miRTarBase - #MIRT234342 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MSL1   
Synonyms MSL-1, hMSL1
Description male specific lethal 1 homolog
Transcript NM_001012241   
Expression
Putative miRNA Targets on MSL1
3'UTR of MSL1
(miRNA target sites are highlighted)
>MSL1|NM_001012241|3'UTR
   1 CTGTGCTGGCAAGAACCCTGTCTTCAGATAGTTGTAGCATGCCATTCCCGAGAGTGGCAGAGACCTGTATATGTGACCTT
  81 TGTCCTCACATATGTTATCACTCGCTGATAATACCCTTTCATACTTCCTTGACTTTGTTTTCATTACTCTGATTTCACAA
 161 AAACTCTTTCATTCGGCTAATTGTGAGTTATGGAGGGTGATTGGGATTTCTTTTCCCTTTTTTGGGAAATGGGCTCTCAA
 241 GCTAAAGCTATAGGATGGCAGATTCAGAAGTTTCAGGGGTCTGTTTCTATACATTTGCCTATGTTAAAGGGGTAAAAGGG
 321 CTCTCTTCATTAGACATGTGGAAGATGAAGCAGCCCCTTCCTTTAGAGCTGTGCCTGCATGGCACTCTTCTCACCCTGGT
 401 ACACCCTCCTTATAGTGGGTATAGTGATTTTTAACCCTAAAATAAAACAAACAACCTCACCATGAGCTTTAGGACCAGAA
 481 GAGGAATGACAAGTGAAGCGATGAAGCAAGCCATCTTCACAGAGTAGAAAAGACATCGGAGAGTTGGTAGATAACTGTCT
 561 GAAAAGATAGTTGTTCATTTGAAACTATTCTGTGATACAGTCATGTGGGAAGGGATGTTTGGCTGTGATTATTTTTTCAG
 641 TTAATGGATAACAATTTCTTTACTGCTCAAAAACCAAAATCTTTGGAAAAGAAAGTGGGGATGGTTAGTTTCAGAACAAG
 721 TTACAGCTGTAAACAAAAGCACTTAGTATTTGGGATGGCATGCCAAAACCTGTATAAATGTCCTTGTATCACATCACTTC
 801 TCAAGTATTCCTTCATTGGGCTTCATCCTTTTAGCAGAACTCTTGGTGGTGGGATAGAGACTTAGGGAGGGTAGGGGGAG
 881 AGTGTGGAAATAGGTGCTTCCTTTGGCTGGCAAATGTCTACATCTTGAAACAAACAGATGTACCTAATGAGCTTCTCCAT
 961 TCACTTTGTAAAAATAATTTGTATGTGTACCATCTTGGTCCTCTCCCCTCCCGTTTTGTTAAAATATCAGGATAGCACTC
1041 CCAGGCCACTTTGGTCTCAGTGTAAGATCCCTATTAACTATCTGAAAGGAAAATAGAGCCAAGACCTCTGGTCTCAAATA
1121 TATAGGAATTGCCTTTCTTTAGTCTTCAGGACTATTGTGTGAAAACAAGTAGGGGTCTAATCTCCTAGAAGGTAGGGGCT
1201 TTTATCCTTAAAGAGAATATGTCCCCAGATTATTAGCACTTTTAGAGGAGAAGCCAAGGTATGTAGGGTGTGTGGCTGGC
1281 CCATCAGTGGAGCACGAAGAGAGAATGGGATACCATTGTGGGAAGAGAAGAAAAGTTCCTCAGGGGCCTCCCACTGCTAA
1361 AGTTTTTTGTGAGATGTTGATCTGTGCTTCCTGGATTTGACTTTTAAAGGAATTATTCTGGCAGCACATGTAGTATTCTT
1441 GGATGATCTTGCTGCTCTTATTTCTCCTTTTGTGTGTGTGTGTGTGTGTGTGTGGCTATGGGTTTTCATTTGTAACTCCA
1521 TCTGCTTAGGAGAGTGGGCTCTCTATAAGGGAACCTGCTGTAAACTTCATTGCAGCAAGGATGTAGAGAGAAATAGGACT
1601 TAATTCCACTAGGGGCTCTCATCTCACACCTTAAGGAGGAGATTTCTAGAAAAACTGGGCCAGATTTTCTTTGTTCTCCA
1681 TCATTTTAATGTGGCAGGCTGTTCAGTTTTCTTACTCTTACCTATGTGATATTTCTTCGTAACGTGTCCAAAAAGAAAAA
1761 AGACCCAATCAGTGTCTCTTGACTTTGTTCTTTGATCCCTCAGTTTCTTCTTGATTTCAGCATGTGTCGGGTTCCTAATT
1841 TTGGGTATGAGTTAGCAAATTTAACCATTGTGTTTGTGCCCTACCCAGGGGACTCCCCAGTTTCTGACTTGAAGTAGACT
1921 GAGAAGAATCCACGAGGTGCTATCTGGCCAGATTTAAGTAGATTCTATTTCCTTGGTTCTCCCTCTCCCTGAGGACCTCT
