miRTarBase - #MIRT191454 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PPM1A   
Synonyms PP2C-ALPHA, PP2CA, PP2Calpha
Description protein phosphatase, Mg2+/Mn2+ dependent 1A
Transcript NM_021003   
Other Transcripts NM_177951 , NM_177952   
Expression
Putative miRNA Targets on PPM1A
3'UTR of PPM1A
(miRNA target sites are highlighted)
>PPM1A|NM_021003|3'UTR
   1 AACTGCTCATCTAGCCATGGAGTTTACCTTCACCTCCAAAGGAGAGTACAGCTCAACTTTGTTGAAACTTTTAACATCCA
  81 TCCTCAACTTTAAGGAAGGGGATATGACATGGGTGAGAATGATTACATCAGAGAACTTCAGCAGTACAACAGCTAGCCCA
 161 GAACTGATTTTTTTTTTTTTTTTTGTAAATTTGAGACTTATGTAAGCGTGATTTCAAACCATAATTCGTGTTGTAAATCA
 241 GACTCCAGCAATTTTTGTTGTATGATTTTGTTTTTTTGTAAAGTGTAATTGTCCTTGTACAAAATGCTCATATTTAATTA
 321 TGAACTGCTTTAAATCACTATCAAAGTTACAAGAAATGTTTGGCTTATTGTGTGATGCAACAGATATATAGCCCTTTCAA
 401 GTCATGTTGTGTTTGGACTTGGGGTTGGAACAGGGAGAGCAGCAGCCATGTCAGCTACACGCTCAAATGTGCAGATGATT
 481 ATGGAAAATAACCTCAAAATCTTACAAAGCTGAACATCCAAGGAGTTATTGAAAACTATCTTAAATGTTCTTGGTAGGGG
 561 AGTTGGCATTGTTGATAAAGCCAGTCCCTTCATTTAACTGTCTTTCAGGATGTTCCTTCGTTGTTTCCATGAGTATTGCA
 641 GGTAATAATACAGTGTATTCATAAGAATCTCAATCTTGGGGCTAAATGCCTTGTTTCTTTGCACCTCTTTTCAAGTCCTT
 721 ACATTTAATTACTAATTGATAAGCAGCAGCTTCCTACATATAGTAGGAAACTGCCACATTTTTGCTATCATGATTGGCTG
 801 GGCCTGCTGCTGTTCCTAGTAAGATATTCTGAATTCCATTTTATCAATAAAGCTTGATTTAACAAACAAGAAACTTAATC
 881 ATGTATGTGTAATTCCTCTTTTACCCTGGCCTTTTAAAACACTGTGCCGTTGTAATGAGACGTTTCTCATAGGGAAAGAT
 961 GTTAGTCTCTTTTAATTGGACAACACTGTCACTCAAGGCATAGATGAAACTTTCCTTCCATTAGAAAGACTAAAAGATTT
1041 AATTCTTGGTTGTACCTTAATCTATTTTTTAAATAGGTTTCTTTCAGGCTGCTTATTTTTCATTAAGATGTGTATCAGCT
1121 TGGATTTGCCTACTGTTTAATTAAAATATTTATTGTCAAAGTTTGACAATCTAACACTCTATGGTAGGGGTGTGTGTGTG
1201 TGTGTTTGTGAGTGTGTGTTTGCCTGTGATTTTTAATTGGCCCATGTCTTTAGAATCCAAGTGGTTAAGATGTATTTGTG
1281 ATTTGAAATATAGCATGTTGATAATATTTAGCTGTTGGCCTTTACAAATAACTTTCAAAGCTTAAGGAATTGTAGATATA
1361 AAAATAACCTAATTTAATTTAGGCTTAAATTCCTCTGATTAAGCATGTGAAAGTAAGTTTTAAAATCTGTCGCATTGAAA
1441 AGATTACTGTTCCGTGCCCTTCTGTATTTTTGTCTCTTTAGGTTGAATATTGTATTTATCACCATGTAATCATTCAGTAG
1521 GCAGATTCCCACTAGAAAACTGTTGAAATGTAAGACTAAAATACAACATTGAATACAAAATCAAAATTTTGTGTATAAAA
1601 ACCAGTATAGTCCATTTTGTTATATTTGTTTTTTCCCTAACTTGGAAATATACATATTTGTATATATAGCCTTAAAATTA
1681 ATGTAAAGTTAGGGGAGTAGTGGGGAAAGTAATGTGAAATGTCTCAGATTTAAGTAGTTAAATACCAGCAAAATCTTTTC
1761 ATTATCCCTCTTATTTTGTGAGGTGATTAAATGTAACTTAATTGTATTTAATTTATATCTTATTCCAGCATGAATGAGGA
1841 AAAACTGAAGTACTATTTATATTTAGAAATTCATATCAGTTGAAATTACAGAACCAATTCCATACTTACAATAAATACTT
1921 AATGTCTAAATCTGTGGTAGAGTGCGAAGTATGATAATGTTCTAAGTTATGGCTTTGCAAGCATCTAAATGTGCATTTAA
2001 TGAATACCAGTGCTTCTAGTATAGACTAATTACCAGACATACTGGTACTGAAAGCTAAATCCCTATTATAACAAACCAGT
2081 TCCTTAATATTTTAAGTAGACTGACAACTTTAGTTCCAGAAATTGCAAAACTTTGAACTGGACTGTGTAATCTTTTGAGA
2161 TGCAAAACTTAAGTCACAAGTAGAGTATGTGATGGAAAGCTGTATTTCAAACCATAACAGCATATTTAGAGCCTTTTTTT
2241 TTTGAGTCTTTAAACAAGAGAAAATTAAAATATTCCTGTCAAAATTATTAGTATTGAAATTAGGCTTGGACACGAGAGAG
2321 AACCGTATTTGAGTGATGTGAGAAGACTAAATCTTTTCCACATGAGTCAGCACTGCCATACTAATAATTTTTTTACTATA
2401 AAAATACAGGAAGGAAGTATACATTATAACAGCAGACTGTGTGTGTTCCTGATTCCTGGAGGTAATAGTGGGGGGAAACC
2481 AACCATACTTTTTAAAGGCACTTTTGCACCTCTATTGTGCACTTCATTCTTGTACCACTTAAATTCTTCACCCCCATCCC
2561 CTTTTTTTGTGCTAATTAGCATCTCAGGGCAATGCCTCAAAAATGTTTGATGTGTTCTGTTCTTTGGAGGGAAAAAGTTC
2641 TTATGTGATGATAATATAGTACTCAAAATATACTTTTATCATTTAAATGTCTTATTTGCTGCTATGAATAGGAAATAACA
2721 TTTTGTATAGCAGGCTCTGTTTTACCCTAACATTAAAAAATTTCACTGATCTTTCTTTCATTAACAGGGTAGAATCTCCT
2801 AATTTCCACTTTCTTGGGAATATACTTTTATAGACAATAGAAGCAGTTCTCAATATTAGCATATACTTTAAAAAATCAAA
2881 GTGATAACTTAATTCAGCTTTGGAAGTATCTCAAACATATTTTTACTTTATAGTGCATTAACTTGCTTCTAGAGTACTTA
2961 ATGCAACTGCTCTAGCCACTTAATTTTTTATACTAATCTCAACATTAAGAAATTTGGATTAAGTAATAAATTAGTTATGT
3041 AATTCAAGTAATCTGAATTACAGCAGTACTTTTAGTGATCATTCATAGGACTATATATTAACCCAGCTAATAACTCAGTT
3121 TTTTTACAAAATGTTTCGAGTATTATTGGTAAAACACTGTTCTAGGCTAAGCACATTGGGACTGTAAAGAAATGAGTAGA
3201 TCCTTGGCTTCAAGTTTACATCTGGACAATTTATAATCTAGTGTATGTTAGTATTATAACTGGATCACTCATCAAAAAAT
3281 ATATATATATATCTATTGCCCACCTGCTATCTACCAGGTACTTAGCTGATCAAGGCAGGCCCCTGCCCTAAAGACCTTGT
3361 TTATACTTCCTTTACTCACCTGAAAACTGTTCTCCAGTTTATTTTCTTCTCTCTAAAGTTAAAGAGTAATTCAGAAGAAA
3441 ATTTTGCTTAGCATAAGAATAAAATTGGACTGAAGAGGCTTAAGCCCATTCAGTATCCTTGATTGCATTTATCCAACGGC
3521 CTTTATTCTTCCTGCTGACAGCAGTAACTCAGAGGAATAGGTAGTAGATTTCTGAAAATTATCCAGCCATGGAAATGTAG
3601 GTGGGGTTTGAGTTTAAGGCATTTAAAAATGTAAATATCTCTAGCTAAATTTATCTTAAGTAGAACTCTGTGTTTTTGTA
3681 ACACACTGCCAGTGTTAATATCAAATTTTAGCCAAATTATTACTATGTGTTTTAATATTTTAAAATAATTTCACTGCCCA
3761 TCTTTACTGGACAAACTCATTTGGAGTTCAACTTGTGATTTCTGAAAGAACTGATGAAATTGGGTACTGCTTTTTTTCTC
3841 CATTTTTCGTTTTGTTTTAATTTTGAATTTCATGGTATATACTTTTAGTTCAAACTCAGCTGTTTGTACAGTATTGTATT
3921 AGGATTTGGTATTAGAAAAGATGTGTAAATATCTTAGTATATAATTGTTTCTCATTTGAGGTTTTTCTTCTAAGGGACCT
4001 TAAAGAGTTTTATATACTTTTGCTCACAGAAACTGCTGGTGAGATTACCATTTTTTGAGTATCTAGTCTTCTAGTTTTTC
4081 TTTTAGGCATTAGGAAGCCTTCTTTAGAGTTCAAAATTTTAGAAGCCTAATTTGCTCTTACTTCCTTCAATTATGTGCCA
4161 TGTGTTTTGGTTTGTATATGTTTTAAATTGTATATTTCCTTGGAATATGCTTGAAATATTTAAGAATACATTTTCAAAAT
4241 GTATAATACTGTATTGTTTTGTTGATCAGAATAATAAGTCTCAGTTAAATGTTTGTTATTACTGATAGTCAAAATGCTCA
4321 ATAGAAATGATGAGAGGCATTGGTTCCAATTCATTGTCAAATGAACGTTTTCTAATTTTGTTCACAGATTCTTTCCCTTT
4401 CGATTGTTCTGTATGTTAAGATAGTGGCTTCTGCTCTCACTGTTTTCCTATTTATATTACTAGCAGGTAGGAGTGCTAAT
4481 TAGAAAAACTTAGATGGTATTGAAATTACAGTTGACAACTTATATTTTTATGAGATGGAGAAAAAAGATTAAGTTGATAT
4561 AACAACAAAGTGGACTTTTTTTCTTCCTTATCCTGCACGAAATATTGCCCTTGTTTCCTCTACTTTCCTCTTGGTGTTTT
4641 CTCTTTTTTTCAAACAGAAACAGGCCAATTCCATTTTCTTGAGCAAGAAAGCTTAGTGTGTTACTTCATCAAGGCCAGCT
4721 AATACTGTGTTAAACCGGGCTGAAAATGAGAAAACTTGGGAGATGGAGGAATGGGGAAATGGCAGTGGGATAGGTAGGGA
