miRTarBase - #MIRT212604 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RBPJ   
Synonyms AOS3, CBF1, IGKJRB, IGKJRB1, KBF2, RBP-J, RBPJK, RBPSUH, SUH, csl
Description recombination signal binding protein for immunoglobulin kappa J region
Transcript NM_005349   
Other Transcripts NM_015874 , NM_203283 , NM_203284   
Expression
Putative miRNA Targets on RBPJ
3'UTR of RBPJ
(miRNA target sites are highlighted)
>RBPJ|NM_005349|3'UTR
   1 CTACCGTCTTTTTGCTAGGACTTAAACTGACTTGAGTGTGGCAAAAAGTTAACAAAAAAGGAGAAAAAATGAACAATCGT
  81 TTGTGGTTTCTTGGGAAAACTTTTCATACCAGGTGATACTATTCAAAAACCCCGTTGTCTCCCTGCAAGTGCTGATTTGA
 161 AATGCAGAAGCCACAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAATCAAAATGTATAAATATTGGAAATCA
 241 AGTTTTTCAGCTGTTTTGTTGGTTGGTTGGTTGGTTTTTGTTTGGTTTTGTTTAAATGGGCAAGAAGTAAATAATGTGGC
 321 TGGAATACAAGTTGAACAAACTAGAAGACACAAATCTAACATAGTTTTTATGGACCAAGGAACTTGTATATTGTATAAGC
 401 TTTAGTAAAAGGTACATTTTCACCATACCTTTTTTTATATCACGGTATTATAGTACACCTTGTTACCAAATAGGTTGTTC
 481 TCTTCCCCACCCACCTTTGAGCTTTTGCTCTAAAATACATTCAGGTTCCAAGCCTGACCATCCTTGTTTAATCTATCATA
 561 CTCTTCCAGGTTTTTTTTTTTTGGTCTAAGGCTGGAACTTTTTTCTTTTTTTTCAGCTGAAGTCTTATGACTTTTCATGA
 641 GTCAAAATTGTTTGGATTTCAGCAAGTCAAATCTTGCAAAGGCCTGCATATTTTTTTTAAGATTATATGAAGTCTGTGCA
 721 AAAGCTTTAAAAAAATGCCTCTGCCTTGCCTGCAATACATGCAATGTATGTTAACTTAGTCTCTCTTCTCAGACACTGTT
 801 GGTAGTTATTTCTGTGTTTTCCTTTTTTTAAAAAAAAATATGGACTTATTGTGGTTATCTGAGAGGTTCTAACATTCACA
 881 TGCAATTTGGTGTGGCCATTTAGCTATTAATGAGTTAATGGCGCAGAACTTGTTGATATTTGAAGTGTTCTCTCCCCTTT
 961 TCCCATGACGTAAATACATAGGTGTGTTCCAGGATTTGTTCAGGTTTTTCCCCCCTCCTAATCTTGTACATAACTTGTAT
1041 TATGTGTAAGTTAAACATTTTATTTTGAACTTGGAATGTTCCCAGTGATTTCATTCAGCAGGGTATTTTCTGCCTTGTTG
1121 GCAAGTGACAAAAAATATGGGAAGTATTTGCTACCAGTTGGTAGATGGTGCCCTTAATGGTAGAATGAGGAAAATGTCCG
1201 CAAAAGCATGTTTTATTATCTTTACTTTTTTGGGGGGTTGGAGGGGGTAGCCTAGCCAGAACATCATTGTAATCTTAAAA
1281 CATAAGATGCTTTTATTAGATGATCAACTAAAATAGCTGGAAGACAGTACTTTAGAAACAGATAGTTGTAAGATTATAAA
1361 ATGCAAATGTAACTTATGTTTTCATTTTTTTCTCTGCCTTTTTTGTTTGTTTGTTTTCTCTTTTCCAGTACTGAGCATCT
1441 CCACAAATGTCTCCTAACTCAGAAAATGTTTCTTTTCTTTTCAGTTGAGATTTGGTTGCATTCAGGGTTGTAGGTTGGCC
1521 TTGCTTGCTAACCCCGCCGGTTTTACCGTGCTTTCATTCCTGAACTTTGTTTATGCCTTTGTTTGGTTTCTTCGAAATTG
1601 CAGCAGACTCATTGGGCTACATTTAGTACAGGAACCACGTGTGTAATGTTATACAACACAGTCTAGTAATACAATCATCC
1681 CTCTTAGAGTAAAAACTACCTCTAGATTGTGGTAAGCTTTTACTGTCCCATAAAACAGGAGCCACAGTACCTTATGAATG
1761 CAAAACTGTAACTTCCTACAGTGTTTCCCTACAGAACATTGTCTTTCTGGTGTCCTGGGCTGTTTTGAAAAAGTTTCCAT
1841 TAATAGACTTTTTAGAAATTATTATTAGTAGCATTTTTTTTCCAGCTTTGCTGTCTTCATCACTCACTCTATGCTCAGAC
1921 TATGCCACTGTAAATATTCTTCCTAACATCTTTAAATCGCCTTTTCCTCAGTTTTCAAGGGGAAGGTCATTTGTAAAGCA
2001 CGTTAGGTGGTTAAATCAGTTATTGCGGTTTTCTCTTACTGCAAGCCTTTTTAATCACCCCCAGGCTGCATTTTATTCTA
2081 TATCGCCTTTTTTCTTCAAATCTGCTCCAATCACTCACTTCTCTCTTATAAGCTAATCCTGCCTCACACCTTAAATCTGT
2161 TTCAGTGATCAAGGGCAGAACTCATTGTGGCCTTATCTTTCTTTGTTGTAATTGTTCACTGTCTCTTTCTTACAGACCAC
2241 TTATTTCTGAGTAGTAGTTATTCCTCTCTATGGAGTCATGGCAGGAATCATTACACAGTGCTTTTGTTCAGAGCATGGAC
2321 ATGTTCCTAGTGCTGCTTTGCTTTAACGGCCACAAGTTTCCTCCACTTCCTAGGTTTGGTATTTAGTTAAGGAATCATAT
2401 TAAATTAACCAATAACAAAAGAGATACTTTTGAAGAACAAACTATTCCTTACCCATTTTTGTAGCTCAAAAATAATTTTT
2481 CAAGTTCATGACCTTATTAAAATGAACTTGTGTTTTTTTAACAAACATGTATGTTTTATTTTGATAGTTTCTTTCCGTAA
2561 GATAATTGAAATATTATACTGTAAACCCTTTTCTTTTCTTTTTTTGAAAAGTCCAAGAATGTACTTATACAGGCATTTTT
2641 CCCCACCTATTTTTGGCCATTCTCATACCACAGACTAAAGAGTGAAATGATTTGTCCATTGTAGCTTATTGTTTATCAGT
2721 AGTTCTTTTGTCAGCTGCTTACATTTTTTCTTTCATGGTTTTGTGAATCATTTTCAGTATGTAATTTATAGGAACCTTGT
2801 CCTCTGGTTATAGTAGACTGTGTGCCCTCCTCCAGTGATGGCATTATTAGACATGCTGGTCATTTACCCTCAGAAAGACT
2881 CTCTTATTAGAATGGTGAGTGCTTCAGTTATAGTATGTTTGAATTTTTAAAAAATTCTGTTTTAGAAATGTATCTTATGC
2961 TCTCATGACTATGCAGTTTCTAAACATACACATAGAAGCTGAGTCTCTGATCCAATATGTTTTTATTTGTTCCATTTAAT
3041 TTATCACATAGATTGGGAAGGCAAGCTAAAAGCCTTAAAAATGCCCTTTATATTTTGAGTGATTTCAGCGTTGAACACTA