2001 TATTTTATTGTCCCCTCTTCTAGGTTAATTCTCCTTTGATTTGACTTTGTTGAGAAGGAGGTTGGACAGTAGATTAGCAA
2081 AGTTCCAAGTGCAAAATTACAGTGTGTTAGAGTGTGGGGGGAAAATTAGTCTTATTTTTCCCTACATGGGATACAACACT
2161 GTGAATTCAATCTTCAACTGAAGGCCCTGCAGTTCTCCTAAAACATAGTTGTTTGTTTTTCTTTAACAAAGTTTAAGCTA
2241 GTGTTAATAAATTAAAAAAAATTGCTTGTCTGTCTACTTCAGCTTTGTTTTATGCCCATTTCATATTGTTGTCTGTGTTG
2321 TAATTCATAACTTTTGATACCATTTCTGATGTGTAAAATTGGTTGTCTTGTAAATATCTTATAAAGAGTTCAATTGTAAA
2401 TAAACTATTGTGGCTGTTAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuggUAAUA-CACGACGAu 5'
                  || ||  ||||||| 
Target 5' attcttggATGATCTTGCTGCTc 3'
1435 - 1457 146.00 -8.70
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||||:|||:|  ||||:| 
Target 5' aaTAAACTATTGT-GGCTGTTa 3'
2399 - 2419 127.00 -21.60
3
miRNA  3' guguUUGGU-AAUACACGACGAu 5'
              ||| | || | | ||||| 
Target 5' ggatAACAATTTCTTTACTGCTc 3'
646 - 668 126.00 -7.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30159718 26 COSMIC
COSN30533761 49 COSMIC
COSN30119766 70 COSMIC
COSN30541273 85 COSMIC
COSN31560753 122 COSMIC
COSN31961324 528 COSMIC
COSN31961325 591 COSMIC
COSN1718964 1108 COSMIC
COSN32056646 1286 COSMIC
COSN16312562 1330 COSMIC
COSN17119574 1473 COSMIC
COSN23198168 1494 COSMIC
COSN20113899 1495 COSMIC
COSN24013548 1831 COSMIC
COSN24912613 2361 COSMIC
COSN24911220 2369 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1315823897 1 dbSNP
rs1298635567 11 dbSNP
rs1330535561 12 dbSNP
rs1208973018 16 dbSNP
rs1292235053 16 dbSNP
rs1267055657 17 dbSNP
rs1230181292 18 dbSNP
rs1463841918 19 dbSNP
rs963270397 20 dbSNP
rs1247624504 21 dbSNP
rs746475660 21 dbSNP
rs1478025518 24 dbSNP
rs1189967173 31 dbSNP
rs1414370227 33 dbSNP
rs770321442 36 dbSNP
rs1400421194 41 dbSNP
rs1304647187 49 dbSNP
rs1363308244 50 dbSNP
rs866778369 50 dbSNP
rs1158741096 51 dbSNP
rs1473885451 52 dbSNP
rs372999457 53 dbSNP
rs1187762890 55 dbSNP
rs1440322960 59 dbSNP
rs1257760121 66 dbSNP
rs1200677557 72 dbSNP
rs1385404511 78 dbSNP
rs1485235582 85 dbSNP
rs1301053595 90 dbSNP
rs557625087 91 dbSNP
rs532146572 93 dbSNP
rs547031311 95 dbSNP
rs982865056 99 dbSNP
rs1231293247 100 dbSNP
rs917923208 104 dbSNP
rs1033237756 105 dbSNP
rs1384317561 113 dbSNP
rs1318664043 124 dbSNP
rs372433035 125 dbSNP
rs1205968148 128 dbSNP
rs1390092822 132 dbSNP
rs1164846088 156 dbSNP
rs1471973818 158 dbSNP
rs1370593094 164 dbSNP
rs1187748728 166 dbSNP
rs1427609940 172 dbSNP
rs957281346 175 dbSNP
rs1009866432 176 dbSNP
rs936925278 179 dbSNP
