 dbSNP
rs1245434720 498 dbSNP
rs1290356868 502 dbSNP
rs1348941374 517 dbSNP
rs1433862054 517 dbSNP
rs549005562 523 dbSNP
rs1425967661 525 dbSNP
rs1357083753 527 dbSNP
rs562551953 530 dbSNP
rs1168530277 531 dbSNP
rs879205260 535 dbSNP
rs1450573662 538 dbSNP
rs1264300848 542 dbSNP
rs1054232893 543 dbSNP
rs76825633 554 dbSNP
rs879715720 555 dbSNP
rs1247488758 561 dbSNP
rs781018244 561 dbSNP
rs1223918518 563 dbSNP
rs55914924 564 dbSNP
rs1009924342 567 dbSNP
rs56273235 571 dbSNP
rs1227596073 573 dbSNP
rs1023949688 580 dbSNP
rs866177426 581 dbSNP
rs1297546225 585 dbSNP
rs1217256528 592 dbSNP
rs1366511863 593 dbSNP
rs1249922007 599 dbSNP
rs1443075713 601 dbSNP
rs1368178148 605 dbSNP
rs1190293807 607 dbSNP
rs1306799830 611 dbSNP
rs1383906284 613 dbSNP
rs1375273073 616 dbSNP
rs551607965 626 dbSNP
rs1174458488 638 dbSNP
rs1432935509 639 dbSNP
rs1426266561 641 dbSNP
rs1201890756 654 dbSNP
rs1444451191 658 dbSNP
rs1251182312 677 dbSNP
rs571386787 678 dbSNP
rs1392363157 679 dbSNP
rs1252966177 680 dbSNP
rs1463213762 686 dbSNP
rs1207881015 691 dbSNP
rs1296023824 699 dbSNP
rs1395227232 708 dbSNP
rs1301643966 709 dbSNP
rs1224969662 712 dbSNP
rs1348235481 715 dbSNP
rs1287225883 719 dbSNP
rs1396092437 720 dbSNP
rs1399308488 721 dbSNP
rs201596909 721 dbSNP
rs1338674142 726 dbSNP
rs1380446993 728 dbSNP
rs1360125749 730 dbSNP
rs1245102744 731 dbSNP
rs1183052183 733 dbSNP
rs1411496369 733 dbSNP
rs1298087657 735 dbSNP
rs1308974731 737 dbSNP
rs1225517369 739 dbSNP
rs190482111 740 dbSNP
rs1205315104 741 dbSNP
rs935752823 743 dbSNP
rs1202221279 746 dbSNP
rs1239266405 746 dbSNP
rs1359076423 747 dbSNP
rs1480176802 747 dbSNP
rs1053293264 748 dbSNP
rs1162790244 748 dbSNP
rs1165420664 748 dbSNP
rs1193630062 748 dbSNP
rs1247189826 748 dbSNP
rs1321554568 748 dbSNP
rs1387123702 748 dbSNP
rs1388829222 748 dbSNP
rs1447521752 748 dbSNP
rs1458446907 748 dbSNP
rs1491516159 748 dbSNP
rs71469127 748 dbSNP
rs780327023 748 dbSNP
rs1369195175 749 dbSNP
rs1491273215 749 dbSNP
rs1293246106 750 dbSNP
rs55659804 751 dbSNP
rs11216305 752 dbSNP
rs1274572366 753 dbSNP
rs1472745673 754 dbSNP
rs369297855 755 dbSNP
rs1207775295 756 dbSNP
rs1189710499 757 dbSNP
rs1389469589 758 dbSNP
rs866099118 758 dbSNP
rs1414932400 759 dbSNP
rs1375686336 760 dbSNP
rs1427106253 761 dbSNP
rs1167953597 762 dbSNP
rs1480519922 762 dbSNP
rs1270491749 763 dbSNP
rs1202389518 765 dbSNP
rs1483042426 766 dbSNP
rs1274286232 767 dbSNP
rs1372121131 767 dbSNP
rs1466140163 770 dbSNP
rs1253462500 773 dbSNP
rs371952915 774 dbSNP
rs377139336 775 dbSNP
rs11216306 776 dbSNP
rs1403202233 778 dbSNP
rs1451836943 780 dbSNP