3121 GTATACTATCTAAATTTGCTGCTCACTTTCTTTAAACTGTGGCAATTAAAGGCATGTTTATACATGACTTAATCGTGAAA
3201 TGTTTGTCACTCTTACTGCACAGACTTATCTGCAATCATAACTGGTTAGTTTTTTTGTTTTGTTTTGTTTTATTGTTTTT
3281 AATGAAACTGGTACCATCTGTGCTTTCACAAAAAACTTCCAATGCCATTTTTGAGAACTAACCTAACTAGTCATGCTAAC
3361 CAGAAAATCCACTGGGGAGGAGGTTCCTTTTGAAACAAAATGCTGTTCAGTTAGTAACCAAGTTACTTTGATTGCAAAAG
3441 CAGCTGTGTTTCTGATAAGTACTGAACAAATGTGTGTAATTTTCTGTGCCAGACTTATGACTTTGTTTTCAAGCACTGTA
3521 ATGTGGGATGGATGGTTAGAAACAATAATATATTAGGGTTTCTGTTTAACCCTTTCAGGACTGAACTGTATCTCCTTTTG
3601 TTAATTTTCCCCTGTGTTGTGATAAATGTTTGCCAGCATTCAGTACTGTGTTGGTCCAGATGTAGGTTTATATGCTCATT
3681 TTTAGCTTATTTCTTGTACCTTGCAGCATGCTCTACGCATTCAGTCCTTAAGGGGTTTATTTTACAAACTGTGCGCCTGT
3761 AAGGTTTATTAGCAATAAGATAGAAAATTGAGCAAGTTTATACCATAATTTTGTAGAAAAAAAGAATCTGCTCAGTTCCA
3841 TATTTCATCCGTGAAAAACTTGCAATACGAGCAGTTTCAAGGAATAAATAAAAAGGAAATGTAAACCATTGTAAAAGTCT
3921 TCTGTCGAATGTGCCTGATGCATGTATTATCGTCTTTTATTTCAGAATACTTCATAAAGATAAAATTAAATTCTATATTA
4001 TAGTTGGTGTATTTACAATCTTACCATGTACATCACATCAAAGTGATAGCTCTACTAATTTAATTTCCTTGTCAATGTTT
4081 TTAACTATATAGTGCTTTAAAGAGATTTTTTTTCCCTGTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-A--UACACGACGAu 5'
            :| ||:|| |  || ||||||| 
Target 5' agTATACTATCTAAATTTGCTGCTc 3'
3120 - 3144 158.00 -10.30
2
miRNA  3' guGUUUGGUA-----AUA-----CACGACGAu 5'
            ||:| |||     |:|     |||||||| 
Target 5' ttCAGAGCATGGACATGTTCCTAGTGCTGCTt 3'
2307 - 2338 152.00 -18.00
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ::|| ||  |  |||||:| 
Target 5' ttTGAAACA--AAATGCTGTTc 3'
3389 - 3408 132.00 -6.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1187156 81 ClinVar
COSN30501843 10 COSMIC
COSN31554723 49 COSMIC
COSN31492100 57 COSMIC
COSN30107496 71 COSMIC
COSN30100636 94 COSMIC
COSN15661788 193 COSMIC
COSN31133077 195 COSMIC
COSN28713509 206 COSMIC
COSN20099937 216 COSMIC
COSN5566968 395 COSMIC
COSN30544089 400 COSMIC
COSN31568425 442 COSMIC
COSN31608257 445 COSMIC
COSN20099938 583 COSMIC
COSN17986385 1532 COSMIC
COSN30383510 1549 COSMIC
COSN26318290 2089 COSMIC
COSN7635964 2609 COSMIC
COSN23638071 2718 COSMIC
COSN21768133 2761 COSMIC
COSN5566969 2991 COSMIC
COSN25034558 3013 COSMIC
COSN21876676 3073 COSMIC
COSN26715492 3351 COSMIC
COSN30344860 3401 COSMIC
COSN15863267 3870 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs368717046 6 dbSNP
rs372595077 7 dbSNP
rs1371501612 10 dbSNP
rs1020925084 17 dbSNP
rs748664003 17 dbSNP
rs866532092 21 dbSNP
rs763013895 22 dbSNP
rs1306445569 25 dbSNP
rs1351827553 28 dbSNP
rs1397211249 30 dbSNP
rs770058789 32 dbSNP
rs768859401 34 dbSNP
rs1366919533 35 dbSNP
rs185229282 36 dbSNP
rs1163624896 39 dbSNP
rs1231940798 43 dbSNP
rs1472284061 46 dbSNP
rs1299706373 49 dbSNP
rs1342661041 50 dbSNP
rs1204173441 51 dbSNP
rs1185936601 54 dbSNP
rs1366325275 54 dbSNP
rs1252902928 64 dbSNP
rs1386322350 64 dbSNP
rs979726338 77 dbSNP
rs752802924 78 dbSNP
rs557915044 80 dbSNP
rs77760317 81 dbSNP
rs139206085 91 dbSNP
rs1334868278 98 dbSNP
rs571007380 99 dbSNP
rs1268098965 109 dbSNP
rs1463919328 113 dbSNP
rs1207326496 114 dbSNP
rs1262866526 119 dbSNP
rs1287431661 122 dbSNP
rs573982434 125 dbSNP
rs1442071315 127 dbSNP
rs781294643 130 dbSNP
rs752929590 134 dbSNP
rs1388211941 135 dbSNP
rs1453942243 138 dbSNP
rs944912748 138 dbSNP
rs1475599233 141 dbSNP
rs1158489948 147 dbSNP
rs1181877809 151 dbSNP
rs866741172 168 dbSNP
rs1409740312 173 dbSNP
rs1058022 174 dbSNP
rs1455279022 175 dbSNP
rs1036490908 176 dbSNP
rs1158972520 178 dbSNP
rs1199757330 178 dbSNP
rs1245085985 178 dbSNP
rs1275361380 178 dbSNP
rs1319674561 178 dbSNP
rs1325650404 178 dbSNP
rs1328859339 178 dbSNP
rs1373287080 178 dbSNP
rs1382477991 178 dbSNP
rs1387430913 178 dbSNP
rs1431818737 178 dbSNP
rs1435589076 178 dbSNP
rs1455971139 178 dbSNP
rs1457890690 178 dbSNP
rs1477961641 178 dbSNP