4801 AGGATTACTCTTAATTGTTTTAAAAGCCATAGGAAAGTCTTCCTTGTACGTGGCTGTAAATTTATAAGAACTATTGTGTC
4881 ACATAAACCAACAAGAATGAACCTTTGCTGCTTCAGATAATTTGATTTTTCCAGCAAGGAAATTAATAAGTTACTGATTC
4961 TTCAGCATAGAAACAACTGAGAAGAATTAATGCAATGTTTCTTCACTAGAAAACCCAACCCTTCATTTCTTTTCATTGCT
5041 CCAAAACCCAGTTTTCAACTAATGGTTTTCTCATTAAACTAAATGTTTAGAAAAGTTGTTTAGAGTTTTTCTTTTTCTTT
5121 TACATAGTCCTCCTGATCCAGTATAAGACTATTTAGTAACGTGCATTTGTATGGTACTATCTAAAGTAAGTTAGATTGAT
5201 GTAAGAGATCGGGTAGCTGCGGAACAAAATTAGTTATATCCTAATTAGGTACAGTGAATGACACAAAATCATTTTAGCAA
5281 TGCTTCTTAACCTTTTGGGGTCACAGGCGTTTTGAGACTGATGAATCCTAGGGACTTATTTACCCAGGAAAATGCGTATA
5361 TAACATACATATCTCCCTAAAGTTTACAATATTGTAGTGGTTCATGGGCCCCCTGGTTAAGAGCCCATTCTAAAGTACAA
5441 TAGGGCATCATCCCTTTTCCTGCAAAGCCCAAAAGTATATTTCTAGGGCATGAAAATAACTTGAGTCTATTTTAAGGAAT
5521 TGTTTCACTCTAGAGGTAGATAGGGGACCTGGCTAGAATCTGACATTAAAATATACTTTTTAAAAAATATTATATTTGGG
5601 GTGGGGAAAGTGATTAAAAGGTGAAAAAAAAACATAGTATTCAGAAGTTTTGGAGGTTAATGTCTTTCTCTAAGATTTGC
5681 CACTTTAGAAATTCAACAGAAAAGAGGTAAAACAGAAATGGAATGTATCTGGAACATTTTTGGCCTCCATAGTGCAGATA
5761 TACTATATTAACAAGTAATACATTTATTTACCTGTCAGATCTCCAGGTTTTAAGATTTTGAGCTTTCTAGTATTAGGATT
5841 CATTAAATGTTCAATTCATTTCATATTCTAAGGAATTAGGTTATTTACTTACTAATTCAGGATGTTAAAATAACATCCAA
5921 GTCGGACAACCACCACCAATGCACACAGTTAATGAGATTTCTAAAATATAATAAGTACAATGTAACAAACGTATAGAATT
6001 TTGCATTTGTTGCCAAAATTAGATGTTTAATGACAGCTTATTTAATTCCCATTTGTGGGACTTCTGGAACATAGAAACCA
6081 TTATCTTACCTGGTTATCCCTTGACTAAATAGCATATCTGCAGGAAAATATCTTGTTTGTAGTGATATGCCCCAATAGTG
6161 ATTGATTTCACTCTTGAAATGAGTTATATCACTTAATTTGTATAAATGTTATGAGTGGAGAGACATGTACATGTTAAAAG
6241 CATGTTGCATTATATATTCATTTTTTAAACTCTATAAATGTTAAGAATAATATAATTGCAGAAATATTTTTCTTAAATAC
6321 AATGTGTAACAAAATTCTCCGTAGCAACTCACCCACTTTGCAGTTTATGTGATCCACACTTTTAAAGAAATTCCATAAAT
6401 GTATATTTTGTATTATGTATTATTTCCTGGTCCAAAGAAAATATGTGAATTCAGTTCTAACTTTAAGAATGTACTGTTTG
6481 TTTTCAAGTTCATTGAAAAATTGCATTCAGCCTGCGAATGGTTGCAGATTGTATGTTAGATGAAAAGTAGAAATAATTTC
6561 TAGTTTGGAAAACTGGTGCCACTAAATAAACAGGCAATTACATAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUG-GUAAUACACGACGAu 5'
            :|||: : |||| ||||||| 
Target 5' ttTAAATGTCTTATTTGCTGCTa 3'
2682 - 2704 164.00 -12.60
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ::|||| ||   ||||||| 
Target 5' aaTGAACC-TT---TGCTGCTt 3'
4896 - 4913 152.00 -11.60
3
miRNA  3' guguuUGGUAAU--AC----ACGACGAu 5'
               |: |||:  ||    ||||||| 
Target 5' ctatcATGATTGGCTGGGCCTGCTGCTg 3'
785 - 812 145.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31505535 17 COSMIC
COSN30183620 21 COSMIC
COSN31482540 52 COSMIC
COSN31576245 77 COSMIC
COSN24377703 116 COSMIC
COSN27513958 185 COSMIC
COSN29045239 185 COSMIC
COSN29096329 185 COSMIC
COSN17037870 308 COSMIC
COSN17182118 424 COSMIC
COSN25486808 596 COSMIC
COSN15032007 641 COSMIC
COSN9616340 813 COSMIC
COSN16113530 1107 COSMIC
COSN27992234 1205 COSMIC
COSN9088966 1414 COSMIC
COSN16716453 2134 COSMIC
COSN20111362 3126 COSMIC
COSN24959861 3419 COSMIC
COSN27956399 3838 COSMIC
COSN19491087 3880 COSMIC
COSN23079453 3933 COSMIC
COSN26754970 4004 COSMIC
COSN31539188 4145 COSMIC
COSN31533056 4148 COSMIC
COSN1655736 4227 COSMIC
COSN19118900 4432 COSMIC
COSN17681529 4620 COSMIC
COSN21467797 4711 COSMIC
COSN17272957 5020 COSMIC
COSN9616341 5371 COSMIC
COSN31779047 5477 COSMIC
COSN26422118 5583 COSMIC
COSN27332730 5633 COSMIC
COSN29881263 5657 COSMIC
COSN20092846 6067 COSMIC
COSN19136070 6088 COSMIC
COSN31779031 6516 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs762697559 4 dbSNP
rs1341123938 8 dbSNP
rs917524222 9 dbSNP
rs988464360 12 dbSNP
rs765879902 18 dbSNP
rs775843782 19 dbSNP
rs1044591851 23 dbSNP
rs761013328 29 dbSNP
rs909619087 32 dbSNP
rs1351975818 35 dbSNP
rs1437461988 37 dbSNP
rs1203587985 38 dbSNP
rs764627539 40 dbSNP
rs182653798 45 dbSNP
rs757656654 46 dbSNP
rs765390281 47 dbSNP
rs750406687 48 dbSNP
rs943631746 50 dbSNP
rs758662067 52 dbSNP
rs1435302023 58 dbSNP
rs1268972821 60 dbSNP
rs1036748432 63 dbSNP
rs1039264658 64 dbSNP
rs896785222 72 dbSNP
rs1343425782 74 dbSNP
rs1202581721 76 dbSNP
rs899392837 84 dbSNP
rs1318430160 86 dbSNP
rs1453159125 98 dbSNP
rs1279834435 102 dbSNP
rs930672751 107 dbSNP
rs1482922762 110 dbSNP
rs529389931 114 dbSNP
rs1014251336 117 dbSNP
rs886564788 117 dbSNP
rs1473289662 128 dbSNP
rs1181830102 140 dbSNP
rs1050939103 146 dbSNP
rs1024099038 149 dbSNP
rs1405932126 168 dbSNP
rs1418149599 168 dbSNP
rs201235752 168 dbSNP
rs745766481 168 dbSNP
rs78082039 168 dbSNP
rs905665540 183 dbSNP
rs75651391 184 dbSNP
rs374426865 185 dbSNP
rs889736291 185 dbSNP
rs201408914 186 dbSNP
rs1402717031 188 dbSNP
rs1428862663 189 dbSNP
rs1306409587 194 dbSNP
rs1372574410 195 dbSNP
rs1484225939 198 dbSNP
rs1256362941 200 dbSNP
rs549564152 202 dbSNP
rs957510667 208 dbSNP
rs988518129 209 dbSNP
rs1007119249 216 dbSNP
rs1022169318 228 dbSNP
rs762437388 229 dbSNP
rs569479910 234 dbSNP
rs1296098475 241 dbSNP
rs1313072847 245 dbSNP
rs112135102 246 dbSNP
rs1403629507 249 dbSNP
rs1288589534 263 dbSNP
rs986520610 267 dbSNP
rs1358187301 278 dbSNP
rs912065984 283 dbSNP
rs750881680 286 dbSNP
rs956000898 289 dbSNP
rs1439969055 291 dbSNP
rs1341984675 292 dbSNP
rs574409878 295 dbSNP
rs1184861589 296 dbSNP
rs1441164795 298 dbSNP
rs1256792915 303 dbSNP
rs992842296 304 dbSNP
rs1204276107 314 dbSNP
rs191759856 331 dbSNP
rs570340866 338 dbSNP
rs1483804922 339 dbSNP
rs1195906212 341 dbSNP
rs766675296 342 dbSNP
rs975302583 351 dbSNP
rs1247097120 359 dbSNP
rs980668043 364 dbSNP
rs1449361520 367 dbSNP
rs539455661 369 dbSNP
rs1200995164 373 dbSNP
rs777087885 382 dbSNP
rs941527791 388 dbSNP
rs11848262 389 dbSNP