rs1321060464 781 dbSNP
rs11216307 782 dbSNP
rs1237615793 783 dbSNP
rs1363887418 787 dbSNP
rs1347605473 791 dbSNP
rs117842423 794 dbSNP
rs1295179407 795 dbSNP
rs1313034043 799 dbSNP
rs1034270630 802 dbSNP
rs1353906516 805 dbSNP
rs188550080 811 dbSNP
rs1322830283 814 dbSNP
rs146031077 817 dbSNP
rs11216308 820 dbSNP
rs181355369 823 dbSNP
rs1171771726 828 dbSNP
rs973921030 831 dbSNP
rs1485125156 832 dbSNP
rs918695591 837 dbSNP
rs74853754 847 dbSNP
rs1184608216 848 dbSNP
rs1441132149 859 dbSNP
rs1278429123 874 dbSNP
rs1204704231 879 dbSNP
rs185919841 884 dbSNP
rs556157493 888 dbSNP
rs1266445423 889 dbSNP
rs138790262 895 dbSNP
rs986770200 897 dbSNP
rs1374181548 899 dbSNP
rs1281300692 901 dbSNP
rs912523568 903 dbSNP
rs1268443854 906 dbSNP
rs942713909 908 dbSNP
rs1407967168 910 dbSNP
rs1433432232 910 dbSNP
rs765587298 910 dbSNP
rs10892082 911 dbSNP
rs1159779270 912 dbSNP
rs538691858 913 dbSNP
rs1184643908 917 dbSNP
rs1462951095 919 dbSNP
rs1246528362 925 dbSNP
rs936855993 931 dbSNP
rs558400011 935 dbSNP
rs75301475 936 dbSNP
rs11540099 938 dbSNP
rs1354226669 954 dbSNP
rs144675587 954 dbSNP
rs1453238892 957 dbSNP
rs1045430087 958 dbSNP
rs1318229827 964 dbSNP
rs1429661145 966 dbSNP
rs147305219 968 dbSNP
rs760357455 969 dbSNP
rs1403071566 972 dbSNP
rs1001203363 973 dbSNP
rs1164804778 974 dbSNP
rs775200829 975 dbSNP
rs898394411 977 dbSNP
rs113647409 982 dbSNP
rs373116164 982 dbSNP
rs1025404035 988 dbSNP
rs181891564 991 dbSNP
rs45535637 992 dbSNP
rs1292506217 994 dbSNP
rs1451142721 994 dbSNP
rs1246638459 999 dbSNP
rs562516073 1003 dbSNP
rs964419650 1006 dbSNP
rs1362280460 1019 dbSNP
rs139312714 1022 dbSNP
rs1433799965 1023 dbSNP
rs1342285267 1024 dbSNP
rs551837970 1027 dbSNP
rs565265709 1031 dbSNP
rs527480826 1032 dbSNP
rs1170251526 1039 dbSNP
rs116773440 1047 dbSNP
rs1189700960 1050 dbSNP
rs1422046420 1050 dbSNP
rs914035241 1060 dbSNP
rs1224808785 1064 dbSNP
rs1203670802 1071 dbSNP
rs1272358020 1071 dbSNP
rs1490831386 1071 dbSNP
rs11540098 1081 dbSNP
rs1045542827 1085 dbSNP
rs1217124699 1087 dbSNP
rs1344475392 1088 dbSNP
rs1490922750 1091 dbSNP
rs1224333809 1093 dbSNP
rs143325875 1094 dbSNP
rs375103290 1094 dbSNP
rs558680319 1094 dbSNP
rs1055441773 1096 dbSNP
rs1266303745 1099 dbSNP
rs898421583 1104 dbSNP
rs1469543600 1105 dbSNP
rs1182312453 1109 dbSNP
rs995343549 1115 dbSNP
rs1201743507 1116 dbSNP
rs1471662657 1119 dbSNP
rs1025513375 1121 dbSNP
rs766700046 1129 dbSNP
rs1252928472 1138 dbSNP
rs1480882850 1138 dbSNP
rs144864963 1141 dbSNP
rs1008001928 1143 dbSNP
rs777020441 1144 dbSNP
rs113590471 1147 dbSNP
rs538280440 1149 dbSNP
rs1348093705 1151 dbSNP
