miRTarBase - #MIRT180909 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPRD2   
Synonyms HSPC099, KIAA0460
Description regulation of nuclear pre-mRNA domain containing 2
Transcript NM_015203   
Putative miRNA Targets on RPRD2
3'UTR of RPRD2
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ::||::  | | ||||||| 
2015 - 2035 147.00 -8.70
             |||  | ||  ||:|||| 
Target 5' ctgAAA--AGTAAATGTTGCTt 3'
1333 - 1352 135.00 -7.50
miRNA  3' guguuuggUAAUAC-ACGACGau 5'
                  :||| | ||||||  
Target 5' gttctgggGTTAGGATGCTGCag 3'
1689 - 1711 130.00 -8.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30107050 9 COSMIC
COSN28781126 10 COSMIC
COSN32065633 11 COSMIC
COSN23013895 29 COSMIC
COSN30193975 33 COSMIC
COSN30119290 68 COSMIC
COSN18725026 108 COSMIC
COSN20090354 252 COSMIC
COSN6002464 424 COSMIC
COSN22276932 513 COSMIC
COSN29315190 561 COSMIC
COSN7465834 597 COSMIC
COSN17296783 821 COSMIC
COSN31778145 1188 COSMIC
COSN31778097 1189 COSMIC
COSN32057201 1415 COSMIC
COSN29915944 1648 COSMIC
COSN32056029 1683 COSMIC
COSN4900753 1971 COSMIC
COSN28970901 1973 COSMIC
COSN31778121 2142 COSMIC
COSN26563434 2169 COSMIC
COSN8319665 2179 COSMIC
COSN28640724 2236 COSMIC
COSN8636168 2236 COSMIC
COSN26572579 2251 COSMIC
COSN20095345 2564 COSMIC
COSN6002465 2624 COSMIC
COSN20095346 2646 COSMIC
COSN5865546 2659 COSMIC
COSN5731700 2879 COSMIC
COSN28201787 2977 COSMIC
COSN16719146 2998 COSMIC
COSN1089202 3149 COSMIC
rs12040949 1653 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs587687687 4 dbSNP
rs1309508681 5 dbSNP
rs16837095 8 dbSNP
rs7002 10 dbSNP
rs1486412000 14 dbSNP
rs753279422 16 dbSNP
rs866941824 19 dbSNP
rs367784870 20 dbSNP
rs145871523 33 dbSNP
rs1191730658 34 dbSNP
rs778667656 35 dbSNP
rs963413600 37 dbSNP
rs769378790 43 dbSNP
rs766209438 50 dbSNP
rs1271979190 59 dbSNP
rs961461358 64 dbSNP
rs1308480413 67 dbSNP
rs920115614 70 dbSNP
rs974130900 70 dbSNP
rs1229823324 71 dbSNP
rs1249848840 72 dbSNP
rs1290453456 73 dbSNP
rs1438953359 76 dbSNP
rs587636549 81 dbSNP
rs932800336 86 dbSNP
rs985766795 90 dbSNP
rs1259516894 92 dbSNP
rs587709927 96 dbSNP
rs587596238 97 dbSNP
rs1219541240 98 dbSNP
rs944266560 98 dbSNP
rs748861465 101 dbSNP
rs112042154 102 dbSNP
rs1181034232 107 dbSNP
rs1262115548 108 dbSNP
rs1430102168 109 dbSNP
rs992304541 110 dbSNP
rs587649430 112 dbSNP
rs587712886 117 dbSNP
rs1308055059 122 dbSNP
rs1461687304 123 dbSNP
rs1299528000 131 dbSNP
rs587631700 142 dbSNP
rs143871570 151 dbSNP
rs1175034875 152 dbSNP
rs187900262 157 dbSNP
rs1388553209 158 dbSNP
rs934427313 158 dbSNP
rs1297734611 166 dbSNP
rs1302798808 170 dbSNP
rs587617212 171 dbSNP
rs1054112669 176 dbSNP
rs1384283636 185 dbSNP
rs1293701239 188 dbSNP
rs1454115073 190 dbSNP
rs1364811909 192 dbSNP
rs746107027 195 dbSNP
rs587676200 197 dbSNP