rs897964346 178 dbSNP
rs1289236648 179 dbSNP
rs1401162256 187 dbSNP
rs1393952448 188 dbSNP
rs1247626733 189 dbSNP
rs1314290729 191 dbSNP
rs770327838 192 dbSNP
rs930923223 192 dbSNP
rs1278995193 193 dbSNP
rs1218595894 194 dbSNP
rs201279979 194 dbSNP
rs1049753052 195 dbSNP
rs1318132249 196 dbSNP
rs1364097813 196 dbSNP
rs1227301050 197 dbSNP
rs1240374085 197 dbSNP
rs1361284928 198 dbSNP
rs1335226452 199 dbSNP
rs1414438706 199 dbSNP
rs1389557694 200 dbSNP
rs1423655858 200 dbSNP
rs1186921803 201 dbSNP
rs1446616060 202 dbSNP
rs865794885 202 dbSNP
rs1285900631 204 dbSNP
rs372992565 205 dbSNP
rs1181695025 206 dbSNP
rs1205703120 206 dbSNP
rs1294708094 206 dbSNP
rs1340860697 206 dbSNP
rs202057048 206 dbSNP
rs1247759090 207 dbSNP
rs1379402202 212 dbSNP
rs1241726873 214 dbSNP
rs1378759209 215 dbSNP
rs1480834509 216 dbSNP
rs1447745436 217 dbSNP
rs1479045978 221 dbSNP
rs904881909 221 dbSNP
rs1344701729 222 dbSNP
rs1199058982 223 dbSNP
rs1259932058 225 dbSNP
rs1486112602 226 dbSNP
rs1002264865 227 dbSNP
rs1181634408 230 dbSNP
rs1056261183 231 dbSNP
rs1249623274 231 dbSNP
rs542628478 232 dbSNP
rs1159682606 235 dbSNP
rs374343477 239 dbSNP
rs1471690820 240 dbSNP
rs138284583 242 dbSNP
rs1009283711 252 dbSNP
rs1234338611 252 dbSNP
rs541259594 254 dbSNP
rs1224040337 258 dbSNP
rs540043701 258 dbSNP
rs756331122 258 dbSNP
rs756326184 262 dbSNP
rs1322009578 263 dbSNP
rs1020810394 271 dbSNP
rs1377446040 275 dbSNP
rs778002342 300 dbSNP
rs1376890136 322 dbSNP
rs1290540728 323 dbSNP
rs1411004097 329 dbSNP
rs564272393 341 dbSNP
rs1306324961 342 dbSNP
rs968259532 343 dbSNP
rs1000809578 347 dbSNP
rs1464393890 361 dbSNP
rs1403768272 371 dbSNP
rs563879848 384 dbSNP
rs367624709 394 dbSNP
rs1249511388 408 dbSNP
rs1201041071 422 dbSNP
rs1408838789 426 dbSNP
rs1245561163 430 dbSNP
rs796395066 431 dbSNP
rs1318305261 437 dbSNP
rs1270461694 440 dbSNP
rs550060341 444 dbSNP
rs1329151446 451 dbSNP
rs1374810484 457 dbSNP
rs1388977364 467 dbSNP
rs1368430046 470 dbSNP
rs1393675156 475 dbSNP
rs911853456 491 dbSNP
rs1292977281 497 dbSNP
rs1308382967 503 dbSNP
rs569803067 508 dbSNP
rs1456501237 518 dbSNP
rs1232629611 520 dbSNP
rs755112194 524 dbSNP
rs528903656 526 dbSNP
rs1433653222 529 dbSNP
rs919450446 534 dbSNP
rs1188915563 539 dbSNP
rs1466022519 542 dbSNP
rs930789266 543 dbSNP
rs201666085 545 dbSNP
rs1207639100 550 dbSNP
rs1464740320 551 dbSNP
rs1266575995 553 dbSNP
rs1049348882 556 dbSNP
rs1313270898 559 dbSNP
rs926861039 562 dbSNP
rs1217532852 564 dbSNP
rs937700244 565 dbSNP
rs1056146607 567 dbSNP
rs1304329180 571 dbSNP
rs1466274368 571 dbSNP
rs777521133 571 dbSNP
rs1481636899 579 dbSNP
rs548533854 580 dbSNP
rs74654941 583 dbSNP
rs1177821418 584 dbSNP
rs78114989 585 dbSNP
rs1187564051 592 dbSNP
rs777982743 595 dbSNP
rs1266651862 602 dbSNP
rs1260139383 606 dbSNP
rs1447247723 606 dbSNP
rs1202525211 616 dbSNP
rs1483896458 620 dbSNP
rs1431358455 622 dbSNP
rs1255914942 624 dbSNP
rs113516220 629 dbSNP
rs903711830 632 dbSNP
rs1001097798 636 dbSNP
rs1227980986 637 dbSNP
rs1363250162 642 dbSNP
rs1314667282 647 dbSNP
rs749320486 656 dbSNP
rs1378090624 669 dbSNP
rs1301027744 672 dbSNP
rs557976518 682 dbSNP
rs1431496932 689 dbSNP
rs1028278010 691 dbSNP
rs1428727092 693 dbSNP
rs1427482786 699 dbSNP
rs1166281011 719 dbSNP
rs1355887902 720 dbSNP
rs1462091739 729 dbSNP
rs570748774 732 dbSNP
rs1292420576 735 dbSNP
rs954098661 742 dbSNP
rs1367599535 744 dbSNP
rs1424760396 751 dbSNP
rs1439258673 755 dbSNP
rs571801458 756 dbSNP
rs1306101633 760 dbSNP
rs1372122359 765 dbSNP
rs1227983377 766 dbSNP
rs1337759307 774 dbSNP
rs1267464014 776 dbSNP
rs1245723553 779 dbSNP
rs1339680652 780 dbSNP
rs1008065481 795 dbSNP
rs1411634084 796 dbSNP
rs749464769 805 dbSNP
rs1309462194 815 dbSNP
rs1407447636 819 dbSNP
rs965992785 823 dbSNP
rs11549569 830 dbSNP
rs1368284540 830 dbSNP