rs532559350 1154 dbSNP
rs1376160495 1160 dbSNP
rs1301576974 1175 dbSNP
rs1365155206 1185 dbSNP
rs765482224 1186 dbSNP
rs1407236650 1194 dbSNP
rs1178886805 1197 dbSNP
rs1455776996 1200 dbSNP
rs1299990368 1203 dbSNP
rs1363310597 1207 dbSNP
rs1371199248 1230 dbSNP
rs1419645298 1236 dbSNP
rs1181628869 1244 dbSNP
rs1223716114 1249 dbSNP
rs541871775 1252 dbSNP
rs975830708 1253 dbSNP
rs1205191334 1254 dbSNP
rs1348084124 1255 dbSNP
rs1362106553 1256 dbSNP
rs550664007 1257 dbSNP
rs1244202953 1260 dbSNP
rs1319301936 1275 dbSNP
rs1311233598 1277 dbSNP
rs569021116 1281 dbSNP
rs1339036417 1282 dbSNP
rs565678041 1290 dbSNP
rs1433237010 1293 dbSNP
rs1384492804 1294 dbSNP
rs1289575923 1300 dbSNP
rs1490091542 1304 dbSNP
rs1204712904 1309 dbSNP
rs958535838 1310 dbSNP
rs1366756882 1311 dbSNP
rs988433237 1312 dbSNP
rs1443870206 1313 dbSNP
rs1385697838 1314 dbSNP
rs914151294 1320 dbSNP
rs1385762881 1323 dbSNP
rs949563062 1328 dbSNP
rs1260581685 1333 dbSNP
rs982258158 1336 dbSNP
rs534420776 1338 dbSNP
rs1161476824 1340 dbSNP
rs1384324265 1342 dbSNP
rs928392824 1349 dbSNP
rs1430658216 1353 dbSNP
rs937079400 1354 dbSNP
rs1055876969 1357 dbSNP
rs1317685630 1358 dbSNP
rs1331057148 1362 dbSNP
rs1225676814 1364 dbSNP
rs1326169431 1368 dbSNP
rs1296603583 1372 dbSNP
rs1352901161 1373 dbSNP
rs898199450 1374 dbSNP
rs930971686 1380 dbSNP
rs553900163 1381 dbSNP
rs1366080313 1382 dbSNP
rs1060211 1383 dbSNP
rs1474315503 1385 dbSNP
rs1372246869 1386 dbSNP
rs1385667551 1387 dbSNP
rs1451037539 1395 dbSNP
rs1314815674 1402 dbSNP
rs1193456737 1404 dbSNP
rs1429864247 1415 dbSNP
rs1343237558 1426 dbSNP
rs1214865739 1427 dbSNP
rs1490671430 1431 dbSNP
rs1008031406 1432 dbSNP
rs1040853183 1435 dbSNP
rs1305308202 1441 dbSNP
rs996903502 1442 dbSNP
rs1229967443 1470 dbSNP
rs1343869338 1475 dbSNP
rs1282773465 1476 dbSNP
rs1243176515 1478 dbSNP
rs1032839667 1479 dbSNP
rs758406090 1490 dbSNP
rs554643874 1492 dbSNP
rs1395520537 1499 dbSNP
rs1462613756 1508 dbSNP
rs1009560194 1511 dbSNP
rs1181614101 1517 dbSNP
rs1463258803 1523 dbSNP
rs1021240774 1528 dbSNP
rs1242303144 1539 dbSNP
rs1475615113 1547 dbSNP
rs1169922308 1551 dbSNP
rs1417605033 1553 dbSNP
rs1409569151 1557 dbSNP
rs1176917357 1562 dbSNP
rs1408321291 1573 dbSNP
rs1270335157 1578 dbSNP
rs1468707907 1579 dbSNP
rs187273139 1581 dbSNP
rs764042479 1582 dbSNP
rs970945586 1584 dbSNP
rs192067458 1586 dbSNP
rs926778901 1593 dbSNP
rs879220756 1597 dbSNP
rs1224314019 1598 dbSNP
rs1325764857 1600 dbSNP
rs554423120 1600 dbSNP
rs1271611564 1601 dbSNP
rs991287002 1603 dbSNP
rs1329338185 1605 dbSNP
rs1448751554 1611 dbSNP
rs919653913 1613 dbSNP
rs765085277 1615 dbSNP