rs775719631 198 dbSNP
rs1345854305 199 dbSNP
rs1247777279 203 dbSNP
rs1194789884 215 dbSNP
rs931357258 219 dbSNP
rs1208401230 221 dbSNP
rs1346922367 221 dbSNP
rs1261250116 222 dbSNP
rs61819382 222 dbSNP
rs1180378838 223 dbSNP
rs1202037701 223 dbSNP
rs1208603850 223 dbSNP
rs1239794292 223 dbSNP
rs1253835636 223 dbSNP
rs1260380779 223 dbSNP
rs1280768312 223 dbSNP
rs1348730762 223 dbSNP
rs1350969160 223 dbSNP
rs1419175614 223 dbSNP
rs1485333132 223 dbSNP
rs61486244 223 dbSNP
rs774191644 223 dbSNP
rs918094080 224 dbSNP
rs1184630305 225 dbSNP
rs1247016225 228 dbSNP
rs77520158 229 dbSNP
rs1356721400 235 dbSNP
rs1414679498 235 dbSNP
rs1454479930 237 dbSNP
rs1336552630 239 dbSNP
rs1399325794 240 dbSNP
rs1195147620 241 dbSNP
rs1382250451 241 dbSNP
rs1392671516 242 dbSNP
rs1013156729 243 dbSNP
rs1413424127 244 dbSNP
rs1185238995 245 dbSNP
rs76993680 245 dbSNP
rs1258147743 246 dbSNP
rs1474838678 246 dbSNP
rs1173169334 247 dbSNP
rs1445093719 247 dbSNP
rs1205906191 248 dbSNP
rs1404526689 248 dbSNP
rs1346382095 249 dbSNP
rs1048389763 252 dbSNP
rs1271334289 252 dbSNP
rs945448537 253 dbSNP
rs1455664478 256 dbSNP
rs1286481707 257 dbSNP
rs1336015899 257 dbSNP
rs45595332 258 dbSNP
rs1364694379 260 dbSNP
rs1441863033 261 dbSNP
rs1319452609 262 dbSNP
rs1305924838 266 dbSNP
rs1368799803 267 dbSNP
rs1218721787 268 dbSNP
rs755932157 268 dbSNP
rs1435349348 273 dbSNP
rs1390472173 274 dbSNP
rs1162095224 281 dbSNP
rs1460481195 282 dbSNP
rs6656322 287 dbSNP
rs1414383248 292 dbSNP
rs1248910272 293 dbSNP
rs1164959170 305 dbSNP
rs907116706 310 dbSNP
rs1241279433 312 dbSNP
rs925308027 319 dbSNP
rs1307613049 322 dbSNP
rs587730032 330 dbSNP
rs1466417809 336 dbSNP
rs1251377251 338 dbSNP
rs936694024 344 dbSNP
rs587615885 346 dbSNP
rs1292169441 347 dbSNP
rs1038907278 366 dbSNP
rs961350799 367 dbSNP
rs1267305301 377 dbSNP
rs900403563 382 dbSNP
rs933251963 386 dbSNP
rs1366848944 391 dbSNP
rs1323512762 402 dbSNP
rs1439473363 405 dbSNP
rs1349919405 406 dbSNP
rs1051512227 408 dbSNP
rs1250759106 410 dbSNP
rs587691197 421 dbSNP
rs1177342206 422 dbSNP
rs1409327771 423 dbSNP
rs1027477645 425 dbSNP
rs1393450901 428 dbSNP
rs886273367 432 dbSNP
rs1004633971 439 dbSNP
rs1388296548 445 dbSNP
rs767448665 446 dbSNP
rs1462302825 454 dbSNP
rs898819240 457 dbSNP
rs772906260 458 dbSNP
rs587731073 459 dbSNP
rs966029873 462 dbSNP
rs1392639529 474 dbSNP
rs1435827273 476 dbSNP
rs587630425 478 dbSNP
rs1375401433 481 dbSNP
rs112722056 483 dbSNP
rs765723119 486 dbSNP
rs1287664740 487 dbSNP
rs1353796384 498 dbSNP
rs760497023 500 dbSNP
rs1431358740 501 dbSNP
rs1234981122 506 dbSNP
rs992420559 508 dbSNP
rs1373371433 514 dbSNP
rs1270872521 518 dbSNP
rs1433979870 520 dbSNP
rs1450734232 524 dbSNP
rs61410121 529 dbSNP
rs1175500911 530 dbSNP
rs1025103906 532 dbSNP
rs1054165890 537 dbSNP