rs1457049475 830 dbSNP
rs557658381 831 dbSNP
rs1487469950 838 dbSNP
rs77336243 839 dbSNP
rs1253147512 840 dbSNP
rs1253423934 841 dbSNP
rs1436167866 842 dbSNP
rs772139496 843 dbSNP
rs1448683303 848 dbSNP
rs1186415927 850 dbSNP
rs1229992165 852 dbSNP
rs1421277794 858 dbSNP
rs1428740044 861 dbSNP
rs1287651178 868 dbSNP
rs1236720033 869 dbSNP
rs926772484 879 dbSNP
rs1323595201 881 dbSNP
rs536680200 884 dbSNP
rs938254576 886 dbSNP
rs1388104067 890 dbSNP
rs1324363689 891 dbSNP
rs1159105226 893 dbSNP
rs746427416 897 dbSNP
rs553381355 900 dbSNP
rs573425542 919 dbSNP
rs6816542 923 dbSNP
rs565340668 924 dbSNP
rs111226502 928 dbSNP
rs1465192217 944 dbSNP
rs543223027 947 dbSNP
rs903596069 948 dbSNP
rs1215320567 950 dbSNP
rs563612692 952 dbSNP
rs75991297 967 dbSNP
rs147388257 970 dbSNP
rs558919947 971 dbSNP
rs1008116312 974 dbSNP
rs1019471105 977 dbSNP
rs1389881025 979 dbSNP
rs528211077 988 dbSNP
rs1399521246 990 dbSNP
rs1404972781 999 dbSNP
rs1173304418 1005 dbSNP
rs1477744386 1006 dbSNP
rs1393281892 1010 dbSNP
rs184000400 1015 dbSNP
rs1450276364 1016 dbSNP
rs6821440 1019 dbSNP
rs1464374237 1024 dbSNP
rs368416441 1030 dbSNP
rs1026438727 1031 dbSNP
rs1213356921 1038 dbSNP
rs1444120903 1047 dbSNP
rs1279237692 1049 dbSNP
rs139433898 1074 dbSNP
rs1345148576 1077 dbSNP
rs1276106656 1079 dbSNP
rs1228736483 1081 dbSNP
rs1363983410 1081 dbSNP
rs984860767 1083 dbSNP
rs1429061613 1089 dbSNP
rs1034279548 1103 dbSNP
rs1411038324 1104 dbSNP
rs1475925927 1114 dbSNP
rs1335463071 1122 dbSNP
rs1164982801 1130 dbSNP
rs1419283989 1138 dbSNP
rs1373737653 1139 dbSNP
rs1170527974 1140 dbSNP
rs959506551 1141 dbSNP
rs1389767657 1151 dbSNP
rs1184629043 1158 dbSNP
rs992436865 1159 dbSNP
rs918164355 1169 dbSNP
rs1347262994 1174 dbSNP
rs1186792366 1184 dbSNP
rs945062364 1197 dbSNP
rs76994449 1200 dbSNP
rs1302523490 1207 dbSNP
rs936431167 1230 dbSNP
rs1229622680 1232 dbSNP
rs1049466764 1233 dbSNP
rs1416760188 1235 dbSNP
rs889638217 1237 dbSNP
rs550879519 1240 dbSNP
rs768474893 1242 dbSNP
rs1354085136 1251 dbSNP
rs1328395077 1257 dbSNP
rs1309998035 1261 dbSNP
rs773131621 1263 dbSNP
rs943860325 1268 dbSNP
rs1040974922 1276 dbSNP
rs1168617647 1283 dbSNP
rs762848010 1288 dbSNP
rs1414311861 1291 dbSNP
rs994060191 1296 dbSNP
rs1026741823 1311 dbSNP
rs189138804 1318 dbSNP
rs191447888 1319 dbSNP
rs1230631618 1331 dbSNP
rs1255022557 1334 dbSNP
rs1486442097 1340 dbSNP
rs1291094793 1346 dbSNP
rs1233041737 1368 dbSNP
rs1333422151 1370 dbSNP
rs1290757785 1378 dbSNP
rs1188132642 1391 dbSNP
rs1372737699 1392 dbSNP
rs1296493974 1395 dbSNP
rs1033752409 1399 dbSNP
rs1470089675 1402 dbSNP
rs1157294526 1406 dbSNP
rs1325056670 1409 dbSNP
rs1410755850 1410 dbSNP
rs1401696612 1414 dbSNP
rs959558848 1417 dbSNP
rs540693331 1421 dbSNP
rs553446718 1427 dbSNP
rs1282020402 1429 dbSNP
rs992322519 1439 dbSNP
rs1373943334 1443 dbSNP
rs1405212162 1450 dbSNP
rs1192403808 1453 dbSNP
rs1436743599 1454 dbSNP
rs1025107647 1456 dbSNP
rs1245764474 1463 dbSNP
rs1211361418 1473 dbSNP
rs1467426670 1476 dbSNP
rs966956375 1488 dbSNP
rs1209947893 1491 dbSNP
rs1316821504 1495 dbSNP
rs1313572872 1499 dbSNP
rs1349893519 1502 dbSNP
rs1439971876 1507 dbSNP
rs1221013093 1508 dbSNP
rs1302970970 1511 dbSNP
rs1438923737 1513 dbSNP
rs978337031 1519 dbSNP
rs1320939907 1521 dbSNP
rs1453026831 1531 dbSNP
rs982485196 1532 dbSNP
rs1373939712 1536 dbSNP
rs1393897872 1537 dbSNP
rs924958983 1537 dbSNP
rs555844666 1540 dbSNP
rs1218488368 1541 dbSNP
rs1187459937 1546 dbSNP
rs936330825 1547 dbSNP
rs1277922278 1548 dbSNP
rs573285784 1549 dbSNP
rs1349608160 1565 dbSNP
rs1312874525 1586 dbSNP
rs985642826 1594 dbSNP
rs575700172 1595 dbSNP
rs1367586864 1598 dbSNP
rs1298135675 1600 dbSNP
rs910964164 1608 dbSNP
rs74931548 1609 dbSNP
rs1183317469 1613 dbSNP
rs77598726 1618 dbSNP
rs1470794617 1621 dbSNP
rs918386211 1622 dbSNP