rs1430867944 1622 dbSNP
rs751547277 1631 dbSNP
rs1470111740 1653 dbSNP
rs1201765950 1657 dbSNP
rs1233945388 1664 dbSNP
rs1262415441 1671 dbSNP
rs1242846594 1675 dbSNP
rs73578684 1677 dbSNP
rs943922664 1678 dbSNP
rs1282323624 1687 dbSNP
rs1195104718 1688 dbSNP
rs1041277697 1691 dbSNP
rs899705791 1695 dbSNP
rs545121046 1700 dbSNP
rs114637182 1704 dbSNP
rs893877382 1705 dbSNP
rs1335829113 1708 dbSNP
rs1200326929 1709 dbSNP
rs1360504459 1712 dbSNP
rs79044679 1715 dbSNP
rs1468288480 1718 dbSNP
rs1176397580 1723 dbSNP
rs541543035 1725 dbSNP
rs182087844 1747 dbSNP
rs529945944 1752 dbSNP
rs1160976799 1754 dbSNP
rs1443259511 1755 dbSNP
rs1316710296 1758 dbSNP
rs550075777 1776 dbSNP
rs1429594400 1779 dbSNP
rs1283516106 1780 dbSNP
rs1346906418 1783 dbSNP
rs199697214 1783 dbSNP
rs1447663165 1784 dbSNP
rs397778984 1784 dbSNP
rs45628435 1784 dbSNP
rs780225114 1787 dbSNP
rs1218782552 1791 dbSNP
rs1282601721 1804 dbSNP
rs1357187927 1804 dbSNP
rs1246413663 1808 dbSNP
rs1314161256 1808 dbSNP
rs748841991 1810 dbSNP
rs768229136 1821 dbSNP
rs569896673 1822 dbSNP
rs973959525 1825 dbSNP
rs919692339 1833 dbSNP
rs1281894454 1837 dbSNP
rs1446212149 1838 dbSNP
rs1365468138 1839 dbSNP
rs866507992 1843 dbSNP
rs1425945685 1844 dbSNP
rs1417735562 1849 dbSNP
rs1475859441 1854 dbSNP
rs879151103 1859 dbSNP
rs1223579647 1860 dbSNP
rs982420536 1868 dbSNP
rs1223085674 1869 dbSNP
rs1290977038 1869 dbSNP
rs908177988 1871 dbSNP
rs1198829376 1874 dbSNP
rs1213686879 1875 dbSNP
rs185160798 1877 dbSNP
rs1279581889 1884 dbSNP
rs1471448613 1887 dbSNP
rs1344267420 1891 dbSNP
rs943704758 1891 dbSNP
rs1304288694 1897 dbSNP
rs1157272716 1898 dbSNP
rs1407797549 1900 dbSNP
rs551844910 1905 dbSNP
rs866789805 1913 dbSNP
rs921167775 1915 dbSNP
rs1197480225 1917 dbSNP
rs1480169793 1918 dbSNP
rs1269612810 1919 dbSNP
rs1191713915 1925 dbSNP
rs1489415344 1927 dbSNP
rs932524632 1928 dbSNP
rs1203514383 1938 dbSNP
rs747196488 1944 dbSNP
rs189920008 1955 dbSNP
rs893909814 1956 dbSNP
rs1303428771 1957 dbSNP
rs1221259293 1961 dbSNP
rs1322236456 1962 dbSNP
rs1283354545 1965 dbSNP
rs1367015284 1974 dbSNP
rs755275688 1982 dbSNP
rs945411567 1985 dbSNP
rs1371776729 1986 dbSNP
rs1298014062 1988 dbSNP
rs534387663 1996 dbSNP
rs1042417802 2000 dbSNP
rs1322324443 2001 dbSNP
rs559231738 2002 dbSNP
rs1469429490 2012 dbSNP
rs1241182938 2017 dbSNP
rs781642616 2023 dbSNP
rs1178319291 2028 dbSNP
rs1277689772 2028 dbSNP
rs1434877519 2031 dbSNP
rs1003939231 2032 dbSNP
rs747508516 2041 dbSNP
rs1458069246 2042 dbSNP
rs1239714416 2062 dbSNP
rs895360955 2063 dbSNP
rs554259808 2066 dbSNP
rs1349749976 2069 dbSNP