rs186424223 182 dbSNP
rs1207993671 192 dbSNP
rs1358154509 198 dbSNP
rs536194813 202 dbSNP
rs1245754155 208 dbSNP
rs892666951 215 dbSNP
rs1009311244 218 dbSNP
rs955187871 219 dbSNP
rs986513380 220 dbSNP
rs911078821 231 dbSNP
rs890212588 232 dbSNP
rs1190928873 234 dbSNP
rs963834723 237 dbSNP
rs1389484497 251 dbSNP
rs1429762805 254 dbSNP
rs141810003 265 dbSNP
rs1461171869 267 dbSNP
rs1388004065 274 dbSNP
rs1363288060 275 dbSNP
rs745447621 279 dbSNP
rs930645101 280 dbSNP
rs143770102 295 dbSNP
rs148130269 299 dbSNP
rs1480988727 302 dbSNP
rs1196602531 303 dbSNP
rs1388959072 310 dbSNP
rs777204292 311 dbSNP
rs1267785293 321 dbSNP
rs1453295262 321 dbSNP
rs1295964534 326 dbSNP
rs1339820240 328 dbSNP
rs1272662565 341 dbSNP
rs973324756 345 dbSNP
rs950136914 351 dbSNP
rs1342896086 354 dbSNP
rs1045835456 365 dbSNP
rs1434906116 366 dbSNP
rs1333403659 368 dbSNP
rs1324607150 377 dbSNP
rs906042974 380 dbSNP
rs1001681073 390 dbSNP
rs141692709 393 dbSNP
rs1369101620 396 dbSNP
rs1055120897 399 dbSNP
rs1393933659 404 dbSNP
rs1430028266 404 dbSNP
rs1170363192 407 dbSNP
rs577220587 413 dbSNP
rs893355422 414 dbSNP
rs537886431 417 dbSNP
rs1276820050 429 dbSNP
rs1207529612 444 dbSNP
rs1253730707 444 dbSNP
rs1483526248 445 dbSNP
rs1019989891 448 dbSNP
rs189995437 452 dbSNP
rs574757655 467 dbSNP
rs1217606210 484 dbSNP
rs1347239976 491 dbSNP
rs1275894386 500 dbSNP
rs1007962749 501 dbSNP
rs1348965146 507 dbSNP
rs1221089814 511 dbSNP
rs1017953601 516 dbSNP
rs1374533992 530 dbSNP
rs1266326726 532 dbSNP
rs963846193 538 dbSNP
rs973842115 539 dbSNP
rs1425294806 544 dbSNP
rs762189621 545 dbSNP
rs542184426 552 dbSNP
rs776397401 559 dbSNP
rs1413859710 561 dbSNP
rs1182722034 563 dbSNP
rs951368487 567 dbSNP
rs983084918 572 dbSNP
rs1450037525 579 dbSNP
rs907899321 580 dbSNP
rs950002012 582 dbSNP
rs563945621 590 dbSNP
rs927323609 592 dbSNP
rs182573385 600 dbSNP
rs1165036254 602 dbSNP
rs1279448580 603 dbSNP
rs1208627515 605 dbSNP
rs926667741 610 dbSNP
rs773762079 611 dbSNP
rs187223087 626 dbSNP
rs1459720200 633 dbSNP
rs766776486 641 dbSNP
rs75153767 645 dbSNP
rs1282024596 648 dbSNP
rs751819184 649 dbSNP
rs1449799414 671 dbSNP
rs1359209606 679 dbSNP
rs1317066738 695 dbSNP
rs532155670 697 dbSNP
rs945486869 710 dbSNP
rs1390822532 711 dbSNP
rs1159835300 715 dbSNP
rs547460757 717 dbSNP
rs1411402681 719 dbSNP
rs1300517467 722 dbSNP
rs1180288263 730 dbSNP
rs1051943966 732 dbSNP
rs1473926200 737 dbSNP
rs1238096844 742 dbSNP
rs1188083657 760 dbSNP
rs890170933 775 dbSNP
