miRTarBase - #MIRT245003 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ENTPD7   
Synonyms LALP1
Description ectonucleoside triphosphate diphosphohydrolase 7
Transcript NM_020354   
Expression
Putative miRNA Targets on ENTPD7
3'UTR of ENTPD7
(miRNA target sites are highlighted)
>ENTPD7|NM_020354|3'UTR
   1 GGCTGGACCAGGACTAGAGAAGCTTGAGCACCCCCGAGTTGCTGCTCATTGAATTCCTCCACTTTCTTATATAGCCTCAG
  81 ATGCTGTGATGTCTGACCTTGTGGATATTTGCCCTTGGAATTTCTACTTTACTTTCTACCGTAATTCCTTCTCCGTACCC
 161 AGGTCTTCTCTGAGAGAAGCTATAATTTAATCTGTGAGGAACTAAATGACAGGAGATTGGTGCTAATACGGGGGACCAAG
 241 CTTTGTCCAAGTGAAGCAGGCTTCGACTCCTTCTGAGAGGTCTGGTGTGTTCCTAGAATCTCACCTTTTCTTCCCTTGCT
 321 AAAGCATGAAGTTTGGCATTTGGCACACTGGAAGCCTGGTTGAAATGAAATTTGTAGCATCTGATACAAAGCCAGAGACA
 401 TTCTAGCAAGTGCAGCAGCCCCTTCTTTCTCTGTAACAGAGATATCATTTATGTGGAGATCCACAACCTTTAACAGGGAT
 481 CCAAGATCTTTGCAGTTCAATCGACCACATAGGAATTTCCAGGCACCAAAATGATATAACTTCCTTGCTTCCTTGACAAA
 561 GAAGCCATCATGGGTGTGATCCAAGATCCCTGTCGTAGTGTTGATGATGTTAGTACATGATTTTAAAGGTTAGAACCCCT
 641 TCTAAATGAATGGTCTGTGGAAGATTTTAGTATCTTATCTGATGCCTGGTATGATGAGGATAGAAAATTTTTCCATTTTT
 721 ATGTGCCTCACAGGCTGTTTGGGCATTAATTTTGCTTTTTGAGCCTTAAGTGTGTTAGTAGGATGGAGAAACTGTGATGG
 801 GGACTGGGAACCTGGATTTGTCTGATTTTAGGTCACTGTTCCCTGGGCCTGTTTTTGTGAGCCCTTACACAGGAAGATAT
 881 AAAGAGAGTTCTTTCATTTCACTGCTAAAATCAGTATGTAGTATGGGGAATGTATTTGGGTTGTTTTTAAAGAAAAGGGG
 961 AACAGAATCAGGAGAGTGGGCAAAGGCAATAAAATCAAAGTTCTTATTAATTATTTCTGAGAAATAGAAGTTTCTCAATT
1041 TATGACTCTTGGAATGTCTGAAAGGGAGCAAATTTGGAATAGATCAATCTGTTAATAAGCCATCTGGCAACTTTCAGAAC
1121 CTCTATTAAGAGACTGCTGAGTCACAAACAGCACTTCCATTAATGAAGCGAGAGGAAAAGCCATAATAATTACATCTTCA
1201 CCCACTACCCTTCCAGAGCTTTGCTTCTCCTCCACATTTAGCCATTAAATTGCATGAGGATTTCTCTTCATCAGGGTCCG
1281 CATGGAATCTTTCTTATATTTTACCCTTTCCTACATGTAGCCTTGAATGTCCTTTCCACGAATATGCTCCCACGGCTGGG
1361 AGCATTTTCTTTTCTTTTCGTCACCTTTGATTTTTGGGATTAGATTAATAGGGGAAAAAGTCCCTGGCTTTAAAGAAAAC
1441 AAAAGTAGAATTCTTCAAAAATAAATTTCATACTGGGAACAGAAAGGAACTAAATGCTTCATAAAACAGGGAAAAAGAAA
1521 TTAAGATCATCCTAGAAATAAACTAAGATAAAAATAAGTATACTGACCCTTGGTTGGTAGATAAAAAGATGACCAGTCTT
1601 GTATTGTTTTAAAATTAGATAAACATGGATTAAGCATGCAAAGACTCTGTTCCTTTTTTTTTTTCTTGGAGACAGGGCCT
1681 CACGCTGTCACCCAGGCTGGAGTGCAGTTGTGCAACATCATGGCTCACCGCAGCCTCAACCTCCTGGGCTCAAACAGTCC
1761 TCCCAACTCAGACTCCAGAGTAGCTGGGACTACAGGTGTGCGCCACCACACTCAGCTAATTTTTTATTTTATTTTTTTAG
1841 AGATGGAGTCTGTGTTGTCCAGGCTGGTCTCAAACTCTTGGGCTCAAGCAATCCTCCCACCTCAGCCTCCCAAAGTGCTG
1921 GGATTACAAGCATGAGCTACTGCACCTGCCCTCTGTTTCCTTTGGAAATCTCTTACCTTTCATTAGGGTTTCTTTCATAG
2001 CAATTTCCTTTGGTTTTTAAGACTTCTACATTGCTTTTTCTTTTATTATCTGTGCTCCGTGAACCTTATGAATGCTGCTT