rs182559402 2072 dbSNP
rs995029140 2073 dbSNP
rs373158698 2074 dbSNP
rs1314563603 2076 dbSNP
rs1306954769 2090 dbSNP
rs77678768 2091 dbSNP
rs1379588560 2092 dbSNP
rs1335124769 2105 dbSNP
rs982533484 2125 dbSNP
rs188141473 2126 dbSNP
rs1304708094 2129 dbSNP
rs1451746101 2135 dbSNP
rs544997703 2138 dbSNP
rs1221949129 2142 dbSNP
rs1015290556 2143 dbSNP
rs1251339580 2144 dbSNP
rs1439626745 2147 dbSNP
rs1382017062 2162 dbSNP
rs1181496990 2165 dbSNP
rs576706494 2165 dbSNP
rs1256449838 2173 dbSNP
rs976807215 2185 dbSNP
rs921209287 2188 dbSNP
rs1259572934 2192 dbSNP
rs1218057337 2195 dbSNP
rs1356458226 2196 dbSNP
rs932534827 2197 dbSNP
rs1245674377 2215 dbSNP
rs989323129 2216 dbSNP
rs1165894688 2220 dbSNP
rs1383712726 2226 dbSNP
rs915040176 2232 dbSNP
rs773604621 2233 dbSNP
rs1420277387 2246 dbSNP
rs945190240 2263 dbSNP
rs1042523760 2264 dbSNP
rs1423804852 2271 dbSNP
rs1368760174 2283 dbSNP
rs1189208338 2288 dbSNP
rs1426352341 2290 dbSNP
rs1260511787 2293 dbSNP
rs207472401 2302 dbSNP
rs1193714769 2308 dbSNP
rs11540101 2310 dbSNP
rs1290242152 2316 dbSNP
rs759885482 2318 dbSNP
rs1396669090 2321 dbSNP
rs61905518 2325 dbSNP
rs1357497569 2335 dbSNP
rs1326820348 2337 dbSNP
rs1267542851 2339 dbSNP
rs775649408 2346 dbSNP
rs572486077 2355 dbSNP
rs1326046739 2358 dbSNP
rs1278976227 2368 dbSNP
rs1401952555 2369 dbSNP
rs11540103 2371 dbSNP
rs1343674621 2374 dbSNP
rs1301221884 2376 dbSNP
rs1453227454 2380 dbSNP
rs1316908928 2384 dbSNP
rs552189292 2393 dbSNP
rs749848445 2404 dbSNP
rs1245603858 2408 dbSNP
rs1055504579 2410 dbSNP
rs1252095959 2414 dbSNP
rs1341616947 2415 dbSNP
rs1194115209 2417 dbSNP
rs895408040 2423 dbSNP
rs1462170085 2427 dbSNP
rs561395061 2428 dbSNP
rs1241760681 2430 dbSNP
rs1478532283 2436 dbSNP
rs1027858811 2438 dbSNP
rs1452689895 2440 dbSNP
rs886643482 2441 dbSNP
rs771449820 2443 dbSNP
rs1194417441 2448 dbSNP
rs1004994833 2450 dbSNP
rs1015321595 2455 dbSNP
rs1220625360 2457 dbSNP
rs763139926 2467 dbSNP
rs764198674 2468 dbSNP
rs1435752752 2471 dbSNP
rs1463165536 2479 dbSNP
rs1165675897 2480 dbSNP
rs1398846722 2481 dbSNP
rs1470257280 2487 dbSNP
rs1325335478 2492 dbSNP
rs1338618154 2494 dbSNP
rs1389482968 2494 dbSNP
rs1291702704 2497 dbSNP
rs1331612487 2498 dbSNP
rs1380381097 2499 dbSNP
rs1395212412 2500 dbSNP
rs1296607441 2506 dbSNP
rs772352734 2506 dbSNP
rs1028374902 2507 dbSNP
rs953991746 2508 dbSNP
rs1379907064 2514 dbSNP
rs1180236775 2515 dbSNP
rs1225451524 2516 dbSNP
rs1437620809 2522 dbSNP
rs1257512487 2531 dbSNP
rs751635788 2535 dbSNP
rs989437858 2539 dbSNP
rs1200823543 2550 dbSNP
rs150529996 2552 dbSNP
rs543292502 2558 dbSNP
rs1219861846 2559 dbSNP