rs1270503284 777 dbSNP
rs1209938462 789 dbSNP
rs1321442895 792 dbSNP
rs1042351905 793 dbSNP
rs1229641965 802 dbSNP
rs890807300 805 dbSNP
rs1007807254 816 dbSNP
rs759673613 817 dbSNP
rs1432193738 826 dbSNP
rs1323783914 832 dbSNP
rs1366749934 833 dbSNP
rs565575232 835 dbSNP
rs994712028 840 dbSNP
rs529671893 844 dbSNP
rs556577055 847 dbSNP
rs1026843043 851 dbSNP
rs1407293451 856 dbSNP
rs767428356 857 dbSNP
rs951275593 858 dbSNP
rs1447686826 860 dbSNP
rs982732257 872 dbSNP
rs373013241 875 dbSNP
rs750284030 876 dbSNP
rs1189751656 879 dbSNP
rs190505948 883 dbSNP
rs926601813 887 dbSNP
rs1482639471 893 dbSNP
rs1273382252 900 dbSNP
rs1322713649 900 dbSNP
rs1181992540 901 dbSNP
rs1225764417 905 dbSNP
rs1415477377 907 dbSNP
rs1416977740 914 dbSNP
rs958062555 915 dbSNP
rs1365489156 920 dbSNP
rs1295058780 921 dbSNP
rs1436844894 926 dbSNP
rs914120248 936 dbSNP
rs989482339 936 dbSNP
rs536850527 937 dbSNP
rs1392065725 942 dbSNP
rs1411620916 955 dbSNP
rs1253409729 963 dbSNP
rs1433098399 964 dbSNP
rs1423617430 967 dbSNP
rs927272793 968 dbSNP
rs1488989061 970 dbSNP
rs552000388 975 dbSNP
rs150107977 985 dbSNP
rs990623294 988 dbSNP
rs1483857444 990 dbSNP
rs1447361721 991 dbSNP
rs1303540096 993 dbSNP
rs1038823259 994 dbSNP
rs914777645 1005 dbSNP
rs1231968189 1007 dbSNP
rs796152139 1013 dbSNP
rs138543128 1014 dbSNP
rs755954788 1025 dbSNP
rs1226747024 1028 dbSNP
rs1425057655 1032 dbSNP
rs867854077 1035 dbSNP
rs1349622712 1036 dbSNP
rs891342253 1045 dbSNP
rs994430209 1046 dbSNP
rs1276396912 1054 dbSNP
rs1372701518 1063 dbSNP
rs1298973120 1067 dbSNP
rs1465552250 1069 dbSNP
rs1357533251 1070 dbSNP
rs1047398789 1074 dbSNP
rs553408713 1079 dbSNP
rs777662178 1089 dbSNP
rs1238657423 1095 dbSNP
rs753669655 1099 dbSNP
rs1024545516 1106 dbSNP
rs899489511 1107 dbSNP
rs1180926238 1114 dbSNP
rs1481959375 1127 dbSNP
rs969950399 1134 dbSNP
rs1210689440 1135 dbSNP
rs878924708 1138 dbSNP
rs141519435 1139 dbSNP
rs1002695218 1150 dbSNP
rs1027121704 1155 dbSNP
rs1252180868 1156 dbSNP
rs886964746 1176 dbSNP
rs1229938256 1182 dbSNP
rs1350892392 1185 dbSNP
rs1307931607 1189 dbSNP
rs1395694643 1191 dbSNP
rs183217393 1199 dbSNP
rs16965660 1200 dbSNP
rs1470588413 1203 dbSNP
rs970667624 1210 dbSNP
rs1002119585 1216 dbSNP
rs188945615 1218 dbSNP
rs546517310 1221 dbSNP
rs778591417 1226 dbSNP
rs1186367980 1229 dbSNP
rs1034375780 1232 dbSNP
rs112027518 1235 dbSNP
rs1183729377 1240 dbSNP
rs376549357 1244 dbSNP
rs1266094821 1245 dbSNP
rs1464059298 1245 dbSNP
rs1210550769 1269 dbSNP