rs1299250452 391 dbSNP
rs918347102 406 dbSNP
rs543023439 408 dbSNP
rs933643820 410 dbSNP
rs1364575917 417 dbSNP
rs1166425841 419 dbSNP
rs1392286271 422 dbSNP
rs1368942523 435 dbSNP
rs886406026 440 dbSNP
rs950149400 449 dbSNP
rs1293138616 452 dbSNP
rs1490229943 455 dbSNP
rs1388743740 461 dbSNP
rs1265554058 462 dbSNP
rs572869860 464 dbSNP
rs1250875459 473 dbSNP
rs1324787339 475 dbSNP
rs1365036483 477 dbSNP
rs535192748 481 dbSNP
rs1001411225 485 dbSNP
rs1330097455 487 dbSNP
rs1300224498 490 dbSNP
rs1388193462 493 dbSNP
rs942669781 503 dbSNP
rs1368478667 505 dbSNP
rs1054694946 508 dbSNP
rs893063840 511 dbSNP
rs1463997022 514 dbSNP
rs1425700626 519 dbSNP
rs1171059326 526 dbSNP
rs1048318 528 dbSNP
rs1353645900 530 dbSNP
rs1201248664 539 dbSNP
rs1296148174 556 dbSNP
rs575100154 564 dbSNP
rs1253571051 569 dbSNP
rs1464355884 576 dbSNP
rs1186560285 577 dbSNP
rs1249711613 588 dbSNP
rs184045698 592 dbSNP
rs1007881397 599 dbSNP
rs1223237039 603 dbSNP
rs1366869866 607 dbSNP
rs1018050717 610 dbSNP
rs564081941 620 dbSNP
rs577935834 621 dbSNP
rs1330015068 624 dbSNP
rs920721539 627 dbSNP
rs1388594501 629 dbSNP
rs377351543 636 dbSNP
rs1331997972 645 dbSNP
rs1413884469 648 dbSNP
rs1422781719 651 dbSNP
rs952303597 656 dbSNP
rs116388200 668 dbSNP
rs1014260838 670 dbSNP
rs907898483 674 dbSNP
rs1441656321 685 dbSNP
rs1363173249 698 dbSNP
rs1203565743 703 dbSNP
rs188931057 705 dbSNP
rs1046139307 718 dbSNP
rs1024342249 723 dbSNP
rs927442522 725 dbSNP
rs1395739176 733 dbSNP
rs144489291 735 dbSNP
rs1237277850 738 dbSNP
rs868473469 742 dbSNP
rs1338285969 750 dbSNP
rs1054305591 759 dbSNP
rs980340299 761 dbSNP
rs1017621339 763 dbSNP
rs962879350 771 dbSNP
rs1357359838 776 dbSNP
rs137960964 777 dbSNP
rs1414846910 779 dbSNP
rs1041681282 798 dbSNP
rs918315842 800 dbSNP
rs764323151 810 dbSNP
rs1441827917 813 dbSNP
rs112358642 823 dbSNP
rs1007927611 827 dbSNP
rs1048359 830 dbSNP
rs986423372 837 dbSNP
rs1183139106 845 dbSNP
rs910857408 848 dbSNP
rs963831113 854 dbSNP
rs1269939264 861 dbSNP
rs942365556 869 dbSNP
rs563067655 876 dbSNP
rs142140579 881 dbSNP
rs1355488288 884 dbSNP
rs376146900 896 dbSNP
rs1286019928 897 dbSNP
rs757970423 899 dbSNP
rs1376823446 904 dbSNP
rs983563718 906 dbSNP
rs748021063 908 dbSNP
rs1425744639 911 dbSNP
rs765861195 923 dbSNP
rs1411394521 925 dbSNP
rs756049726 929 dbSNP
rs1421749597 934 dbSNP
rs1162003191 936 dbSNP
rs1346244907 941 dbSNP
rs1164102409 942 dbSNP
rs891877606 943 dbSNP
rs1416541542 952 dbSNP
rs1014313102 957 dbSNP
rs1164314504 958 dbSNP
rs115257358 965 dbSNP
rs1381755884 969 dbSNP
rs1261469464 970 dbSNP
rs905840126 970 dbSNP
rs1196299821 974 dbSNP
rs139706576 991 dbSNP
rs1489032139 991 dbSNP
rs192420039 1006 dbSNP
rs1054926166 1013 dbSNP
rs777541506 1015 dbSNP
rs531824211 1016 dbSNP
rs1291464791 1021 dbSNP
rs914644130 1024 dbSNP
rs546544905 1031 dbSNP
rs1041563578 1039 dbSNP
rs1341310293 1043 dbSNP
rs144474881 1046 dbSNP
rs1209206530 1049 dbSNP
rs891086154 1053 dbSNP
rs545219024 1054 dbSNP
rs1465498780 1057 dbSNP
rs1422123437 1061 dbSNP
rs1254072196 1065 dbSNP
rs1478370351 1069 dbSNP
rs955548479 1079 dbSNP
rs1190248479 1082 dbSNP
rs182064708 1089 dbSNP
rs200827201 1096 dbSNP
rs535132362 1097 dbSNP
rs1213775667 1105 dbSNP
rs1039377317 1113 dbSNP
rs963717854 1115 dbSNP
rs1220199255 1118 dbSNP
rs979537235 1120 dbSNP
rs925206560 1130 dbSNP
rs1026714199 1136 dbSNP
rs1370002253 1139 dbSNP
rs935268897 1143 dbSNP
rs1294125440 1154 dbSNP
rs770597574 1158 dbSNP
rs1398684846 1170 dbSNP
rs1333915784 1173 dbSNP
rs1466646581 1177 dbSNP
rs917717461 1185 dbSNP
rs568537913 1186 dbSNP
rs565383124 1188 dbSNP
rs1005047752 1190 dbSNP
rs147304544 1190 dbSNP
rs949218091 1192 dbSNP
rs971681656 1201 dbSNP
rs778473122 1202 dbSNP
rs555091847 1203 dbSNP
rs1200435713 1204 dbSNP
rs1313118494 1207 dbSNP
rs1034375348 1212 dbSNP
rs745568163 1216 dbSNP
rs958984620 1225 dbSNP
rs186615079 1233 dbSNP
rs1407480147 1249 dbSNP
rs1299350306 1256 dbSNP
rs1373394557 1257 dbSNP
rs537676660 1258 dbSNP
rs1311629921 1262 dbSNP
rs191864416 1265 dbSNP
rs1402124049 1279 dbSNP
rs1301402025 1285 dbSNP
rs1467922875 1289 dbSNP
rs867146133 1292 dbSNP
rs183895114 1293 dbSNP
rs1173845479 1296 dbSNP
rs1234674108 1304 dbSNP
rs1418765390 1308 dbSNP
rs1274214680 1322 dbSNP
rs946109791 1326 dbSNP
rs527459483 1328 dbSNP
rs1419538333 1337 dbSNP
rs775157978 1343 dbSNP
rs955517762 1351 dbSNP
rs1179859294 1353 dbSNP
rs1233572792 1354 dbSNP
rs912363590 1358 dbSNP
rs1216146460 1370 dbSNP
rs1351864348 1378 dbSNP
rs12894934 1383 dbSNP
rs1008825292 1386 dbSNP
rs943983293 1390 dbSNP
rs1239877384 1393 dbSNP
rs1018011137 1395 dbSNP
rs1040003828 1404 dbSNP
rs1311249115 1405 dbSNP
rs1398349105 1406 dbSNP
rs1380324656 1418 dbSNP
rs1190045736 1422 dbSNP
rs190120916 1429 dbSNP
rs979119318 1432 dbSNP
rs924905382 1433 dbSNP
rs931000967 1449 dbSNP
rs1389201455 1453 dbSNP
rs1427473131 1454 dbSNP
rs762400966 1455 dbSNP
rs1257960135 1457 dbSNP
rs1048047984 1459 dbSNP
rs1487398347 1468 dbSNP
rs988032474 1473 dbSNP
rs1265642252 1482 dbSNP
rs917853213 1484 dbSNP
rs1354672938 1489 dbSNP
rs1355693206 1490 dbSNP
rs575356027 1492 dbSNP
rs1247614345 1497 dbSNP
rs1336205591 1498 dbSNP
rs1277893577 1499 dbSNP
rs981034416 1501 dbSNP
rs1003884808 1502 dbSNP
rs193041271 1506 dbSNP
rs1291727595 1508 dbSNP
rs937457666 1514 dbSNP
rs1038464154 1517 dbSNP
rs1441402420 1518 dbSNP
rs1951118 1519 dbSNP
rs185637907 1528 dbSNP
rs1291350817 1529 dbSNP
rs531921329 1530 dbSNP
rs1459318126 1531 dbSNP
rs930000107 1539 dbSNP
rs190448443 1544 dbSNP
rs1476736826 1552 dbSNP
rs1425560006 1554 dbSNP
rs1194144419 1557 dbSNP