rs1261795849 2570 dbSNP
rs374589090 2573 dbSNP
rs945213551 2574 dbSNP
rs1187504272 2576 dbSNP
rs977893468 2579 dbSNP
rs1404664214 2586 dbSNP
rs15030 2596 dbSNP
rs1429946020 2597 dbSNP
rs1190491720 2598 dbSNP
rs1157357963 2602 dbSNP
rs1414575608 2602 dbSNP
rs1470065428 2616 dbSNP
rs939397824 2621 dbSNP
rs1180864602 2629 dbSNP
rs1055134692 2636 dbSNP
rs1422374170 2637 dbSNP
rs916607079 2638 dbSNP
rs1444204669 2642 dbSNP
rs930636601 2643 dbSNP
rs1178557668 2644 dbSNP
rs1352891777 2645 dbSNP
rs1309776062 2649 dbSNP
rs1403771064 2649 dbSNP
rs1242080932 2650 dbSNP
rs1465445536 2651 dbSNP
rs542784334 2654 dbSNP
rs886674608 2656 dbSNP
rs1005026483 2661 dbSNP
rs796298332 2665 dbSNP
rs767434171 2670 dbSNP
rs1346288746 2675 dbSNP
rs1361706407 2677 dbSNP
rs1160920619 2679 dbSNP
rs1423159207 2694 dbSNP
rs1413435032 2703 dbSNP
rs1225396444 2714 dbSNP
rs1182676266 2715 dbSNP
rs1240497432 2719 dbSNP
rs532259249 2726 dbSNP
rs1488631126 2733 dbSNP
rs1286693362 2734 dbSNP
rs1028071927 2737 dbSNP
rs953880347 2739 dbSNP
rs1228602326 2744 dbSNP
rs1357993828 2745 dbSNP
rs1312146745 2751 dbSNP
rs1267946757 2757 dbSNP
rs1010557480 2759 dbSNP
rs1340550144 2760 dbSNP
rs755901577 2767 dbSNP
rs1022238515 2770 dbSNP
rs12574377 2775 dbSNP
rs12273027 2777 dbSNP
rs376427366 2778 dbSNP
rs559052797 2781 dbSNP
rs753590091 2782 dbSNP
rs1407332359 2783 dbSNP
rs1203069988 2784 dbSNP
rs528110141 2786 dbSNP
rs1478192649 2794 dbSNP
rs547860853 2795 dbSNP
rs991345065 2800 dbSNP
rs1489839276 2804 dbSNP
rs12576725 2806 dbSNP
rs1245955092 2807 dbSNP
rs114732975 2808 dbSNP
rs1323235075 2809 dbSNP
rs536440284 2814 dbSNP
rs1426525292 2816 dbSNP
rs193148674 2817 dbSNP
rs1049028582 2828 dbSNP
rs1318014461 2830 dbSNP
rs1279526957 2831 dbSNP
rs560946715 2832 dbSNP
rs1367477939 2841 dbSNP
rs908147104 2847 dbSNP
rs1159744617 2859 dbSNP
rs1353054450 2869 dbSNP
rs1365383233 2876 dbSNP
rs1425959732 2882 dbSNP
rs1466329371 2882 dbSNP
rs940915060 2884 dbSNP
rs1424398009 2886 dbSNP
rs570237952 2886 dbSNP
rs1191659740 2892 dbSNP
rs11860 2902 dbSNP
rs528321169 2903 dbSNP
rs183558724 2904 dbSNP
rs1366919109 2905 dbSNP
rs12574603 2909 dbSNP
rs1224890996 2912 dbSNP
rs1309769151 2921 dbSNP
rs1311063835 2923 dbSNP
rs1302594088 2924 dbSNP
rs1315556153 2925 dbSNP
rs1371704869 2925 dbSNP
rs1308988952 2927 dbSNP
rs1358502515 2927 dbSNP
rs1177743091 2928 dbSNP
rs1179684115 2928 dbSNP
rs1229007842 2928 dbSNP
rs1234426514 2928 dbSNP
rs1239643324 2928 dbSNP
rs1256061412 2928 dbSNP
rs1378325998 2928 dbSNP
rs1402702346 2928 dbSNP
rs1439971285 2928 dbSNP
rs1482652328 2928 dbSNP
rs150627380 2928 dbSNP