rs1253120784 555 dbSNP
rs587763814 557 dbSNP
rs747950563 572 dbSNP
rs967322659 574 dbSNP
rs1211343901 576 dbSNP
rs978186049 576 dbSNP
rs1312341872 580 dbSNP
rs1280311712 597 dbSNP
rs1221525006 603 dbSNP
rs1372020257 605 dbSNP
rs948457827 620 dbSNP
rs1044628493 622 dbSNP
rs925380621 626 dbSNP
rs1234078446 631 dbSNP
rs1478577607 633 dbSNP
rs907007302 633 dbSNP
rs587638551 639 dbSNP
rs1466370390 641 dbSNP
rs1002815234 642 dbSNP
rs1157232165 644 dbSNP
rs759618422 644 dbSNP
rs1412774142 648 dbSNP
rs1161541740 664 dbSNP
rs1474512152 671 dbSNP
rs1257441102 679 dbSNP
rs936774543 689 dbSNP
rs974685395 694 dbSNP
rs1484456636 698 dbSNP
rs1475735170 708 dbSNP
rs587694266 712 dbSNP
rs1213173120 719 dbSNP
rs1411866802 721 dbSNP
rs1328121997 725 dbSNP
rs995506314 728 dbSNP
rs1405030040 737 dbSNP
rs1026949608 739 dbSNP
rs954280127 742 dbSNP
rs921943929 746 dbSNP
rs1381025459 781 dbSNP
rs587752678 788 dbSNP
rs1430268632 790 dbSNP
rs587656603 791 dbSNP
rs1322562697 792 dbSNP
rs1459956724 793 dbSNP
rs1307337270 799 dbSNP
rs1356079138 801 dbSNP
rs587707918 806 dbSNP
rs886265831 810 dbSNP
rs1426117484 820 dbSNP
rs1417796650 821 dbSNP
rs1291256412 824 dbSNP
rs1006950150 827 dbSNP
rs374138115 840 dbSNP
rs1248271750 843 dbSNP
rs1355421567 846 dbSNP
rs1214742818 852 dbSNP
rs940548698 856 dbSNP
rs1323495884 861 dbSNP
rs1037437608 862 dbSNP
rs965497455 863 dbSNP
rs12758270 864 dbSNP
rs1001300172 865 dbSNP
rs1322835752 866 dbSNP
rs752821704 874 dbSNP
rs1486312122 876 dbSNP
rs879881198 877 dbSNP
rs1294245777 897 dbSNP
rs1190477621 899 dbSNP
rs1353274370 900 dbSNP
rs1236045373 901 dbSNP
rs1170116072 902 dbSNP
rs191863913 921 dbSNP
rs895488618 925 dbSNP
rs1390358263 926 dbSNP
rs587742059 929 dbSNP
rs914208745 932 dbSNP
rs1452236401 942 dbSNP
rs1266034695 945 dbSNP
rs1472683116 963 dbSNP
rs1421738433 965 dbSNP
rs1013845447 968 dbSNP
rs587622867 975 dbSNP
rs1422003768 987 dbSNP
rs587617261 988 dbSNP
rs1159399232 989 dbSNP
rs1204121827 994 dbSNP
rs771860223 1003 dbSNP
rs1025684942 1004 dbSNP
rs1232341910 1006 dbSNP
rs587671760 1008 dbSNP
rs1375961556 1017 dbSNP
rs1301986327 1026 dbSNP
rs1436465908 1027 dbSNP
rs928488012 1031 dbSNP
rs1371746610 1034 dbSNP
rs1307992447 1040 dbSNP
rs1339586706 1041 dbSNP
rs148182059 1044 dbSNP
rs1271563150 1051 dbSNP
rs1032523352 1052 dbSNP
rs958079784 1063 dbSNP
rs897078332 1064 dbSNP
rs145899107 1065 dbSNP
rs1248280365 1072 dbSNP
rs1048889333 1073 dbSNP
rs752734124 1073 dbSNP
rs1483370042 1081 dbSNP
rs1213584603 1082 dbSNP
rs974800078 1089 dbSNP
rs1276497467 1094 dbSNP
rs1208470240 1103 dbSNP
rs1277125578 1117 dbSNP
rs140509417 1121 dbSNP
rs200068502 1123 dbSNP
rs1007407183 1128 dbSNP
rs587595996 1132 dbSNP
rs1235460120 1135 dbSNP
rs1194416194 1142 dbSNP
rs1287860496 1154 dbSNP
rs1410957202 1160 dbSNP