rs1216605066 1559 dbSNP
rs1273967523 1562 dbSNP
rs1211723270 1563 dbSNP
rs74951857 1564 dbSNP
rs1258011310 1567 dbSNP
rs180910551 1569 dbSNP
rs1320419604 1570 dbSNP
rs547210636 1583 dbSNP
rs185478645 1589 dbSNP
rs1469273366 1592 dbSNP
rs1227697182 1609 dbSNP
rs967460982 1612 dbSNP
rs1018898898 1614 dbSNP
rs1442492593 1634 dbSNP
rs1395078255 1635 dbSNP
rs900004727 1636 dbSNP
rs1000984035 1645 dbSNP
rs1032111727 1646 dbSNP
rs1168353790 1652 dbSNP
rs73317863 1659 dbSNP
rs1376149141 1663 dbSNP
rs975259722 1665 dbSNP
rs921213645 1667 dbSNP
rs567199837 1669 dbSNP
rs528897808 1670 dbSNP
rs1404263544 1671 dbSNP
rs1197285665 1675 dbSNP
rs1162040155 1684 dbSNP
rs1395989170 1686 dbSNP
rs1024877545 1689 dbSNP
rs1274071664 1699 dbSNP
rs1200252805 1704 dbSNP
rs548654793 1722 dbSNP
rs1343790515 1723 dbSNP
rs188277841 1725 dbSNP
rs971090339 1726 dbSNP
rs1236094669 1752 dbSNP
rs1371066854 1756 dbSNP
rs1461940231 1762 dbSNP
rs529186168 1768 dbSNP
rs1362847400 1778 dbSNP
rs1432554505 1783 dbSNP
rs1329234408 1797 dbSNP
rs1271006018 1799 dbSNP
rs1413725700 1802 dbSNP
rs1378660609 1820 dbSNP
rs1399843204 1823 dbSNP
rs1226713350 1828 dbSNP
rs1175731054 1830 dbSNP
rs1275170259 1831 dbSNP
rs1335528638 1840 dbSNP
rs1208718475 1846 dbSNP
rs908189968 1848 dbSNP
rs926417239 1850 dbSNP
rs1176860678 1853 dbSNP
rs1442024611 1854 dbSNP
rs939792706 1856 dbSNP
rs568581699 1862 dbSNP
rs373046176 1865 dbSNP
rs1003489133 1867 dbSNP
rs1212564761 1870 dbSNP
rs73317864 1874 dbSNP
rs529970032 1876 dbSNP
rs1021646348 1883 dbSNP
rs766796384 1889 dbSNP
rs1047076379 1892 dbSNP
rs1280032992 1894 dbSNP
rs967348460 1900 dbSNP
rs1338469148 1906 dbSNP
rs891376614 1910 dbSNP
rs1360197520 1912 dbSNP
rs944323113 1915 dbSNP
rs1020146054 1916 dbSNP
rs1402566121 1919 dbSNP
rs1408845134 1923 dbSNP
rs73317865 1925 dbSNP
rs1472102998 1926 dbSNP
rs1239507222 1929 dbSNP
rs1205297366 1931 dbSNP
rs1189172268 1933 dbSNP
rs1485784765 1935 dbSNP
rs139684382 1936 dbSNP
rs921073251 1944 dbSNP
rs1001053455 1946 dbSNP
rs983979301 1947 dbSNP
rs1227611319 1954 dbSNP
rs1354245670 1958 dbSNP
rs1386293581 1971 dbSNP
rs1032081899 1974 dbSNP
rs892241394 1981 dbSNP
rs1340085446 1982 dbSNP
rs1296539939 1989 dbSNP
rs11620995 1992 dbSNP
rs1046040342 2020 dbSNP
rs1024678838 2022 dbSNP
rs927744394 2023 dbSNP
rs937735243 2025 dbSNP
rs1056372999 2033 dbSNP
rs894612060 2034 dbSNP
rs1421966162 2036 dbSNP
rs1184350014 2037 dbSNP
rs1486646910 2038 dbSNP
rs970426377 2048 dbSNP
rs1220264968 2055 dbSNP
rs1358329881 2069 dbSNP
rs574065050 2070 dbSNP
rs1449774258 2077 dbSNP
rs1295339700 2078 dbSNP
rs981059060 2079 dbSNP
rs1356253872 2082 dbSNP
rs1227793622 2083 dbSNP
rs1317019601 2089 dbSNP
rs1011851360 2097 dbSNP
rs1216478879 2099 dbSNP
rs1287024278 2109 dbSNP
rs1033621737 2116 dbSNP
rs1274317904 2120 dbSNP
rs751681731 2125 dbSNP
rs543070318 2126 dbSNP
rs1327111916 2127 dbSNP
rs1465578667 2138 dbSNP
rs1398477682 2153 dbSNP
rs919993226 2156 dbSNP
rs777893021 2158 dbSNP
rs556618567 2164 dbSNP
rs181373848 2170 dbSNP
rs982739310 2174 dbSNP
rs1254360245 2178 dbSNP
rs912512994 2180 dbSNP
rs1194119705 2181 dbSNP
rs944070237 2186 dbSNP
rs1208365095 2190 dbSNP
rs1206432307 2196 dbSNP
rs866464542 2199 dbSNP
rs921558135 2205 dbSNP
rs996913302 2213 dbSNP
rs936813430 2215 dbSNP
rs1373220053 2218 dbSNP
rs952571517 2222 dbSNP
rs1362025074 2228 dbSNP
rs200633506 2234 dbSNP
rs760572221 2234 dbSNP
rs767518829 2234 dbSNP
rs1358981620 2237 dbSNP
rs186457712 2240 dbSNP
rs1432493015 2244 dbSNP
rs1471142536 2244 dbSNP
rs1159053713 2245 dbSNP
rs1424277835 2246 dbSNP
rs908502840 2247 dbSNP
rs752841880 2249 dbSNP
rs961276157 2250 dbSNP
rs1480811701 2255 dbSNP
rs754186623 2256 dbSNP
rs1208922922 2257 dbSNP
rs927615950 2261 dbSNP
rs1053995370 2270 dbSNP
rs937769811 2271 dbSNP
rs892210285 2276 dbSNP
rs1009285244 2279 dbSNP
rs80165138 2299 dbSNP
rs914975863 2304 dbSNP
rs906170834 2311 dbSNP
rs1378827491 2314 dbSNP
rs1409318391 2314 dbSNP
rs1301463771 2315 dbSNP
rs79704005 2316 dbSNP
rs1376957457 2320 dbSNP
rs549355021 2324 dbSNP
rs1034004202 2325 dbSNP
rs903475734 2326 dbSNP
rs1361589110 2330 dbSNP
rs1274771060 2336 dbSNP
rs934865840 2338 dbSNP
rs541702414 2342 dbSNP
rs994628552 2343 dbSNP
rs1236875288 2352 dbSNP
rs1412801028 2354 dbSNP
rs1185606914 2359 dbSNP
rs1282051518 2360 dbSNP
rs901150543 2361 dbSNP
rs1258538179 2367 dbSNP
rs997236219 2374 dbSNP
rs1026140391 2383 dbSNP
rs1484906188 2388 dbSNP
rs950562643 2391 dbSNP
rs1240303485 2392 dbSNP
rs749228817 2407 dbSNP
rs912660472 2414 dbSNP
rs965745351 2419 dbSNP
rs1235584241 2422 dbSNP
rs1182527542 2423 dbSNP
rs1015343128 2427 dbSNP
rs975462314 2428 dbSNP
rs1245990161 2432 dbSNP
rs191660467 2440 dbSNP
rs111421763 2470 dbSNP
rs1382064703 2470 dbSNP
rs1035113782 2471 dbSNP
rs936938250 2472 dbSNP
rs1054047363 2473 dbSNP
rs1162493396 2474 dbSNP
rs1398811272 2476 dbSNP
rs990878479 2476 dbSNP
rs1391971339 2477 dbSNP
rs756033174 2490 dbSNP
rs1426963337 2507 dbSNP
rs183564838 2510 dbSNP
rs115079574 2514 dbSNP
rs777738087 2515 dbSNP
rs548535727 2521 dbSNP
rs1443610465 2522 dbSNP
rs1304682895 2524 dbSNP
rs1271870678 2532 dbSNP
rs187202074 2532 dbSNP
rs1216130207 2544 dbSNP
rs978927273 2547 dbSNP
rs1277976673 2554 dbSNP
rs924745120 2555 dbSNP
rs753639757 2556 dbSNP
rs1002259733 2557 dbSNP
rs1227288740 2557 dbSNP
rs1297073326 2560 dbSNP
rs570563900 2561 dbSNP
rs1382340939 2562 dbSNP
rs1389428572 2562 dbSNP
rs1323755774 2563 dbSNP
rs1249260619 2570 dbSNP
rs1340872264 2572 dbSNP
rs1195814822 2573 dbSNP
rs1266619003 2575 dbSNP
rs1467112602 2576 dbSNP
rs1394860848 2587 dbSNP