rs548543438 2928 dbSNP
rs1239837106 2929 dbSNP
rs1292905034 2930 dbSNP
rs1490416929 2931 dbSNP
rs1224178099 2933 dbSNP
rs1241361356 2946 dbSNP
rs1244478058 2949 dbSNP
rs1379522931 2949 dbSNP
rs76205794 2950 dbSNP
rs1395607995 2951 dbSNP
rs902050686 2954 dbSNP
rs996352646 2955 dbSNP
rs1049964829 2960 dbSNP
rs879085509 2964 dbSNP
rs1157923676 2966 dbSNP
rs1358520913 2966 dbSNP
rs1420087655 2967 dbSNP
rs796985142 2969 dbSNP
rs879003193 2969 dbSNP
rs889518978 2972 dbSNP
rs1417193596 2977 dbSNP
rs1256301395 2981 dbSNP
rs1183078040 2993 dbSNP
rs540022922 2996 dbSNP
rs1217900127 3004 dbSNP
rs1010587196 3006 dbSNP
rs1385571625 3010 dbSNP
rs1021933101 3016 dbSNP
rs559233868 3019 dbSNP
rs966619353 3022 dbSNP
rs1349428834 3041 dbSNP
rs572446398 3049 dbSNP
rs1300462046 3051 dbSNP
rs1380624549 3051 dbSNP
rs1297522421 3055 dbSNP
rs535063951 3056 dbSNP
rs370263047 3057 dbSNP
rs1400523293 3062 dbSNP
rs1362296990 3068 dbSNP
rs999482002 3073 dbSNP
rs143337330 3088 dbSNP
rs960851177 3093 dbSNP
rs559867617 3096 dbSNP
rs1476555888 3099 dbSNP
rs1316183959 3100 dbSNP
rs1361953788 3106 dbSNP
rs1195100767 3122 dbSNP
rs916671051 3123 dbSNP
rs952102432 3124 dbSNP
rs1247793553 3132 dbSNP
rs1287280713 3133 dbSNP
rs1320638846 3138 dbSNP
rs1216968675 3151 dbSNP
rs984764501 3153 dbSNP
rs1278916530 3164 dbSNP
rs778629739 3167 dbSNP
rs1219217198 3185 dbSNP
rs565199967 3190 dbSNP
rs1328109942 3191 dbSNP
rs907844538 3192 dbSNP
rs940695838 3192 dbSNP
rs1391101503 3193 dbSNP
rs1294935903 3198 dbSNP
rs1252505593 3202 dbSNP
rs188998050 3206 dbSNP
rs747679472 3211 dbSNP
rs976776321 3212 dbSNP
rs1479116600 3215 dbSNP
rs1376455712 3223 dbSNP
rs1198726312 3236 dbSNP
rs1434122366 3249 dbSNP
rs1269899232 3254 dbSNP
rs1456398269 3258 dbSNP
rs543900517 3260 dbSNP
rs146727549 3267 dbSNP
rs1200630743 3274 dbSNP
rs1446211711 3289 dbSNP
rs1180387345 3290 dbSNP
rs1232365297 3291 dbSNP
rs1413304575 3294 dbSNP
rs1331523698 3301 dbSNP
rs1305348033 3303 dbSNP
rs932158136 3311 dbSNP
rs771353528 3321 dbSNP
rs1411183048 3322 dbSNP
rs889545521 3323 dbSNP
rs192574402 3326 dbSNP
rs576983465 3328 dbSNP
rs545763837 3337 dbSNP
rs746249453 3339 dbSNP
rs999186862 3345 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGU--AAUACACGACGAu 5'
               |::|  || | ||||||| 
Target 5' aggguAUUAUUUUUUAUGCUGCUg 3'
10 - 33
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000527958.1 | 3UTR | AUUCUUUGGAGGGUAUUAUUUUUUAUGCUGCUGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.361 4.0e-4 0.382 1.8e-4 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.648 1.0e-3 0.729 1.3e-4 20 Click to see details