rs183713130 1625 dbSNP
rs1390400474 1630 dbSNP
rs1200089246 1638 dbSNP
rs112525004 1639 dbSNP
rs1174455505 1640 dbSNP
rs1260030674 1642 dbSNP
rs1370152520 1642 dbSNP
rs112056315 1661 dbSNP
rs754065620 1662 dbSNP
rs573925445 1675 dbSNP
rs757463139 1682 dbSNP
rs1486269512 1683 dbSNP
rs1006210142 1684 dbSNP
rs879743433 1686 dbSNP
rs1344661193 1699 dbSNP
rs1275624813 1700 dbSNP
rs1226895242 1713 dbSNP
rs1408327654 1715 dbSNP
rs1314559136 1718 dbSNP
rs1396587004 1724 dbSNP
rs1354729100 1727 dbSNP
rs544577303 1728 dbSNP
rs1411132232 1745 dbSNP
rs1370577397 1746 dbSNP
rs1166989133 1756 dbSNP
rs1330963979 1759 dbSNP
rs1355113170 1769 dbSNP
rs542504013 1777 dbSNP
rs1435595531 1778 dbSNP
rs1167315649 1781 dbSNP
rs559181038 1789 dbSNP
rs779305075 1795 dbSNP
rs769351650 1802 dbSNP
rs1301001177 1805 dbSNP
rs143464793 1808 dbSNP
rs1186341241 1815 dbSNP
rs191951762 1826 dbSNP
rs1296473118 1829 dbSNP
rs1337022998 1834 dbSNP
rs565027775 1835 dbSNP
rs1195475155 1837 dbSNP
rs530501536 1840 dbSNP
rs1267056037 1841 dbSNP
rs73126675 1854 dbSNP
rs1000210622 1858 dbSNP
rs563602526 1858 dbSNP
rs1213561005 1868 dbSNP
rs1032580830 1874 dbSNP
rs957976668 1874 dbSNP
rs1389371620 1875 dbSNP
rs985141595 1897 dbSNP
rs183759428 1909 dbSNP
rs780641921 1912 dbSNP
rs536804878 1917 dbSNP
rs1372781947 1919 dbSNP
rs1473834839 1929 dbSNP
rs918440234 1931 dbSNP
rs1181159464 1938 dbSNP
rs1417626081 1941 dbSNP
rs1169730142 1951 dbSNP
rs148679474 1959 dbSNP
rs1420249777 1961 dbSNP
rs1467888690 1963 dbSNP
rs1270997734 1985 dbSNP
rs1210564579 1990 dbSNP
rs1351288253 1993 dbSNP
rs1048821235 1999 dbSNP
rs1236243686 2008 dbSNP
rs909794820 2010 dbSNP
rs937215174 2018 dbSNP
rs1323766570 2025 dbSNP
rs1396561133 2027 dbSNP
rs567143985 2028 dbSNP
rs1055135143 2030 dbSNP
rs895116285 2055 dbSNP
rs1158430260 2058 dbSNP
rs1386308386 2058 dbSNP
rs747424790 2059 dbSNP
rs1229083249 2062 dbSNP
rs1013693051 2085 dbSNP
rs768292764 2086 dbSNP
rs1194540043 2088 dbSNP
rs1354990534 2096 dbSNP
rs1046498203 2104 dbSNP
rs902708092 2108 dbSNP
rs776279034 2110 dbSNP
rs1447576534 2122 dbSNP
rs1271883089 2124 dbSNP
rs999690868 2129 dbSNP
rs1203249065 2130 dbSNP
rs1346531382 2133 dbSNP
rs1280366674 2139 dbSNP
rs1233162061 2140 dbSNP
rs1368307650 2148 dbSNP
rs1033048004 2150 dbSNP
rs1433332637 2154 dbSNP
rs1214782235 2163 dbSNP
rs565138219 2167 dbSNP
rs958317902 2169 dbSNP
rs1261391477 2180 dbSNP
rs1434403090 2182 dbSNP
rs1393491581 2184 dbSNP
rs1170642545 2186 dbSNP
rs1475624967 2187 dbSNP
rs1241253099 2191 dbSNP
rs1190972709 2193 dbSNP
rs1445511815 2194 dbSNP
rs1444034526 2196 dbSNP
rs1195538249 2207 dbSNP
rs1373752548 2224 dbSNP
rs186932258 2229 dbSNP
rs1474946583 2230 dbSNP
rs1345033440 2236 dbSNP
rs558662468 2238 dbSNP
rs1340540726 2241 dbSNP
rs1269950076 2242 dbSNP
rs1420015234 2247 dbSNP
rs1461832066 2253 dbSNP
rs569359281 2264 dbSNP
rs1313636100 2270 dbSNP
rs375547049 2271 dbSNP
rs532278437 2276 dbSNP
rs1383591250 2280 dbSNP
rs976496968 2281 dbSNP
rs1418575963 2283 dbSNP
rs370466899 2290 dbSNP
rs1318610360 2293 dbSNP
rs918324116 2305 dbSNP
rs1165917315 2310 dbSNP
rs369873826 2319 dbSNP
rs1418491635 2321 dbSNP
rs573509138 2323 dbSNP
rs545995848 2327 dbSNP
rs1253299114 2339 dbSNP
rs759870325 2349 dbSNP
rs542365346 2354 dbSNP
rs1294520388 2367 dbSNP
rs1272821879 2388 dbSNP
rs1213180287 2390 dbSNP
rs1337315202 2391 dbSNP
rs1294455733 2397 dbSNP
rs552865810 2398 dbSNP
rs193234161 2399 dbSNP
rs1260553793 2401 dbSNP
rs1281320056 2404 dbSNP
rs916608152 2420 dbSNP
rs949351412 2421 dbSNP
rs868072536 2428 dbSNP
rs1348940388 2437 dbSNP
rs902593230 2448 dbSNP
rs115663572 2449 dbSNP
rs1164165781 2452 dbSNP
rs1474168536 2454 dbSNP
rs1413598675 2475 dbSNP
rs1177263916 2487 dbSNP
rs1469372727 2489 dbSNP
rs1053966651 2491 dbSNP
rs893938625 2505 dbSNP
rs1223233270 2511 dbSNP