rs1169778426 2601 dbSNP
rs1460646183 2605 dbSNP
rs531259472 2606 dbSNP
rs1041322717 2615 dbSNP
rs1193951824 2618 dbSNP
rs1253451924 2621 dbSNP
rs901409475 2623 dbSNP
rs72720117 2631 dbSNP
rs1049717996 2633 dbSNP
rs1374944489 2636 dbSNP
rs745456229 2641 dbSNP
rs1469305271 2645 dbSNP
rs1257811960 2646 dbSNP
rs1462580045 2649 dbSNP
rs1194492968 2659 dbSNP
rs888534640 2661 dbSNP
rs1252663238 2665 dbSNP
rs1005559866 2669 dbSNP
rs1369536985 2675 dbSNP
rs1392338168 2677 dbSNP
rs539555432 2688 dbSNP
rs771912693 2692 dbSNP
rs896967980 2694 dbSNP
rs571409117 2699 dbSNP
rs1327152041 2705 dbSNP
rs192456205 2706 dbSNP
rs994680903 2720 dbSNP
rs554010739 2727 dbSNP
rs567541389 2728 dbSNP
rs183218761 2729 dbSNP
rs1465739517 2731 dbSNP
rs886242712 2736 dbSNP
rs1175672508 2737 dbSNP
rs1455070168 2738 dbSNP
rs1034972514 2740 dbSNP
rs1008713431 2743 dbSNP
rs959543585 2747 dbSNP
rs1011953437 2753 dbSNP
rs1251708651 2757 dbSNP
rs1433267248 2761 dbSNP
rs1195953831 2765 dbSNP
rs1277553649 2770 dbSNP
rs779694081 2770 dbSNP
rs965527577 2773 dbSNP
rs1235918965 2775 dbSNP
rs975809418 2777 dbSNP
rs1278840395 2779 dbSNP
rs145758677 2781 dbSNP
rs1264397726 2782 dbSNP
rs1329299171 2784 dbSNP
rs977814616 2786 dbSNP
rs923667635 2788 dbSNP
rs1314801473 2793 dbSNP
rs576510286 2802 dbSNP
rs1435379478 2806 dbSNP
rs1407384356 2808 dbSNP
rs1157284301 2825 dbSNP
rs958026391 2826 dbSNP
rs1364734295 2827 dbSNP
rs1464282277 2829 dbSNP
rs1485127428 2836 dbSNP
rs977320069 2838 dbSNP
rs1212614485 2844 dbSNP
rs1485683066 2849 dbSNP
rs747022456 2852 dbSNP
rs139925261 2854 dbSNP
rs1221933502 2857 dbSNP
rs914171971 2862 dbSNP
rs1279901800 2865 dbSNP
rs1232500084 2878 dbSNP
rs932858746 2878 dbSNP
rs1415642617 2884 dbSNP
rs1049727902 2885 dbSNP
rs773549858 2885 dbSNP
rs1187076681 2886 dbSNP
rs1316400398 2888 dbSNP
rs1415848697 2889 dbSNP
rs909856439 2898 dbSNP
rs945516484 2901 dbSNP
rs941466083 2902 dbSNP
rs1037098425 2905 dbSNP
rs1476226288 2909 dbSNP
rs897216088 2912 dbSNP
rs982328827 2913 dbSNP
rs538629090 2915 dbSNP
rs1189546284 2917 dbSNP
rs1420501491 2917 dbSNP
rs145457621 2927 dbSNP
rs1055292122 2930 dbSNP
rs1290962833 2932 dbSNP
rs1284820983 2933 dbSNP
rs1213019143 2934 dbSNP
rs1386098466 2937 dbSNP
rs898796853 2944 dbSNP
rs1332339454 2957 dbSNP
rs1382487133 2965 dbSNP
rs572585664 2966 dbSNP
rs541293515 2970 dbSNP
rs886379831 2973 dbSNP
rs1012544105 2977 dbSNP
rs1325762670 2984 dbSNP
rs1327133685 2984 dbSNP
rs1008679298 2992 dbSNP
rs1234524822 2993 dbSNP
rs1397050900 2994 dbSNP
rs558326504 2999 dbSNP
rs1405576662 3006 dbSNP
rs1418403744 3016 dbSNP
rs1184441124 3020 dbSNP
rs1018812668 3022 dbSNP
rs1248124070 3023 dbSNP
rs1328339582 3029 dbSNP
rs1467135897 3030 dbSNP
rs1274801252 3032 dbSNP
rs1214151464 3033 dbSNP
rs1307103311 3037 dbSNP
rs900340406 3056 dbSNP
rs763855293 3067 dbSNP
rs1213516518 3074 dbSNP
rs996900365 3077 dbSNP
rs1340086674 3085 dbSNP
rs1302768690 3089 dbSNP
rs1028843144 3094 dbSNP
rs1262321062 3096 dbSNP
rs1373900212 3103 dbSNP
rs1486065624 3104 dbSNP
rs186744540 3107 dbSNP
rs989511572 3111 dbSNP
rs199686369 3119 dbSNP
rs574750325 3123 dbSNP
rs1411308622 3125 dbSNP
rs1390251327 3128 dbSNP
rs1021199754 3138 dbSNP
rs189649636 3139 dbSNP
rs966993371 3143 dbSNP
rs1411920631 3173 dbSNP
rs1191730869 3181 dbSNP
rs1480159506 3190 dbSNP
rs1230974773 3192 dbSNP
rs776697831 3202 dbSNP
rs982682644 3202 dbSNP
rs1161892641 3214 dbSNP
rs928122315 3221 dbSNP
rs1465794493 3226 dbSNP
rs922730017 3230 dbSNP
rs763537172 3233 dbSNP
rs1373189027 3246 dbSNP
rs1439817329 3248 dbSNP
rs1443906688 3248 dbSNP
rs954335160 3257 dbSNP
rs985651709 3265 dbSNP
rs534364652 3271 dbSNP
rs941391451 3275 dbSNP
rs1176629690 3279 dbSNP
rs920372565 3279 dbSNP
rs79381061 3281 dbSNP
rs1483490841 3283 dbSNP
rs1257124707 3287 dbSNP
rs865913696 3290 dbSNP
rs1056307183 3293 dbSNP
rs1047423096 3294 dbSNP
rs531246581 3296 dbSNP
rs551438090 3310 dbSNP
rs1232189957 3311 dbSNP
rs780794010 3313 dbSNP
rs1350279185 3315 dbSNP
rs1355261210 3319 dbSNP
rs903765195 3326 dbSNP
rs182578492 3329 dbSNP
rs1031047375 3340 dbSNP
rs767786549 3356 dbSNP
rs1343409989 3360 dbSNP
rs997648689 3364 dbSNP
rs1472769410 3369 dbSNP
rs1416918015 3371 dbSNP
rs1185998576 3393 dbSNP
rs1029848022 3397 dbSNP
rs900308590 3404 dbSNP
rs574374516 3406 dbSNP
rs954377582 3411 dbSNP
rs1432989304 3414 dbSNP
rs1172118587 3420 dbSNP
rs1397237008 3421 dbSNP
rs188148450 3423 dbSNP
rs1017172413 3426 dbSNP
rs192909207 3438 dbSNP
rs547242349 3442 dbSNP
rs567480402 3448 dbSNP
rs1439313179 3455 dbSNP
rs893919421 3457 dbSNP
rs1341950469 3458 dbSNP
rs1010909376 3461 dbSNP
rs1299831767 3467 dbSNP
rs1381197569 3469 dbSNP
rs1359289761 3478 dbSNP
rs1373908503 3486 dbSNP
rs185119833 3488 dbSNP
rs1301035636 3489 dbSNP
rs188344291 3494 dbSNP
rs570057517 3502 dbSNP
rs538692938 3505 dbSNP
rs79873526 3506 dbSNP
rs1192789154 3514 dbSNP
rs1426763285 3518 dbSNP
rs1263960630 3519 dbSNP
rs1189698499 3521 dbSNP
rs991416983 3537 dbSNP
rs920340094 3539 dbSNP
rs1468478458 3540 dbSNP
rs760786407 3541 dbSNP
rs1215991772 3544 dbSNP
rs796592621 3546 dbSNP
rs951830396 3549 dbSNP
rs935204013 3551 dbSNP
rs1052121589 3562 dbSNP
rs371549710 3563 dbSNP
rs983171556 3566 dbSNP
rs1255349334 3568 dbSNP
rs1435714709 3578 dbSNP
rs1370219162 3581 dbSNP
rs1454978879 3590 dbSNP
rs192692574 3596 dbSNP
rs535127013 3600 dbSNP
rs1442780470 3606 dbSNP
rs1193886315 3619 dbSNP
rs374534509 3620 dbSNP
rs554695201 3626 dbSNP
rs1418281662 3628 dbSNP
rs997171865 3631 dbSNP
rs1029187831 3632 dbSNP
rs200177392 3633 dbSNP
rs763462782 3635 dbSNP
rs764192411 3636 dbSNP
rs544346578 3637 dbSNP