GSE21687 Ependynoma primary tumors -0.293 9.4e-3 -0.265 1.7e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.422 2.0e-2 -0.397 2.7e-2 24 Click to see details
GSE32688 Pancreatic cancer 0.316 3.9e-2 0.253 8.1e-2 32 Click to see details
GSE17306 Multiple myeloma 0.195 9.0e-2 0.258 3.7e-2 49 Click to see details
GSE21849 B cell lymphoma -0.223 1.2e-1 -0.020 4.6e-1 29 Click to see details
GSE28260 Renal cortex and medulla -0.33 1.4e-1 -0.478 4.9e-2 13 Click to see details
GSE28544 Breast cancer 0.224 1.5e-1 0.551 2.6e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.214 1.8e-1 -0.326 8.0e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.137 2.6e-1 0.215 1.5e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.132 2.7e-1 0.090 3.4e-1 23 Click to see details
GSE27834 Pluripotent stem cells 0.112 3.4e-1 0.179 2.5e-1 16 Click to see details
GSE17498 Multiple myeloma -0.067 3.4e-1 -0.017 4.6e-1 40 Click to see details
GSE38226 Liver fibrosis -0.066 3.9e-1 -0.142 2.7e-1 21 Click to see details
GSE19536 Breast cancer -0.021 4.2e-1 -0.026 4.0e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.023 4.2e-1 0.002 4.9e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.024 4.5e-1 -0.045 4.2e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.018 4.8e-1 -0.091 3.9e-1 12 Click to see details
GSE14794 Lymphoblastoid cells 0.003 4.9e-1 -0.001 5.0e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.003 4.9e-1 -0.001 5.0e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.775 0.01 -0.867 0 9 Click to see details
THCA -0.204 0.06 -0.244 0.03 59 Click to see details
KIRP -0.252 0.08 -0.236 0.1 32 Click to see details
PCPG -0.958 0.09 -1.000 0.5 3 Click to see details
BLCA 0.292 0.12 0.373 0.06 18 Click to see details
PAAD 0.654 0.17 0.200 0.4 4 Click to see details
HNSC -0.137 0.19 -0.097 0.27 42 Click to see details
LUSC -0.137 0.21 -0.185 0.13 38 Click to see details
KIRC -0.101 0.21 -0.084 0.25 68 Click to see details
LIHC 0.08 0.29 0.075 0.3 49 Click to see details
LUAD -0.16 0.31 -0.231 0.24 12 Click to see details
STAD -0.088 0.32 -0.054 0.38 32 Click to see details
CESC 0.49 0.34 0.500 0.33 3 Click to see details
PRAD -0.058 0.34 -0.164 0.13 50 Click to see details
UCEC 0.095 0.35 -0.044 0.43 19 Click to see details
COAD -0.142 0.37 -0.595 0.06 8 Click to see details
BRCA 0.029 0.4 0.009 0.47 84 Click to see details
KICH 0.018 0.47 -0.027 0.45 25 Click to see details
ESCA 0.017 0.48 -0.218 0.26 11 Click to see details
ESCA 0.017 0.48 -0.218 0.26 11 Click to see details
ESCA 0.017 0.48 -0.218 0.26 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1