rs1274152005 2513 dbSNP
rs1470121960 2513 dbSNP
rs1007115200 2520 dbSNP
rs1333307134 2521 dbSNP
rs1018465529 2527 dbSNP
rs2788861 2528 dbSNP
rs997802001 2530 dbSNP
rs1485431404 2540 dbSNP
rs1025856719 2555 dbSNP
rs530673920 2557 dbSNP
rs1459866524 2558 dbSNP
rs984246173 2575 dbSNP
rs547881244 2578 dbSNP
rs567761839 2579 dbSNP
rs1405097598 2580 dbSNP
rs1195148882 2588 dbSNP
rs560994029 2588 dbSNP
rs1454425234 2589 dbSNP
rs530341933 2598 dbSNP
rs1016784353 2599 dbSNP
rs1180963394 2600 dbSNP
rs1361954441 2609 dbSNP
rs958508143 2616 dbSNP
rs1467578032 2621 dbSNP
rs991432701 2629 dbSNP
rs917162538 2630 dbSNP
rs949403746 2634 dbSNP
rs1282204473 2643 dbSNP
rs1158871740 2646 dbSNP
rs1374478376 2650 dbSNP
rs1432472862 2663 dbSNP
rs1348851549 2666 dbSNP
rs1302489480 2669 dbSNP
rs1438443723 2675 dbSNP
rs1363735254 2677 dbSNP
rs1314234935 2681 dbSNP
rs1355513872 2695 dbSNP
rs982112450 2698 dbSNP
rs1478200888 2703 dbSNP
rs766043226 2705 dbSNP
rs1174951840 2706 dbSNP
rs923904102 2706 dbSNP
rs1435014632 2708 dbSNP
rs1397161732 2713 dbSNP
rs935443635 2714 dbSNP
rs1171288428 2715 dbSNP
rs1054258309 2718 dbSNP
rs1264253929 2726 dbSNP
rs1306948111 2729 dbSNP
rs1187657227 2730 dbSNP
rs1485813529 2736 dbSNP
rs1261196216 2742 dbSNP
rs1334451821 2749 dbSNP
rs543781045 2751 dbSNP
rs1485999847 2757 dbSNP
rs893999923 2760 dbSNP
rs1279891082 2780 dbSNP
rs1232310427 2781 dbSNP
rs1309075445 2782 dbSNP
rs1295993676 2793 dbSNP
rs1213967493 2803 dbSNP
rs1241637930 2814 dbSNP
rs1359768976 2816 dbSNP
rs1314247870 2818 dbSNP
rs1414872741 2829 dbSNP
rs1261677378 2832 dbSNP
rs1347507015 2835 dbSNP
rs201419023 2844 dbSNP
rs1310727344 2845 dbSNP
rs1463171029 2846 dbSNP
rs1375190076 2856 dbSNP
rs1171545362 2860 dbSNP
rs942861000 2866 dbSNP
rs1422110373 2868 dbSNP
rs1282616577 2870 dbSNP
rs1039969941 2872 dbSNP
rs901432826 2877 dbSNP
rs998357403 2885 dbSNP
rs1481729731 2888 dbSNP
rs1025319596 2889 dbSNP
rs1176643990 2899 dbSNP
rs1248344644 2902 dbSNP
rs1420731901 2903 dbSNP
rs1182339401 2904 dbSNP
rs886750710 2907 dbSNP
rs1452236783 2912 dbSNP
rs1005323023 2913 dbSNP
rs567204348 2914 dbSNP
rs376205854 2916 dbSNP
rs1354313509 2917 dbSNP
rs1392830371 2929 dbSNP
rs774362313 2930 dbSNP
rs1375631351 2935 dbSNP
rs113620477 2936 dbSNP
rs372624680 2936 dbSNP
rs759326850 2936 dbSNP
rs1398490755 2940 dbSNP
rs764223024 2951 dbSNP
rs7684740 2965 dbSNP
rs1393636262 2966 dbSNP
rs1310517051 2969 dbSNP
rs1370679202 2970 dbSNP
rs1185493800 2972 dbSNP
rs1421176753 2974 dbSNP
rs1232502360 2975 dbSNP
rs1305928336 2976 dbSNP
rs971311444 2987 dbSNP
rs756414082 2993 dbSNP
rs10005515 2999 dbSNP
rs1274780652 3004 dbSNP
rs753898773 3006 dbSNP
rs1214297856 3009 dbSNP
rs185415047 3012 dbSNP
rs956903380 3013 dbSNP
rs1249682806 3015 dbSNP
rs1335771254 3016 dbSNP
rs1481608998 3026 dbSNP
rs1196280921 3031 dbSNP
rs1389277513 3038 dbSNP
rs1375203772 3041 dbSNP
rs1328323295 3048 dbSNP
rs1252187249 3055 dbSNP
rs1394393721 3063 dbSNP
rs1466992422 3071 dbSNP
rs1195208665 3073 dbSNP
rs1395317630 3090 dbSNP
rs1364407999 3092 dbSNP
rs1181399689 3100 dbSNP
rs757516221 3111 dbSNP
rs538198437 3114 dbSNP
rs1194021939 3117 dbSNP
rs142221452 3124 dbSNP
rs1265195997 3127 dbSNP
rs1039852767 3129 dbSNP
rs190667028 3151 dbSNP
rs1237578128 3158 dbSNP
rs1259601032 3158 dbSNP
rs1349585876 3176 dbSNP
rs1306181331 3177 dbSNP
rs750571553 3185 dbSNP
rs1332668027 3187 dbSNP
rs1330828683 3195 dbSNP
rs934260651 3196 dbSNP
rs758812895 3209 dbSNP
rs1385823444 3217 dbSNP
rs1158054696 3218 dbSNP
rs536077312 3234 dbSNP
rs1418171638 3236 dbSNP
rs1328264355 3248 dbSNP
rs1397122276 3250 dbSNP
rs1174429488 3253 dbSNP
rs1453596928 3259 dbSNP
rs1368655629 3270 dbSNP
rs1195283266 3280 dbSNP
rs886805574 3286 dbSNP
rs1214190173 3289 dbSNP
rs1213822428 3295 dbSNP
rs1486330618 3296 dbSNP
rs1293583391 3320 dbSNP
rs552728865 3323 dbSNP