rs777090466 1161 dbSNP
rs1352932564 1164 dbSNP
rs770455503 1166 dbSNP
rs921934204 1167 dbSNP
rs1244040978 1169 dbSNP
rs1400994854 1170 dbSNP
rs954743163 1175 dbSNP
rs1332720153 1182 dbSNP
rs587673894 1190 dbSNP
rs765424803 1196 dbSNP
rs1157850480 1208 dbSNP
rs1472839042 1209 dbSNP
rs1031088991 1222 dbSNP
rs1185467670 1227 dbSNP
rs182900132 1231 dbSNP
rs1441663235 1232 dbSNP
rs187541513 1234 dbSNP
rs1256639840 1239 dbSNP
rs587732713 1242 dbSNP
rs989719580 1255 dbSNP
rs1267577046 1258 dbSNP
rs752781138 1259 dbSNP
rs969738099 1269 dbSNP
rs980293428 1277 dbSNP
rs928367120 1281 dbSNP
rs1436941955 1282 dbSNP
rs1037911285 1286 dbSNP
rs920436029 1289 dbSNP
rs1397405152 1291 dbSNP
rs1386086145 1292 dbSNP
rs1319233386 1294 dbSNP
rs1457331708 1300 dbSNP
rs938374051 1301 dbSNP
rs972570318 1301 dbSNP
rs370851316 1311 dbSNP
rs1401058168 1312 dbSNP
rs1161360091 1315 dbSNP
rs1320099636 1319 dbSNP
rs1368814040 1321 dbSNP
rs918396854 1324 dbSNP
rs587620486 1336 dbSNP
rs937036391 1341 dbSNP
rs1247661286 1342 dbSNP
rs1209390060 1344 dbSNP
rs1466335514 1347 dbSNP
rs1271395873 1353 dbSNP
rs1055593955 1359 dbSNP
rs1286318151 1361 dbSNP
rs1303720554 1361 dbSNP
rs80136909 1362 dbSNP
rs895478785 1370 dbSNP
rs1362518543 1372 dbSNP
rs1296454321 1375 dbSNP
rs1372457929 1377 dbSNP
rs1230522069 1378 dbSNP
rs1321075241 1379 dbSNP
rs1273569497 1381 dbSNP
rs1404687672 1382 dbSNP
rs1344985815 1384 dbSNP
rs889815844 1385 dbSNP
rs1447462758 1391 dbSNP
rs942710723 1397 dbSNP
rs1206059379 1400 dbSNP
rs1189423719 1431 dbSNP
rs1286736470 1434 dbSNP
rs587624533 1451 dbSNP
rs7411534 1460 dbSNP
rs999532971 1465 dbSNP
rs1452626640 1470 dbSNP
rs1292668753 1475 dbSNP
rs587740817 1475 dbSNP
rs1194395900 1476 dbSNP
rs1455636338 1481 dbSNP
rs1341856550 1484 dbSNP
rs1275858260 1501 dbSNP
rs1041399065 1502 dbSNP
rs1366995925 1508 dbSNP
rs1376973766 1509 dbSNP
rs893952978 1520 dbSNP
rs587621903 1526 dbSNP
rs999788289 1534 dbSNP
rs1032883778 1535 dbSNP
rs958238441 1548 dbSNP
rs1427790264 1554 dbSNP
rs996208784 1558 dbSNP
rs587697229 1568 dbSNP
rs193010881 1579 dbSNP
rs954692288 1583 dbSNP
rs1431858833 1586 dbSNP
rs1423331288 1588 dbSNP
rs12042229 1589 dbSNP
rs907884633 1601 dbSNP
rs1248567455 1604 dbSNP
rs1396298132 1604 dbSNP
rs1180619762 1608 dbSNP
rs962237794 1610 dbSNP
rs1275790535 1615 dbSNP
rs1207741137 1618 dbSNP
rs1384547221 1623 dbSNP
rs1276096654 1628 dbSNP
rs1035319693 1632 dbSNP
rs1218093060 1632 dbSNP
rs1276160963 1646 dbSNP
rs1407908368 1646 dbSNP
rs141156871 1649 dbSNP
rs12040949 1653 dbSNP
rs1175587912 1654 dbSNP
rs1240332895 1656 dbSNP
rs1427336041 1662 dbSNP
rs931150679 1666 dbSNP
rs587664082 1670 dbSNP
rs984480418 1671 dbSNP
rs1184720777 1680 dbSNP
rs911140055 1681 dbSNP
rs1327430397 1682 dbSNP
rs587744070 1683 dbSNP
rs1055541719 1686 dbSNP
rs1041032794 1688 dbSNP