rs1354585323 3638 dbSNP
rs1196085666 3645 dbSNP
rs1460904355 3654 dbSNP
rs1323798779 3669 dbSNP
rs1452500103 3677 dbSNP
rs1250268016 3683 dbSNP
rs368678844 3686 dbSNP
rs921874481 3692 dbSNP
rs556519321 3697 dbSNP
rs1025877655 3702 dbSNP
rs1269849668 3708 dbSNP
rs1346565911 3716 dbSNP
rs1360082008 3716 dbSNP
rs1216515519 3722 dbSNP
rs931816243 3725 dbSNP
rs543695409 3726 dbSNP
rs6573305 3730 dbSNP
rs1389874986 3744 dbSNP
rs916692102 3757 dbSNP
rs1372689651 3762 dbSNP
rs1010963467 3763 dbSNP
rs767245895 3769 dbSNP
rs1275525941 3773 dbSNP
rs1434139310 3778 dbSNP
rs1393370490 3779 dbSNP
rs1176006809 3795 dbSNP
rs1469202476 3797 dbSNP
rs1363575072 3812 dbSNP
rs1042500407 3822 dbSNP
rs1208448485 3823 dbSNP
rs1416906702 3831 dbSNP
rs1253477052 3833 dbSNP
rs902490355 3838 dbSNP
rs1003980287 3849 dbSNP
rs74497523 3850 dbSNP
rs73317867 3851 dbSNP
rs1419690060 3856 dbSNP
rs1345702478 3863 dbSNP
rs757235649 3876 dbSNP
rs1236660256 3883 dbSNP
rs1352127451 3883 dbSNP
rs1162716512 3884 dbSNP
rs1396532460 3900 dbSNP
rs1414409283 3907 dbSNP
rs1461793939 3911 dbSNP
rs1317425001 3914 dbSNP
rs1373708431 3915 dbSNP
rs1012358940 3916 dbSNP
rs1336312094 3925 dbSNP
rs1415527330 3933 dbSNP
rs564913028 3936 dbSNP
rs1384929822 3940 dbSNP
rs1027745682 3941 dbSNP
rs1243041555 3944 dbSNP
rs1459111529 3946 dbSNP
rs952215859 3962 dbSNP
rs867976759 3974 dbSNP
rs1474714035 3977 dbSNP
rs1433224417 3987 dbSNP
rs778510032 3999 dbSNP
rs983139739 4000 dbSNP
rs933014140 4003 dbSNP
rs1354906766 4006 dbSNP
rs1283423029 4013 dbSNP
rs184832824 4014 dbSNP
rs965728817 4021 dbSNP
rs976177278 4023 dbSNP
rs113455477 4028 dbSNP
rs1295681160 4032 dbSNP
rs1336058101 4033 dbSNP
rs1268603145 4034 dbSNP
rs921870303 4044 dbSNP
rs1005891988 4050 dbSNP
rs1353853796 4051 dbSNP
rs1223689027 4056 dbSNP
rs1282662205 4062 dbSNP
rs1449087738 4072 dbSNP
rs527358041 4081 dbSNP
rs1038514633 4082 dbSNP
rs898644561 4085 dbSNP
rs1459290595 4090 dbSNP
rs1389833536 4100 dbSNP
rs545395019 4106 dbSNP
rs931926143 4108 dbSNP
rs1164726667 4114 dbSNP
rs1460569141 4115 dbSNP
rs1411229926 4116 dbSNP
rs994334420 4127 dbSNP
rs1026351094 4138 dbSNP
rs1190850560 4141 dbSNP
rs1466246438 4142 dbSNP
rs1054384442 4145 dbSNP
rs960987082 4151 dbSNP
rs1212881946 4171 dbSNP
rs1332456240 4178 dbSNP
rs914371528 4179 dbSNP
rs1014008197 4193 dbSNP
rs945882681 4195 dbSNP
rs1338755562 4202 dbSNP
rs1268563714 4203 dbSNP
rs1437881183 4222 dbSNP
rs1023609074 4228 dbSNP
rs547520692 4244 dbSNP
rs902618925 4250 dbSNP
rs1352007300 4251 dbSNP
rs939363645 4255 dbSNP
rs1325047024 4256 dbSNP
rs1056900431 4258 dbSNP
rs35870932 4258 dbSNP
rs1475521749 4262 dbSNP
rs1418151450 4265 dbSNP
rs1166228648 4268 dbSNP
rs34093293 4269 dbSNP
rs1451220823 4270 dbSNP
rs1390668613 4273 dbSNP
rs374169249 4280 dbSNP
rs895153571 4284 dbSNP
rs75933037 4292 dbSNP
rs1405603151 4293 dbSNP
rs1248248831 4300 dbSNP
rs572530525 4301 dbSNP
rs1027879997 4305 dbSNP
rs1270940415 4307 dbSNP
rs1230750497 4312 dbSNP
rs887917601 4313 dbSNP
rs188425213 4316 dbSNP
rs1375023580 4321 dbSNP
rs1413049171 4322 dbSNP
rs370468127 4326 dbSNP
rs1014659831 4330 dbSNP
rs923219001 4332 dbSNP
rs758097769 4333 dbSNP
rs966227605 4339 dbSNP
rs933210912 4346 dbSNP
rs1050521104 4350 dbSNP
rs1353603519 4350 dbSNP
rs1305833362 4351 dbSNP
rs1353302171 4357 dbSNP
rs1224634491 4358 dbSNP
rs975766194 4367 dbSNP
rs1176581609 4368 dbSNP
rs1029042479 4374 dbSNP
rs1172868713 4392 dbSNP
rs953078464 4397 dbSNP
rs1426995637 4398 dbSNP
rs1286323254 4403 dbSNP
rs1346751772 4410 dbSNP
rs1208248464 4413 dbSNP
rs1483390178 4414 dbSNP
rs990044414 4414 dbSNP
rs1279710095 4424 dbSNP
rs1237293497 4432 dbSNP
rs180746359 4439 dbSNP
rs1314518143 4443 dbSNP
rs1302378757 4449 dbSNP
rs1223538775 4451 dbSNP
rs184872430 4457 dbSNP
rs1286013831 4463 dbSNP
rs756036594 4467 dbSNP
rs977290037 4474 dbSNP
rs1350567139 4480 dbSNP
rs924039485 4485 dbSNP
rs1311811052 4489 dbSNP
rs1464461885 4493 dbSNP
rs142192753 4496 dbSNP
rs1176739189 4497 dbSNP
rs566068155 4498 dbSNP
rs1399843538 4513 dbSNP
rs1056554615 4516 dbSNP
rs1409503892 4520 dbSNP
rs114551776 4524 dbSNP
rs1047188709 4530 dbSNP
rs1256880042 4535 dbSNP
rs948068955 4538 dbSNP
rs896741345 4551 dbSNP
rs1484296070 4555 dbSNP
rs1013810380 4558 dbSNP
rs1049287520 4560 dbSNP
rs554684593 4561 dbSNP
rs1327442911 4564 dbSNP
rs1270498801 4569 dbSNP
rs1005006125 4571 dbSNP
rs1000853080 4574 dbSNP
rs1229842463 4587 dbSNP
rs568297266 4591 dbSNP
rs988380447 4595 dbSNP
rs754500118 4599 dbSNP
rs537274273 4600 dbSNP
rs997638891 4610 dbSNP
rs1161172676 4611 dbSNP
rs1409386947 4618 dbSNP
rs1457938994 4623 dbSNP
rs1417372133 4631 dbSNP
rs1162975829 4635 dbSNP
rs1028762367 4640 dbSNP
rs143175699 4643 dbSNP
rs1186445943 4657 dbSNP
rs1463983303 4659 dbSNP
rs1250268235 4665 dbSNP
rs1209789333 4678 dbSNP
rs910451431 4681 dbSNP
rs1264441755 4685 dbSNP
rs1443520246 4692 dbSNP
rs1242173636 4701 dbSNP
rs1322930524 4702 dbSNP
rs1312894060 4703 dbSNP
rs749700921 4704 dbSNP
rs941734444 4708 dbSNP
rs151231778 4718 dbSNP
rs1369218353 4719 dbSNP
rs189677758 4737 dbSNP
rs977371364 4738 dbSNP
rs1291937553 4744 dbSNP
rs753846035 4745 dbSNP
rs929038502 4757 dbSNP
rs1281937731 4759 dbSNP
rs1169893967 4763 dbSNP
rs928415896 4769 dbSNP
rs1392524443 4770 dbSNP
rs938546275 4786 dbSNP
rs117094006 4790 dbSNP
rs1207692825 4791 dbSNP
rs916698201 4798 dbSNP
rs537797330 4803 dbSNP
rs757294457 4811 dbSNP
rs1045372841 4812 dbSNP
rs1049090083 4818 dbSNP
rs1339483271 4821 dbSNP
rs1299658170 4822 dbSNP
rs905434440 4827 dbSNP
rs1439535309 4835 dbSNP
rs1179157653 4839 dbSNP
rs1299004967 4840 dbSNP