rs1233050139 3328 dbSNP
rs368950894 3343 dbSNP
rs1344790976 3351 dbSNP
rs151187925 3356 dbSNP
rs1230330085 3363 dbSNP
rs1309299215 3370 dbSNP
rs1327525669 3375 dbSNP
rs1298051858 3384 dbSNP
rs79630038 3395 dbSNP
rs1377301168 3397 dbSNP
rs1313744711 3414 dbSNP
rs1422865048 3427 dbSNP
rs1434304258 3427 dbSNP
rs1038161033 3429 dbSNP
rs558777985 3430 dbSNP
rs894231643 3437 dbSNP
rs1012639017 3442 dbSNP
rs1024158447 3444 dbSNP
rs150850979 3445 dbSNP
rs757361291 3445 dbSNP
rs757659908 3445 dbSNP
rs1440322961 3447 dbSNP
rs1215333991 3454 dbSNP
rs1277031792 3455 dbSNP
rs181468241 3456 dbSNP
rs956766484 3460 dbSNP
rs1485370939 3477 dbSNP
rs989887507 3480 dbSNP
rs1217293019 3491 dbSNP
rs915205441 3499 dbSNP
rs1293956584 3501 dbSNP
rs1357645580 3502 dbSNP
rs1447653113 3502 dbSNP
rs1331063716 3508 dbSNP
rs746935363 3514 dbSNP
rs544168885 3515 dbSNP
rs532525385 3527 dbSNP
rs754798175 3547 dbSNP
rs1399216316 3548 dbSNP
rs1168487517 3553 dbSNP
rs1462921316 3555 dbSNP
rs1418012977 3559 dbSNP
rs1186600124 3564 dbSNP
rs1428620528 3565 dbSNP
rs1163510645 3572 dbSNP
rs1417781524 3575 dbSNP
rs1460334240 3576 dbSNP
rs1167623244 3577 dbSNP
rs1350809037 3580 dbSNP
rs1430327387 3584 dbSNP
rs1227816516 3586 dbSNP
rs1287364146 3586 dbSNP
rs964108182 3591 dbSNP
rs1281515399 3596 dbSNP
rs747554472 3597 dbSNP
rs1375929416 3601 dbSNP
rs1329019716 3604 dbSNP
rs975442306 3612 dbSNP
rs184492003 3613 dbSNP
rs1163915607 3616 dbSNP
rs1403117371 3620 dbSNP
rs1409478865 3648 dbSNP
rs540855228 3649 dbSNP
rs780900349 3652 dbSNP
rs1400701304 3661 dbSNP
rs1469284904 3662 dbSNP
rs934137781 3663 dbSNP
rs1177159496 3670 dbSNP
rs747881625 3673 dbSNP
rs1292671942 3678 dbSNP
rs539727399 3679 dbSNP
rs747631697 3684 dbSNP
rs1320033217 3686 dbSNP
rs1235040792 3701 dbSNP
rs1047342774 3705 dbSNP
rs553558030 3706 dbSNP
rs1307268040 3712 dbSNP
rs139319813 3714 dbSNP
rs566947515 3717 dbSNP
rs1292898984 3718 dbSNP
rs1213329300 3728 dbSNP
rs569485686 3730 dbSNP
rs531629885 3735 dbSNP
rs748837458 3736 dbSNP
rs1378106435 3744 dbSNP
rs776800321 3749 dbSNP
rs1186686024 3752 dbSNP
rs1455875845 3755 dbSNP
rs770767403 3756 dbSNP
rs1045490651 3765 dbSNP
rs1487779912 3770 dbSNP
rs1243977092 3781 dbSNP
rs115999380 3787 dbSNP
rs1487969295 3803 dbSNP
rs1284174387 3805 dbSNP
rs1190656033 3806 dbSNP
rs1236720697 3813 dbSNP
rs1348370552 3815 dbSNP
rs1300301488 3816 dbSNP
rs1217460605 3833 dbSNP
rs1363980849 3834 dbSNP
rs1270632353 3841 dbSNP
rs1398864542 3843 dbSNP
rs999088675 3850 dbSNP
rs1314368696 3851 dbSNP
rs568245544 3852 dbSNP
rs1175783769 3856 dbSNP
rs1157300958 3861 dbSNP
rs1432016214 3869 dbSNP
rs188506626 3870 dbSNP
rs1194967788 3881 dbSNP
rs1477554553 3883 dbSNP
rs1420529030 3896 dbSNP
rs1312408184 3897 dbSNP
rs769866790 3900 dbSNP
rs1022268684 3909 dbSNP
rs1483692485 3910 dbSNP
rs1255258223 3913 dbSNP
rs949762561 3914 dbSNP
rs1207767221 3923 dbSNP
rs181306638 3927 dbSNP
rs975496259 3928 dbSNP
rs544542982 3931 dbSNP
rs955605284 3933 dbSNP
rs1415082787 3938 dbSNP
rs1377985595 3943 dbSNP
rs759525354 3945 dbSNP
rs1372457456 3946 dbSNP
rs1464876042 3951 dbSNP
rs929136846 3953 dbSNP
rs1048954049 3970 dbSNP
rs1308873971 3971 dbSNP
rs1421644932 3977 dbSNP
rs887623781 3983 dbSNP
rs1005617308 3986 dbSNP
rs1190145774 3994 dbSNP
rs1424400730 3996 dbSNP
rs1039817533 3998 dbSNP
rs941620972 4001 dbSNP
rs538783294 4004 dbSNP
rs1258436467 4008 dbSNP
rs1277623494 4010 dbSNP
rs558602955 4019 dbSNP
rs1210146076 4020 dbSNP
rs1238567908 4025 dbSNP
rs1470011774 4033 dbSNP
rs948355494 4037 dbSNP
rs1310176587 4041 dbSNP
rs1029895706 4045 dbSNP
rs1376046407 4048 dbSNP
rs1332439705 4056 dbSNP
rs776728249 4060 dbSNP
rs1398739551 4078 dbSNP
rs1440596880 4080 dbSNP
rs1458496592 4082 dbSNP
rs999074057 4086 dbSNP
rs575463287 4088 dbSNP
rs1436676331 4093 dbSNP
rs1334842684 4094 dbSNP
rs934390136 4100 dbSNP