rs1264456071 1694 dbSNP
rs901153157 1699 dbSNP
rs935436654 1701 dbSNP
rs916976184 1705 dbSNP
rs1230194133 1707 dbSNP
rs1052452532 1710 dbSNP
rs1274023146 1720 dbSNP
rs949840470 1723 dbSNP
rs1208104361 1729 dbSNP
rs1266709556 1745 dbSNP
rs1011072060 1749 dbSNP
rs1413294121 1751 dbSNP
rs1024183766 1754 dbSNP
rs1422638503 1757 dbSNP
rs587774348 1761 dbSNP
rs1438487498 1766 dbSNP
rs1004173134 1768 dbSNP
rs587640155 1769 dbSNP
rs61819384 1779 dbSNP
rs1249614128 1784 dbSNP
rs1206229266 1786 dbSNP
rs1472135368 1787 dbSNP
rs1041741364 1788 dbSNP
rs1268264924 1790 dbSNP
rs1217846759 1799 dbSNP
rs959674186 1806 dbSNP
rs748951500 1811 dbSNP
rs993950028 1823 dbSNP
rs768232614 1824 dbSNP
rs1385197681 1829 dbSNP
rs952694696 1835 dbSNP
rs1434701744 1836 dbSNP
rs983975007 1838 dbSNP
rs935578569 1839 dbSNP
rs1053998117 1842 dbSNP
rs1456840297 1843 dbSNP
rs1358132464 1847 dbSNP
rs1165858770 1849 dbSNP
rs78610677 1849 dbSNP
rs1425950445 1853 dbSNP
rs1386667358 1854 dbSNP
rs1162310024 1856 dbSNP
rs1186253969 1857 dbSNP
rs772070545 1859 dbSNP
rs1448559499 1861 dbSNP
rs1248101902 1866 dbSNP
rs1396523092 1867 dbSNP
rs996323834 1867 dbSNP
rs1029136353 1871 dbSNP
rs1310379119 1873 dbSNP
rs976616211 1874 dbSNP
rs1221974551 1878 dbSNP
rs1272275037 1880 dbSNP
rs1227933436 1882 dbSNP
rs868286401 1889 dbSNP
rs1409573387 1890 dbSNP
rs1008992839 1894 dbSNP
rs1294328817 1894 dbSNP
rs935326884 1895 dbSNP
rs1052508367 1897 dbSNP
rs778441669 1898 dbSNP
rs1294663962 1899 dbSNP
rs1459940714 1908 dbSNP
rs962110337 1917 dbSNP
rs1242816396 1919 dbSNP
rs946756438 1925 dbSNP
rs1045247802 1926 dbSNP
rs973722421 1940 dbSNP
rs587598841 1943 dbSNP
rs1003818720 1963 dbSNP
rs1490837496 1963 dbSNP
rs201235561 1963 dbSNP
rs35529963 1963 dbSNP
rs1207454622 1964 dbSNP
rs1343068759 1974 dbSNP
rs1181613258 1982 dbSNP
rs1253322170 1993 dbSNP
rs1231112409 2004 dbSNP
rs1249503332 2011 dbSNP
rs1056714681 2013 dbSNP
rs1482711816 2017 dbSNP
rs1349181639 2018 dbSNP
rs895519984 2029 dbSNP
rs1410848341 2036 dbSNP
rs115369351 2039 dbSNP
rs1421853083 2043 dbSNP
rs991290351 2053 dbSNP
rs1464277294 2056 dbSNP
rs952503977 2061 dbSNP
rs917094080 2078 dbSNP
rs949798206 2097 dbSNP
rs1018125962 2103 dbSNP
rs1409682378 2113 dbSNP
rs1181127804 2119 dbSNP
rs587705990 2121 dbSNP
rs964202662 2124 dbSNP
rs977237126 2133 dbSNP
rs1463055722 2134 dbSNP
rs924263805 2141 dbSNP
rs1369211584 2142 dbSNP
rs1429628699 2143 dbSNP
rs1327637111 2145 dbSNP
rs1314044349 2157 dbSNP
rs1229588244 2178 dbSNP
rs1332677308 2189 dbSNP
rs935708638 2189 dbSNP
rs1393928501 2190 dbSNP
rs1401065223 2196 dbSNP
rs1336755087 2201 dbSNP
rs373776254 2205 dbSNP
rs922520293 2206 dbSNP
rs6587754 2210 dbSNP
rs894038750 2213 dbSNP
rs1365318432 2215 dbSNP
rs1394658449 2218 dbSNP
rs1423404572 2229 dbSNP
rs1257152406 2236 dbSNP