rs564565181 1270 dbSNP
rs987777798 1271 dbSNP
rs1360906771 1282 dbSNP
rs573370993 1283 dbSNP
rs912046294 1289 dbSNP
rs990266002 1291 dbSNP
rs1307650000 1292 dbSNP
rs1351394836 1296 dbSNP
rs1453396650 1296 dbSNP
rs1039187144 1297 dbSNP
rs914619478 1302 dbSNP
rs1386087362 1309 dbSNP
rs1163104348 1317 dbSNP
rs540798708 1318 dbSNP
rs967577567 1319 dbSNP
rs1369778432 1324 dbSNP
rs920316973 1328 dbSNP
rs1366679231 1331 dbSNP
rs930414177 1331 dbSNP
rs978024968 1332 dbSNP
rs1447554697 1333 dbSNP
rs1266408547 1344 dbSNP
rs1219681018 1345 dbSNP
rs912726442 1348 dbSNP
rs944314506 1349 dbSNP
rs1039919316 1350 dbSNP
rs1014578488 1354 dbSNP
rs745449190 1360 dbSNP
rs930950688 1363 dbSNP
rs1247014275 1365 dbSNP
rs905775704 1369 dbSNP
rs1048146214 1375 dbSNP
rs1196345657 1388 dbSNP
rs1231247591 1391 dbSNP
rs1245296812 1394 dbSNP
rs886824702 1400 dbSNP
rs1327588150 1406 dbSNP
rs1477912895 1408 dbSNP
rs559363679 1413 dbSNP
rs765781668 1417 dbSNP
rs1385384372 1426 dbSNP
rs1393366997 1427 dbSNP
rs1303332033 1430 dbSNP
rs1428762192 1431 dbSNP
rs1387752308 1443 dbSNP
rs958083654 1448 dbSNP
rs1003958117 1462 dbSNP
rs77875570 1467 dbSNP
rs75739124 1469 dbSNP
rs1011026987 1470 dbSNP
rs1020961095 1471 dbSNP
rs112133915 1471 dbSNP
rs1196674584 1471 dbSNP
rs1272552479 1471 dbSNP
rs1340156737 1471 dbSNP
rs1376944676 1471 dbSNP
rs150591830 1471 dbSNP
rs754410709 1471 dbSNP
rs966775947 1473 dbSNP
rs1046302362 1475 dbSNP
rs1371360607 1483 dbSNP
rs906347008 1485 dbSNP
rs987881204 1489 dbSNP
rs192672561 1494 dbSNP
rs1417658318 1499 dbSNP
rs771646243 1501 dbSNP
rs1033570288 1503 dbSNP
rs1019160175 1507 dbSNP
rs965347474 1508 dbSNP
rs1400913242 1513 dbSNP
rs958754430 1517 dbSNP
rs920786436 1525 dbSNP
rs1429724467 1532 dbSNP
rs1363005978 1534 dbSNP
rs1471495045 1536 dbSNP
rs751299384 1539 dbSNP
rs184475273 1542 dbSNP
rs1011955588 1544 dbSNP
rs779387257 1545 dbSNP
rs1021616973 1550 dbSNP
rs983199042 1551 dbSNP
rs1199216763 1558 dbSNP
rs1326363597 1565 dbSNP
rs907529302 1566 dbSNP
rs547736229 1571 dbSNP
rs757892260 1585 dbSNP
rs552673619 1589 dbSNP
rs369248804 1590 dbSNP
rs371592240 1594 dbSNP
rs1349026440 1597 dbSNP
rs1343708505 1608 dbSNP
rs1280890834 1612 dbSNP
rs1442517971 1614 dbSNP
rs1339333810 1620 dbSNP
rs1331702821 1624 dbSNP
rs967904937 1628 dbSNP
rs1406650182 1631 dbSNP
rs949706527 1633 dbSNP
rs1045816193 1634 dbSNP
rs1413930959 1634 dbSNP
rs1207638832 1637 dbSNP
rs146286484 1653 dbSNP
rs1451388667 1656 dbSNP
rs1470659098 1665 dbSNP