rs909462082 4843 dbSNP
rs940912045 4851 dbSNP
rs1036619541 4854 dbSNP
rs1452340103 4857 dbSNP
rs901987006 4861 dbSNP
rs997709651 4867 dbSNP
rs558220617 4868 dbSNP
rs892551258 4874 dbSNP
rs1372498528 4877 dbSNP
rs1378370392 4889 dbSNP
rs572054245 4895 dbSNP
rs1009625070 4896 dbSNP
rs181233103 4899 dbSNP
rs1956870 4900 dbSNP
rs1267553016 4903 dbSNP
rs1011238187 4906 dbSNP
rs1166267342 4907 dbSNP
rs1398695753 4913 dbSNP
rs529896085 4915 dbSNP
rs1276239908 4916 dbSNP
rs1205774250 4917 dbSNP
rs140084113 4918 dbSNP
rs1253996278 4926 dbSNP
rs35653853 4931 dbSNP
rs1325818461 4938 dbSNP
rs1235096515 4944 dbSNP
rs1331491493 4946 dbSNP
rs187150899 4947 dbSNP
rs1017513690 4956 dbSNP
rs1408232896 4961 dbSNP
rs967036086 4967 dbSNP
rs1443490958 4968 dbSNP
rs963227593 4991 dbSNP
rs532257214 4993 dbSNP
rs1414381085 5001 dbSNP
rs1226203774 5006 dbSNP
rs552489483 5009 dbSNP
rs565923310 5016 dbSNP
rs1174860007 5017 dbSNP
rs528500775 5017 dbSNP
rs1035625328 5020 dbSNP
rs960129642 5021 dbSNP
rs929067629 5025 dbSNP
rs1363588457 5026 dbSNP
rs992617974 5041 dbSNP
rs1471441139 5048 dbSNP
rs916975453 5050 dbSNP
rs1272403500 5060 dbSNP
rs548255260 5062 dbSNP
rs949610244 5076 dbSNP
rs746269806 5083 dbSNP
rs34064379 5099 dbSNP
rs568186968 5102 dbSNP
rs984848464 5106 dbSNP
rs537161857 5108 dbSNP
rs1345367759 5116 dbSNP
rs772258484 5125 dbSNP
rs1267339636 5126 dbSNP
rs1331551021 5128 dbSNP
rs905445713 5128 dbSNP
rs1036994762 5131 dbSNP
rs1267746380 5145 dbSNP
rs557093278 5155 dbSNP
rs1447333255 5157 dbSNP
rs1338790987 5159 dbSNP
rs190403165 5160 dbSNP
rs150309578 5161 dbSNP
rs889293434 5162 dbSNP
rs1011288984 5175 dbSNP
rs1042844283 5179 dbSNP
rs1413665184 5182 dbSNP
rs553669911 5182 dbSNP
rs571934146 5184 dbSNP
rs1416301147 5190 dbSNP
rs1951112 5193 dbSNP
rs1463381439 5194 dbSNP
rs1235243366 5201 dbSNP
rs1951113 5204 dbSNP
rs1030444791 5209 dbSNP
rs998560821 5211 dbSNP
rs1007350566 5212 dbSNP
rs1035997092 5222 dbSNP
rs1466111822 5228 dbSNP
rs960021782 5230 dbSNP
rs1017358937 5232 dbSNP
rs1227965282 5237 dbSNP
rs1354330585 5241 dbSNP
rs1286087748 5245 dbSNP
rs1246141713 5246 dbSNP
rs1381312302 5250 dbSNP
rs1365158523 5252 dbSNP
rs1013158362 5265 dbSNP
rs963278647 5266 dbSNP
rs1437668268 5272 dbSNP
rs1327746776 5282 dbSNP
rs1318489467 5283 dbSNP
rs1404465377 5286 dbSNP
rs1218691982 5288 dbSNP
rs1022720824 5300 dbSNP
rs561139533 5310 dbSNP
rs1445134213 5315 dbSNP
rs952550389 5326 dbSNP
rs1389436636 5331 dbSNP
rs1186619519 5334 dbSNP
rs1292645056 5340 dbSNP
rs973272405 5346 dbSNP
rs529933804 5356 dbSNP
rs909316560 5357 dbSNP
rs1235012566 5358 dbSNP
rs1265827108 5369 dbSNP
rs764009662 5370 dbSNP
rs868467316 5372 dbSNP
rs992898272 5389 dbSNP
rs1231258627 5394 dbSNP
rs1366367513 5395 dbSNP
rs541057702 5401 dbSNP
rs1274689438 5406 dbSNP
rs1435277933 5412 dbSNP
rs1264107906 5413 dbSNP
rs1325151569 5414 dbSNP
rs1424687730 5423 dbSNP
rs972115442 5425 dbSNP
rs181985185 5426 dbSNP
rs923508218 5435 dbSNP
rs933553043 5441 dbSNP
rs1166638101 5443 dbSNP
rs574552418 5446 dbSNP
rs1419940203 5449 dbSNP
rs1187270631 5450 dbSNP
rs917042565 5455 dbSNP
rs186117390 5472 dbSNP
rs947549461 5486 dbSNP
rs1482729642 5489 dbSNP
rs1476484930 5491 dbSNP
rs980942105 5498 dbSNP
rs549616238 5506 dbSNP
rs563606290 5510 dbSNP
rs1343555468 5526 dbSNP
rs936923841 5527 dbSNP
rs1042814686 5528 dbSNP
rs1370209286 5532 dbSNP
rs1276193817 5534 dbSNP
rs902957849 5535 dbSNP
rs1349323608 5541 dbSNP
rs914127524 5546 dbSNP
rs563332645 5556 dbSNP
rs1362036080 5564 dbSNP
rs1431517533 5564 dbSNP
rs934317591 5564 dbSNP
rs1355002054 5565 dbSNP
rs1175305110 5566 dbSNP
rs945437020 5570 dbSNP
rs1056833752 5576 dbSNP
rs1052160078 5581 dbSNP
rs1177407548 5582 dbSNP
rs895480921 5583 dbSNP
rs1007571797 5585 dbSNP
rs1012796278 5589 dbSNP
rs1022855228 5590 dbSNP
rs888253534 5591 dbSNP
rs532373745 5593 dbSNP
rs1237361520 5594 dbSNP
rs1005373101 5602 dbSNP
rs1016285704 5613 dbSNP
rs34929202 5616 dbSNP
rs1262757775 5620 dbSNP
rs761638079 5622 dbSNP
rs1026266693 5624 dbSNP
rs972564715 5624 dbSNP
rs994618966 5624 dbSNP
rs1411079480 5626 dbSNP
rs1373450364 5633 dbSNP
rs1354726387 5634 dbSNP
rs1415124949 5634 dbSNP
rs1360666818 5639 dbSNP
rs545759962 5643 dbSNP
rs1176948453 5671 dbSNP
rs137885454 5677 dbSNP
rs954890973 5685 dbSNP
rs1255506771 5687 dbSNP
rs1409978932 5690 dbSNP
rs986350661 5696 dbSNP
rs1183018078 5705 dbSNP
rs528391690 5707 dbSNP
rs1013921865 5714 dbSNP
rs1161674806 5718 dbSNP
rs910835506 5719 dbSNP
rs1180611551 5726 dbSNP
rs947518803 5733 dbSNP
rs978963320 5744 dbSNP
rs548142635 5746 dbSNP
rs1184467335 5747 dbSNP
rs574541499 5749 dbSNP
rs1381259187 5753 dbSNP
rs530867728 5754 dbSNP
rs1419946955 5762 dbSNP
rs1463843424 5766 dbSNP
rs969806646 5768 dbSNP
rs551101755 5776 dbSNP
rs1316986960 5780 dbSNP
rs765263488 5789 dbSNP
rs1467120087 5793 dbSNP
rs1303408416 5799 dbSNP
rs768588181 5802 dbSNP
rs895460409 5808 dbSNP
rs958220814 5816 dbSNP
rs948403727 5822 dbSNP
rs570947981 5838 dbSNP
rs1044280182 5848 dbSNP
rs1389562790 5849 dbSNP
rs1454561539 5852 dbSNP
rs1349350494 5862 dbSNP
rs540059847 5878 dbSNP
rs1162818842 5884 dbSNP
rs1425668752 5886 dbSNP
rs546959425 5902 dbSNP
rs1188504335 5906 dbSNP
rs1447976891 5916 dbSNP
rs1250369712 5918 dbSNP
rs888390830 5922 dbSNP
rs750223904 5924 dbSNP
rs1486016611 5925 dbSNP
rs1015344749 5926 dbSNP
rs1264315258 5928 dbSNP
rs896980953 5929 dbSNP
rs142415360 5930 dbSNP
rs766311252 5939 dbSNP
rs1315574655 5940 dbSNP
rs1227580049 5948 dbSNP
rs1362763270 5951 dbSNP
rs911871068 5961 dbSNP
rs943356211 5964 dbSNP
rs1390240193 5965 dbSNP
rs1292027639 5966 dbSNP
rs781544908 5968 dbSNP