rs773173675 2237 dbSNP
rs915196989 2243 dbSNP
rs1463573690 2244 dbSNP
rs1267638973 2247 dbSNP
rs932250337 2248 dbSNP
rs1312262581 2253 dbSNP
rs1327298214 2263 dbSNP
rs1353557969 2275 dbSNP
rs183969184 2276 dbSNP
rs1230661830 2277 dbSNP
rs1045536077 2283 dbSNP
rs1315349591 2283 dbSNP
rs1454285188 2285 dbSNP
rs1385783702 2292 dbSNP
rs1319379721 2293 dbSNP
rs1050520811 2311 dbSNP
rs1272525270 2313 dbSNP
rs890635754 2319 dbSNP
rs1161191800 2320 dbSNP
rs1457242221 2321 dbSNP
rs762595746 2323 dbSNP
rs1185628216 2324 dbSNP
rs764636591 2324 dbSNP
rs1247488972 2325 dbSNP
rs587747286 2329 dbSNP
rs1341575188 2331 dbSNP
rs939495100 2341 dbSNP
rs1441819160 2347 dbSNP
rs1009387535 2348 dbSNP
rs760456914 2352 dbSNP
rs1209575030 2355 dbSNP
rs1056775591 2367 dbSNP
rs898084247 2374 dbSNP
rs1211439755 2377 dbSNP
rs186867607 2380 dbSNP
rs1296151928 2383 dbSNP
rs1430851313 2387 dbSNP
rs771226972 2399 dbSNP
rs1328086864 2409 dbSNP
rs1482153329 2409 dbSNP
rs1046741370 2415 dbSNP
rs1365946901 2416 dbSNP
rs111855989 2421 dbSNP
rs994865890 2430 dbSNP
rs1261965939 2435 dbSNP
rs1450983516 2437 dbSNP
rs776513654 2444 dbSNP
rs1245098843 2445 dbSNP
rs958574954 2448 dbSNP
rs1388958663 2466 dbSNP
rs991414669 2480 dbSNP
rs759865574 2482 dbSNP
rs759653655 2483 dbSNP
rs997977025 2487 dbSNP
rs765503368 2493 dbSNP
rs1340828506 2503 dbSNP
rs1272626838 2511 dbSNP
rs956634687 2516 dbSNP
rs977557461 2517 dbSNP
rs1127211 2518 dbSNP
rs1407794701 2520 dbSNP
rs968438361 2528 dbSNP
rs587701911 2532 dbSNP
rs1411915088 2534 dbSNP
rs935763241 2536 dbSNP
rs1423140212 2537 dbSNP
rs1172136075 2538 dbSNP
rs374429502 2538 dbSNP
rs926700665 2553 dbSNP
rs1432110749 2554 dbSNP
rs1437488580 2555 dbSNP
rs939380464 2559 dbSNP
rs1233862600 2560 dbSNP
rs1204756844 2561 dbSNP
rs144974315 2561 dbSNP
rs35083786 2561 dbSNP
rs192118072 2562 dbSNP
rs760747895 2573 dbSNP
rs1235207371 2576 dbSNP
rs1324131927 2581 dbSNP
rs1285153333 2588 dbSNP
rs1303296394 2588 dbSNP
rs989750902 2590 dbSNP
rs929564452 2598 dbSNP
rs920931398 2602 dbSNP
rs184242753 2606 dbSNP
rs1444635558 2608 dbSNP
rs1357655351 2609 dbSNP
rs189390739 2616 dbSNP
rs912043377 2624 dbSNP
rs1408440478 2627 dbSNP
rs147054931 2640 dbSNP
rs1472582414 2643 dbSNP
rs1039331766 2646 dbSNP
rs944913765 2650 dbSNP
rs750632193 2660 dbSNP
rs899599320 2666 dbSNP
rs372805678 2680 dbSNP
rs897888784 2681 dbSNP
rs587641660 2684 dbSNP
rs761686016 2687 dbSNP
rs1264516643 2713 dbSNP
rs1427831476 2715 dbSNP
rs1029469238 2717 dbSNP
rs1316339261 2719 dbSNP
rs1307360784 2723 dbSNP
rs1431904904 2729 dbSNP
rs764574114 2731 dbSNP
rs892279958 2737 dbSNP
rs1364685386 2739 dbSNP
rs1283781484 2745 dbSNP
rs1009513731 2748 dbSNP
rs1385066241 2750 dbSNP
rs1049058251 2757 dbSNP
rs1459163848 2759 dbSNP
rs1161673587 2765 dbSNP
rs1403984856 2770 dbSNP