rs912757757 1673 dbSNP
rs1222843674 1678 dbSNP
rs1185585785 1679 dbSNP
rs905749125 1685 dbSNP
rs1255415344 1691 dbSNP
rs965487677 1695 dbSNP
rs34676792 1707 dbSNP
rs746510053 1709 dbSNP
rs1462724892 1720 dbSNP
rs1264231732 1724 dbSNP
rs937257169 1730 dbSNP
rs893011482 1736 dbSNP
rs530751541 1739 dbSNP
rs1010995977 1740 dbSNP
rs1021013220 1742 dbSNP
rs754676115 1743 dbSNP
rs921475513 1744 dbSNP
rs112863326 1745 dbSNP
rs1390807819 1748 dbSNP
rs1476437598 1749 dbSNP
rs1161678609 1750 dbSNP
rs1390366836 1756 dbSNP
rs1390527669 1769 dbSNP
rs1019381832 1770 dbSNP
rs139412882 1772 dbSNP
rs1413272720 1775 dbSNP
rs1161687651 1779 dbSNP
rs908200271 1784 dbSNP
rs939790664 1791 dbSNP
rs1046168414 1797 dbSNP
rs1243850572 1801 dbSNP
rs753286381 1815 dbSNP
rs28758455 1821 dbSNP
rs1055052580 1822 dbSNP
rs1216875751 1823 dbSNP
rs893747175 1829 dbSNP
rs1010818987 1830 dbSNP
rs773851736 1832 dbSNP
rs903168766 1846 dbSNP
rs1242063969 1865 dbSNP
rs187963435 1869 dbSNP
rs1019632534 1881 dbSNP
rs1283222644 1887 dbSNP
rs1226082294 1890 dbSNP
rs1364063006 1896 dbSNP
rs1356669293 1898 dbSNP
rs952251920 1900 dbSNP
rs779476082 1906 dbSNP
rs1301477933 1907 dbSNP
rs983585105 1915 dbSNP
rs763471251 1916 dbSNP
rs1385934023 1918 dbSNP
rs546796130 1919 dbSNP
rs907581754 1921 dbSNP
rs80103101 1922 dbSNP
rs1422184398 1925 dbSNP
rs975518942 1934 dbSNP
rs375130547 1935 dbSNP
rs1245392405 1940 dbSNP
rs1224211926 1941 dbSNP
rs1185577825 1946 dbSNP
rs937235807 1953 dbSNP
rs1054415574 1960 dbSNP
rs893063624 1963 dbSNP
rs1473227051 1966 dbSNP
rs1218602661 1977 dbSNP
rs1365204152 1984 dbSNP
rs1285005949 1999 dbSNP
rs1406975103 2017 dbSNP
rs1366360229 2022 dbSNP
rs953116258 2029 dbSNP
rs1307658577 2031 dbSNP
rs1409417908 2043 dbSNP
rs1356375044 2045 dbSNP
rs1171705783 2046 dbSNP
rs1433155620 2049 dbSNP
rs1456511504 2053 dbSNP
rs1202119227 2061 dbSNP
rs984372533 2063 dbSNP
rs1250528982 2074 dbSNP
rs774718302 2086 dbSNP
rs142623456 2087 dbSNP
rs981877137 2089 dbSNP
rs1481301838 2099 dbSNP
rs1251439363 2112 dbSNP
rs1332973025 2113 dbSNP
rs927661720 2114 dbSNP
rs1310425384 2115 dbSNP
rs902574914 2116 dbSNP
rs575700279 2117 dbSNP
rs1449698811 2122 dbSNP
rs754271540 2123 dbSNP
rs540170599 2125 dbSNP
rs1287909651 2126 dbSNP
rs1389937426 2127 dbSNP
rs1375585041 2145 dbSNP
rs1327527783 2155 dbSNP
rs1228232198 2160 dbSNP
rs1298885020 2168 dbSNP
rs1009420274 2178 dbSNP
rs1353525536 2180 dbSNP
rs1404469405 2188 dbSNP
rs1018933658 2194 dbSNP
rs1055406053 2207 dbSNP