rs1366281757 5970 dbSNP
rs3209335 5971 dbSNP
rs1392386716 5978 dbSNP
rs899249318 5984 dbSNP
rs1432995745 5987 dbSNP
rs994721651 5987 dbSNP
rs1189109856 5991 dbSNP
rs754692339 5991 dbSNP
rs73317872 5992 dbSNP
rs1023990233 5994 dbSNP
rs1250796548 5995 dbSNP
rs780555399 5996 dbSNP
rs1227828939 6000 dbSNP
rs986154483 6020 dbSNP
rs1017866449 6031 dbSNP
rs769946050 6036 dbSNP
rs2273623 6046 dbSNP
rs1407069501 6049 dbSNP
rs1346221132 6054 dbSNP
rs979017256 6060 dbSNP
rs1239180710 6062 dbSNP
rs1001187381 6063 dbSNP
rs1454105932 6065 dbSNP
rs368608522 6068 dbSNP
rs1192687103 6075 dbSNP
rs1169019498 6078 dbSNP
rs1465803034 6084 dbSNP
rs1376285072 6087 dbSNP
rs757673105 6099 dbSNP
rs1268940079 6106 dbSNP
rs956422521 6115 dbSNP
rs992561828 6119 dbSNP
rs1196315174 6122 dbSNP
rs917016587 6128 dbSNP
rs1434439489 6132 dbSNP
rs914028527 6137 dbSNP
rs1225562559 6138 dbSNP
rs948372677 6153 dbSNP
rs1324582036 6156 dbSNP
rs1287995094 6157 dbSNP
rs1176196800 6164 dbSNP
rs1337624110 6166 dbSNP
rs1330062438 6171 dbSNP
rs1353364033 6174 dbSNP
rs1396027912 6176 dbSNP
rs1460415540 6179 dbSNP
rs967006129 6182 dbSNP
rs779522264 6183 dbSNP
rs909797626 6185 dbSNP
rs941240645 6195 dbSNP
rs1037371791 6208 dbSNP
rs896957347 6214 dbSNP
rs1301583300 6216 dbSNP
rs1370047239 6225 dbSNP
rs1471287550 6227 dbSNP
rs943410028 6232 dbSNP
rs189794314 6246 dbSNP
rs565619606 6255 dbSNP
rs930686150 6261 dbSNP
rs1428602504 6268 dbSNP
rs1305775142 6270 dbSNP
rs1461618519 6272 dbSNP
rs1051836981 6273 dbSNP
rs1226797851 6273 dbSNP
rs1047569140 6275 dbSNP
rs1280272466 6287 dbSNP
rs1244671894 6288 dbSNP
rs1288164463 6288 dbSNP
rs746394415 6303 dbSNP
rs1317804810 6304 dbSNP
rs886246956 6321 dbSNP
rs1453762594 6323 dbSNP
rs949894945 6325 dbSNP
rs1319469447 6335 dbSNP
rs1045706580 6338 dbSNP
rs1007557906 6341 dbSNP
rs138397437 6342 dbSNP
rs1366598305 6348 dbSNP
rs1255239463 6349 dbSNP
rs1489269910 6357 dbSNP
rs1191354979 6367 dbSNP
rs1017583283 6368 dbSNP
rs1001239885 6372 dbSNP
rs968709819 6375 dbSNP
rs1207045063 6380 dbSNP
rs534746468 6391 dbSNP
rs1449004866 6409 dbSNP
rs892905181 6418 dbSNP
rs1209264292 6421 dbSNP
rs1354349233 6427 dbSNP
rs576940457 6436 dbSNP
rs1000425953 6460 dbSNP
rs1020015993 6462 dbSNP
rs967311193 6488 dbSNP
rs1424218877 6516 dbSNP
rs1032353777 6517 dbSNP
rs182615805 6519 dbSNP
rs1019197339 6527 dbSNP
rs149623464 6542 dbSNP
rs964894641 6560 dbSNP
rs1404187566 6564 dbSNP
rs956220116 6569 dbSNP
rs1437466046 6574 dbSNP
rs772384478 6578 dbSNP
rs1132794 6582 dbSNP
rs548002021 6598 dbSNP
rs920565590 6599 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUACACGACGAu 5'
                   |||| ||||||| 
Target 5' -------ucUUAUUUGCUGCUa 3'
1 - 15
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000395076.4 | 3UTR | UCUUAUUUGCUGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.751 1.8e-5 0.673 2.2e-4 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.704 2.7e-4 0.741 9.3e-5 20 Click to see details
GSE19536 Breast cancer 0.263 4.1e-3 0.270 3.3e-3 100 Click to see details
GSE19783 ER- ER- breast cancer 0.273 7.5e-3 0.249 1.3e-2 79 Click to see details
GSE19350 CNS germ cell tumors 0.66 9.8e-3 0.455 6.9e-2 12 Click to see details
GSE38226 Liver fibrosis -0.483 1.3e-2 -0.343 6.4e-2 21 Click to see details
GSE21032 Prostate cancer 0.193 4.0e-2 0.180 5.2e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.338 4.9e-2 0.123 2.8e-1 25 Click to see details
GSE21849 B cell lymphoma 0.162 2.0e-1 0.193 1.6e-1 29 Click to see details
GSE28260 Renal cortex and medulla -0.22 2.4e-1 -0.264 1.9e-1 13 Click to see details
GSE28544 Breast cancer -0.131 2.7e-1 0.056 4.0e-1 24 Click to see details
GSE17498 Multiple myeloma -0.092 2.9e-1 -0.108 2.5e-1 40 Click to see details
GSE27834 Pluripotent stem cells 0.151 2.9e-1 0.079 3.9e-1 16 Click to see details
GSE17306 Multiple myeloma 0.076 3.0e-1 0.110 2.3e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.049 3.2e-1 -0.062 2.8e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.092 3.3e-1 -0.056 4.0e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.044 4.1e-1 0.191 1.5e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.031 4.4e-1 0.022 4.6e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.015 4.7e-1 0.202 2.0e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.003 4.9e-1 0.006 4.8e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.003 4.9e-1 0.006 4.8e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.619 0 -0.618 0 32 Click to see details
BRCA 0.289 0 0.165 0.07 84 Click to see details
THCA -0.328 0.01 -0.388 0 59 Click to see details
BLCA -0.508 0.02 -0.531 0.01 18 Click to see details
LUAD -0.57 0.03 -0.490 0.05 12 Click to see details
KIRP -0.308 0.04 -0.272 0.07 32 Click to see details
LIHC -0.205 0.08 -0.184 0.1 49 Click to see details
COAD -0.461 0.13 -0.667 0.04 8 Click to see details
HNSC -0.15 0.17 -0.200 0.1 42 Click to see details
PCPG -0.856 0.17 -1.000 0.5 3 Click to see details
PRAD -0.136 0.17 -0.094 0.26 50 Click to see details
ESCA -0.28 0.2 -0.345 0.15 11 Click to see details
CHOL -0.289 0.23 -0.083 0.42 9 Click to see details
CESC 0.657 0.27 0.500 0.33 3 Click to see details
KICH 0.122 0.28 0.181 0.19 25 Click to see details
UCEC 0.127 0.3 0.028 0.45 19 Click to see details
LUSC -0.073 0.33 -0.064 0.35 38 Click to see details
KIRC -0.014 0.45 -0.007 0.48 68 Click to see details
PAAD 0.015 0.49 0.000 0.5 4 Click to see details
PAAD 0.015 0.49 0.000 0.5 4 Click to see details
PAAD 0.015 0.49 0.000 0.5 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1