rs1413578156 2770 dbSNP
rs1022623542 2773 dbSNP
rs1318785477 2778 dbSNP
rs587705089 2783 dbSNP
rs1244443779 2786 dbSNP
rs1441697880 2789 dbSNP
rs587763485 2797 dbSNP
rs894516037 2798 dbSNP
rs1261269888 2811 dbSNP
rs1217911036 2817 dbSNP
rs1319673623 2821 dbSNP
rs1290835977 2837 dbSNP
rs1246983919 2838 dbSNP
rs867201953 2848 dbSNP
rs968118037 2854 dbSNP
rs1365618429 2856 dbSNP
rs1434495343 2857 dbSNP
rs36020363 2857 dbSNP
rs1363225539 2860 dbSNP
rs1291114151 2861 dbSNP
rs1024250532 2866 dbSNP
rs1033652852 2872 dbSNP
rs13057 2879 dbSNP
rs1330864244 2881 dbSNP
rs998670574 2892 dbSNP
rs1031940795 2894 dbSNP
rs12141218 2898 dbSNP
rs1166126256 2902 dbSNP
rs1427372851 2919 dbSNP
rs989865511 2921 dbSNP
rs1188185188 2927 dbSNP
rs920920108 2936 dbSNP
rs919450851 2937 dbSNP
rs929446889 2943 dbSNP
rs750293569 2956 dbSNP
rs1043293 2957 dbSNP
rs1487882600 2963 dbSNP
rs751163639 2965 dbSNP
rs1191058707 2969 dbSNP
rs1253255396 2973 dbSNP
rs1473771209 2976 dbSNP
rs943598828 2977 dbSNP
rs746984210 2984 dbSNP
rs944963765 2985 dbSNP
rs1406133517 2988 dbSNP
rs1039789304 2990 dbSNP
rs1036495246 2994 dbSNP
rs587706271 3000 dbSNP
rs1167205428 3013 dbSNP
rs933764978 3014 dbSNP
rs1431311072 3016 dbSNP
rs1050787638 3017 dbSNP
rs1199830425 3018 dbSNP
rs892332107 3027 dbSNP
rs587606687 3028 dbSNP
rs1352323015 3042 dbSNP
rs1195431449 3044 dbSNP
rs930708349 3054 dbSNP
rs1043529597 3062 dbSNP
rs1323394482 3062 dbSNP
rs903779235 3062 dbSNP
rs1287441251 3063 dbSNP
rs1225937345 3078 dbSNP
rs1306816279 3078 dbSNP
rs879144259 3078 dbSNP
rs759150713 3079 dbSNP
rs1396782877 3080 dbSNP
rs1299336872 3081 dbSNP
rs1012951461 3082 dbSNP
rs1229618065 3083 dbSNP
rs1287306114 3084 dbSNP
rs770398284 3085 dbSNP
rs1177044336 3086 dbSNP
rs587667573 3087 dbSNP
rs960679929 3091 dbSNP
rs1013707614 3094 dbSNP
rs1026393954 3097 dbSNP
rs907094293 3104 dbSNP
rs747697939 3105 dbSNP
rs999180217 3106 dbSNP
rs1460907712 3108 dbSNP
rs866720283 3122 dbSNP
rs1263891514 3126 dbSNP
rs771609761 3128 dbSNP
rs1275941505 3134 dbSNP
rs777632206 3135 dbSNP
rs1335938347 3141 dbSNP
rs142336167 3141 dbSNP
rs1450075581 3147 dbSNP
rs1381386018 3151 dbSNP
rs776233954 3156 dbSNP
rs1011276384 3157 dbSNP
rs1251489201 3158 dbSNP
rs746984780 3161 dbSNP
rs1454151536 3173 dbSNP
rs1365368394 3177 dbSNP
rs1185670305 3202 dbSNP
rs975003428 3208 dbSNP
rs193071728 3209 dbSNP
rs1411982279 3211 dbSNP
rs1404828404 3228 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8 PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000539519.1 | 3UTR | AAUGUGAAUUCUCUUUGCUGCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000539519.1 | 3UTR | AAUAAAAGAAUGUGAAUUCUCUUUGCUGCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUUGUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000539519.1 | 3UTR | AAUUCUCUUUGCUGCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.295 1.4e-3 0.303 1.1e-3 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.606 2.3e-3 -0.684 4.4e-4 20 Click to see details