rs1420550387 2209 dbSNP
rs900544427 2209 dbSNP
rs893620174 2215 dbSNP
rs1180708902 2224 dbSNP
rs1481989617 2230 dbSNP
rs367704694 2249 dbSNP
rs1204246262 2254 dbSNP
rs1328197005 2254 dbSNP
rs573379990 2255 dbSNP
rs903200442 2262 dbSNP
rs1319014114 2264 dbSNP
rs1190248042 2267 dbSNP
rs1249972800 2269 dbSNP
rs998773074 2277 dbSNP
rs1472134608 2279 dbSNP
rs1395461364 2282 dbSNP
rs1019665140 2283 dbSNP
rs372924007 2286 dbSNP
rs1339215100 2287 dbSNP
rs1004976783 2294 dbSNP
rs1159692551 2297 dbSNP
rs1388328652 2306 dbSNP
rs901300228 2309 dbSNP
rs1455683464 2316 dbSNP
rs1464446602 2323 dbSNP
rs1171944176 2324 dbSNP
rs1442184034 2328 dbSNP
rs971151541 2335 dbSNP
rs996884777 2336 dbSNP
rs540779861 2337 dbSNP
rs1028934699 2341 dbSNP
rs1206614264 2351 dbSNP
rs1486074765 2366 dbSNP
rs926978342 2370 dbSNP
rs767657049 2371 dbSNP
rs1357347414 2375 dbSNP
rs984794645 2378 dbSNP
rs1317305322 2382 dbSNP
rs989825044 2383 dbSNP
rs1289335593 2389 dbSNP
rs752765370 2394 dbSNP
rs1384231638 2398 dbSNP
rs1337926136 2412 dbSNP
rs760773620 2412 dbSNP
rs1015825842 2415 dbSNP
rs79785823 2418 dbSNP
rs1231637490 2429 dbSNP
rs1292556581 2430 dbSNP
rs1422404782 2432 dbSNP
rs961037055 2434 dbSNP
rs1043812 2437 dbSNP
rs1255926857 2444 dbSNP
rs572897969 2448 dbSNP
rs1448362217 2449 dbSNP
rs528611573 2458 dbSNP
rs1195278224 2467 dbSNP
rs944801040 2478 dbSNP
rs1040898016 2481 dbSNP
rs1221989387 2492 dbSNP
rs1482873935 2499 dbSNP
rs1294030563 2501 dbSNP
rs927609189 2517 dbSNP
rs869063238 2522 dbSNP
rs1341579654 2524 dbSNP
rs1268881037 2526 dbSNP
rs937765736 2529 dbSNP
rs900597230 2536 dbSNP
rs1327356197 2538 dbSNP
rs990570270 2548 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' -------------uUGCUGCUc 3'
1 - 9
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BT474
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395166. RNA binding protein: AGO. Condition:BT474 AGO HITS-CLIP Replicate 1 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
CLIP-seq Support 1 for dataset GSM1395166
Method / RBP HITS-CLIP / AGO
Cell line / Condition BT474 / BT474 AGO HITS-CLIP Replicate 1
Location of target site ENST00000398532.4 | 3UTR | UGAUCUUGCUGCUCUUAUUUCUCCUUUUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000398532.4 | 3UTR | UUGCUGCUCUUAUUUCUCCUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000398532.4 | 3UTR | AUCUUGCUGCUCUUAUUUCUCCUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000398532.4 | 3UTR | CUGCUCUUAUUUCUCCUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000398532.4 | 3UTR | CUUGCUGCUCUUAUUUCUCCUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.549 6.1e-3 0.481 1.6e-2 20 Click to see details