rs1238623788 4106 dbSNP
rs199777095 4106 dbSNP
rs35885247 4106 dbSNP
rs373424262 4107 dbSNP
rs62411619 4114 dbSNP
rs62411620 4117 dbSNP
rs1033115992 4124 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUA-A--UACACGACGAu 5'
             | ||:|| |  || ||||||| 
Target 5' ---AUACUAUCUAAAUUUGCUGCUc 3'
1 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine, RNase T1 ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUA-A--UACACGACGAu 5'
            :| ||:|| |  || ||||||| 
Target 5' --UAUACUAUCUAAAUUUGCUGCUc 3'
1 - 23
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000342320.4 | 3UTR | AUACUAUCUAAAUUUGCUGCUCACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000342320.4 | 3UTR | UAUACUAUCUAAAUUUGCUGCUCACUUUCUUUAAACUGUGGCAAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000342320.4 | 3UTR | UAUACUAUCUAAAUUUGCUGCUCACUUUCUUUAAACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000342320.4 | 3UTR | UAUACUAUCUAAAUUUGCUGCUCACUUUCUUUAAACUGUGGCAAUUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.655 8.6e-4 0.737 1.0e-4 20 Click to see details
GSE21032 Prostate cancer 0.327 1.3e-3 0.236 1.6e-2 83 Click to see details
GSE32688 Pancreatic cancer -0.479 2.8e-3 -0.216 1.2e-1 32 Click to see details
GSE38226 Liver fibrosis -0.475 1.5e-2 -0.479 1.4e-2 21 Click to see details
GSE14794 Lymphoblastoid cells 0.222 1.8e-2 0.130 1.1e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.458 3.7e-2 -0.359 8.6e-2 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.288 8.1e-2 0.165 2.2e-1 25 Click to see details
GSE17306 Multiple myeloma -0.195 9.0e-2 -0.196 8.9e-2 49 Click to see details
GSE28260 Renal cortex and medulla -0.383 9.8e-2 -0.264 1.9e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.223 1.7e-1 -0.117 3.1e-1 20 Click to see details
GSE19536 Breast cancer -0.094 1.8e-1 -0.051 3.1e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.171 2.1e-1 0.116 2.9e-1 25 Click to see details
GSE21849 B cell lymphoma 0.139 2.4e-1 0.305 5.4e-2 29 Click to see details
GSE17498 Multiple myeloma -0.082 3.1e-1 -0.029 4.3e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.129 3.4e-1 -0.105 3.7e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.051 4.1e-1 -0.072 3.7e-1 24 Click to see details
GSE21687 Ependynoma primary tumors 0.029 4.1e-1 0.041 3.7e-1 64 Click to see details
GSE28544 Breast cancer 0.031 4.4e-1 0.469 1.0e-2 24 Click to see details
GSE19783 ER- ER- breast cancer -0.007 4.8e-1 -0.017 4.4e-1 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.006 4.9e-1 -0.103 3.2e-1 23 Click to see details
GSE42095 Differentiated embryonic stem cells -0.006 4.9e-1 -0.103 3.2e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.325 0 0.274 0.01 84 Click to see details
CHOL 0.707 0.02 0.567 0.06 9 Click to see details
BLCA -0.389 0.06 -0.379 0.06 18 Click to see details
STAD -0.287 0.06 -0.322 0.04 32 Click to see details
PAAD 0.715 0.14 0.400 0.3 4 Click to see details
PCPG -0.897 0.15 -0.500 0.33 3 Click to see details
KICH 0.207 0.16 0.256 0.11 25 Click to see details
HNSC -0.12 0.22 -0.183 0.12 42 Click to see details
LUSC 0.123 0.23 0.264 0.05 38 Click to see details
LUAD 0.195 0.27 0.266 0.2 12 Click to see details
KIRC 0.071 0.28 0.010 0.47 68 Click to see details
PRAD 0.076 0.3 0.026 0.43 50 Click to see details
KIRP 0.09 0.31 0.064 0.36 32 Click to see details
LIHC 0.067 0.32 0.098 0.25 49 Click to see details
UCEC 0.099 0.34 0.211 0.19 19 Click to see details
THCA -0.048 0.36 -0.088 0.25 59 Click to see details
ESCA 0.066 0.42 0.391 0.12 11 Click to see details
COAD -0.053 0.45 -0.381 0.18 8 Click to see details
CESC -0.094 0.47 -0.500 0.33 3 Click to see details
CESC -0.094 0.47 -0.500 0.33 3 Click to see details
CESC -0.094 0.47 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1