GSE21032 Prostate cancer 0.303 2.7e-3 0.191 4.2e-2 83 Click to see details
GSE19783 ER- ER- breast cancer 0.31 2.7e-3 0.335 1.3e-3 79 Click to see details
GSE38226 Liver fibrosis 0.511 9.0e-3 0.325 7.5e-2 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.445 1.7e-2 0.326 6.4e-2 23 Click to see details
GSE21687 Ependynoma primary tumors 0.264 1.8e-2 0.197 5.9e-2 64 Click to see details
GSE27834 Pluripotent stem cells -0.438 4.5e-2 -0.482 2.9e-2 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.307 6.8e-2 -0.363 3.7e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.305 7.4e-2 -0.241 1.3e-1 24 Click to see details
GSE17498 Multiple myeloma 0.222 8.4e-2 0.371 9.2e-3 40 Click to see details
GSE19350 CNS germ cell tumors 0.301 1.7e-1 0.140 3.3e-1 12 Click to see details
GSE28544 Breast cancer -0.145 2.5e-1 -0.439 1.6e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.198 2.6e-1 -0.225 2.3e-1 13 Click to see details
GSE17306 Multiple myeloma -0.093 2.6e-1 0.006 4.8e-1 49 Click to see details
GSE21849 B cell lymphoma -0.05 4.0e-1 -0.184 1.7e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.022 4.5e-1 0.066 3.6e-1 32 Click to see details
GSE14794 Lymphoblastoid cells 0.005 4.8e-1 0.003 4.9e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.009 4.8e-1 0.058 3.9e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.006 4.9e-1 0.068 3.9e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.006 4.9e-1 0.068 3.9e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.562 0 -0.624 0 32 Click to see details
BLCA -0.474 0.02 -0.416 0.04 18 Click to see details
KIRP -0.353 0.02 -0.306 0.04 32 Click to see details
THCA 0.225 0.04 0.177 0.09 59 Click to see details
KICH -0.327 0.06 -0.135 0.26 25 Click to see details
PAAD 0.83 0.09 1.000 0.5 4 Click to see details
LUSC 0.186 0.13 0.204 0.11 38 Click to see details
COAD 0.345 0.2 0.429 0.14 8 Click to see details
PRAD 0.096 0.25 0.054 0.35 50 Click to see details
ESCA -0.2 0.28 -0.036 0.46 11 Click to see details
BRCA -0.051 0.32 -0.057 0.3 84 Click to see details
LIHC 0.059 0.34 0.094 0.26 49 Click to see details
PCPG -0.388 0.37 -0.500 0.33 3 Click to see details
CESC 0.381 0.38 0.500 0.33 3 Click to see details
HNSC -0.049 0.38 -0.072 0.33 42 Click to see details
CHOL 0.04 0.46 0.117 0.38 9 Click to see details
KIRC 0.012 0.46 0.009 0.47 68 Click to see details
LUAD 0.005 0.49 -0.007 0.49 12 Click to see details
UCEC -0.001 0.5 0.005 0.49 19 Click to see details
UCEC -0.001 0.5 0.005 0.49 19 Click to see details
UCEC -0.001 0.5 0.005 0.49 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1