GSE17306 Multiple myeloma 0.275 2.8e-2 0.238 5.0e-2 49 Click to see details
GSE28260 Renal cortex and medulla -0.458 5.8e-2 -0.385 9.7e-2 13 Click to see details
GSE21032 Prostate cancer 0.133 1.2e-1 0.190 4.3e-2 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.18 2.1e-1 -0.099 3.3e-1 23 Click to see details
GSE19536 Breast cancer 0.081 2.1e-1 0.148 7.1e-2 100 Click to see details
GSE19783 ER- ER- breast cancer 0.075 2.6e-1 0.196 4.2e-2 79 Click to see details
GSE21849 B cell lymphoma -0.119 2.7e-1 -0.259 8.7e-2 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.146 2.7e-1 -0.038 4.4e-1 20 Click to see details
GSE28544 Breast cancer -0.13 2.7e-1 0.249 1.2e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.066 3.8e-1 0.031 4.4e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.054 3.8e-1 -0.205 1.3e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.052 4.0e-1 0.139 2.5e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.022 4.3e-1 0.030 4.1e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.035 4.6e-1 0.147 3.2e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.035 4.6e-1 0.147 3.2e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.996 0 1.000 0.5 4 Click to see details
HNSC 0.357 0.01 0.399 0 42 Click to see details
BLCA 0.446 0.03 0.348 0.08 18 Click to see details
THCA 0.242 0.03 0.195 0.07 59 Click to see details
KIRC 0.212 0.04 0.205 0.05 68 Click to see details
PCPG 0.986 0.05 1.000 0.5 3 Click to see details
PRAD 0.228 0.06 0.194 0.09 50 Click to see details
LUAD 0.356 0.13 0.301 0.17 12 Click to see details
BRCA 0.107 0.17 0.190 0.04 84 Click to see details
UCEC 0.176 0.24 0.077 0.38 19 Click to see details
CHOL 0.191 0.31 -0.117 0.38 9 Click to see details
LIHC -0.061 0.34 -0.076 0.3 49 Click to see details
KICH -0.061 0.39 -0.039 0.43 25 Click to see details
KIRP -0.049 0.39 0.018 0.46 32 Click to see details
CESC 0.196 0.44 0.500 0.33 3 Click to see details
STAD -0.028 0.44 0.046 0.4 32 Click to see details
LUSC -0.02 0.45 -0.029 0.43 38 Click to see details
ESCA 0.029 0.47 0.245 0.23 11 Click to see details
COAD 0.019 0.48 -0.286 0.25 8 Click to see details
COAD 0.019 0.48 -0.286 0.25 8 Click to see details
COAD 0.019 0.48 -0.286 0.25 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*