2081 AAAAATAATGTCAAAATATGTTTTAGCTGCCTACTCAGGTAACGTTTTCTTTTGCTCTCATCTTGGTTTCCATATACTAT
2161 TTTTGGTTTTTTGTGAGATCTAATCAATGATCTAGTCAGAAGCTACTTCACTGGCTAACAGTGATCATGTTCATGTGCTA
2241 AAAATGAACTTGAAACACGGAAGTAGTGGTTGGTCCAGTTTGAAAGCTCTTATTAGTATTCTTCATCCTGGCTGTAATAA
2321 TAGCCATTATTTGTTATGCCTTTGTTATGTAGCAGACACTCTTAAGGATTTTATGTGTATTATTCAAATTGCTATTACTG
2401 TTCTTTTTATAGTTGAGAATCTCAGGATACCTACATTTATCACTTTTTCAATATATATGTATTTCTTATTCTTATTTTGT
2481 CTTGGAGTGTTTAATGTGTTATTTCCTGTTCATTACTTTAATATTATGGTATCTAGGCTTGTCTTTATTACCATGAGCAA
2561 GGTCTCCAGGAGTTCCACAGTACTGAAGGAAAATTTTGTCATATCCCTCAGAAGAACTGAATATTTATTATTGGTATGGG
2641 CTCCTTTGTTTATTCTCTTCTCCCAATTAATAGATTTTAAATGAAATCTTATTAGCTAGAAACAAAAGCCACTTACTCCT
2721 TGCTGAGAGCCAATTACTTAAATATATTTCTTCCTTATAATAAAATAATTTGCTTCTAGGAGCAGAAATCTATCTTGCCA
2801 TACCCTTTGGTTTTTAAAGATTTCTCTTCTATTTGCATTTCTGCACTTTGGTGGTTCTCCCATGAAGATAATTATGGTGT
2881 CATAAAATTCACATTCCACTGGTTCCTTTGAATCTTACCAACCACTCTTGTTAACAGAGACAATGAACCTGAACTGTTTT
2961 AGGACTCTTGTTATTACTGAGACAGGTCACAAACATCAAAATAGGAGTCCGTGGCTTGTAGTGATGCTTTTTAGTCTTGT
3041 GATAGCACAATCCATCACTTTCCCCAAAATTCTTGTCATAGAACATAATGAAAAATATGTAAAATACCCATTTATGTGGC
3121 ATTTCATTCACTTAAGTTGCAGTTAACTCTAAGCCAAATTATACCATTTTTTCTCTCTGTACTTTAGCTCCTTGAATTTC
3201 CTTAATCTGGGAAACTTTTGTTCCCACACCAAGGAACAAATTCAGGGGGTACAAGTGCAGGTTTGTTACATGAGTATATT
3281 GAGTGATGCTGAGGTTTGGGGTACAGATCCCATCACCAGGTGGTGAGCATAGTACCTAACAGATAGTTCTTTAATCCATG
3361 CCCTCCTCTCTCCCTCCCTGCTCTAGTAGTCCACAGTGTCTATTCTGGTCTGGGAAATTTTCATCACTTTCCACCAATCT
3441 TCTATTTATTCTCCAAATGTCTTCCAAAGTATCCTGCCCCACCCCCTCCTCATCCTAAGAGATTCCTTTAACTTCAAGAT
3521 CATATCCAGTGATTGCTGAAAAATGTCTGCCATGCACTTGCTAAGCTAGTGTTTTTAGGCATTAACATTTATTATCACAT
3601 CCATATTTATATTTTTGAAATAATTTATACTTCTCACTGATATCATCTAAACAGATGCTTCTCACAGTTTTATGTTTTGT
3681 TTTTTGTCAGGGATGAAAGACAAGTGAGTGGTATCACTTAAGGGAAAGAACAGTAGGCTTAACGAATAGCAGACCTGGAT
3761 TCTAGTTCTGGCTTTGTCATTTACTAGCTCTGGTACCCCAGGCCAGTCACTTACCATCTCTGGTTCGGTTCTCATCTATC
3841 AAACAAAGAGGCTAGACAAGATTAGAAACTAAAGGCAGAAGACAAGGTAGAAAAATCATATGATTTTGGGAAGAGCATTT
3921 TGTCCTTTGGTTTAGAAGACCAGGCTGCCCAAAAGAGCCTCCTATTTTATCCATAACCCCTGATGATAAGGTTGGTGGGA
4001 ACAGAGTTTCTAATAGTAATCATAATAAATTTCAGAAGAGTTTTAAAGCTTCTGGTCAACCCCCTTGATTTATATGGGTG
4081 ATAAAACTGAGGCCTAGAGCAGTTGTAATATGTGCAAAGTCATAGTGACTGGCCTCCTAGCCCAACTACTTTGTCAGCTA
4161 CAATGAAATGCTCATTAACAGAATCTTTCTGCAAGTATAAACAGAATCTATTTTTTATAAAACAGCTGGCCACAACTAAC
4241 CATGCCCCATCTTTACAACTGCTTCTGACATTCATTTATGACTGCTTTGCTCACATTTAGGAATAAACTTTGAAAAAAAT
4321 ACTTTGTCAGAAATAGTGCCAAGTTTTCACTACATCTATTCTTGTTCCTGTATTTCTTTTCGTACTTTTAAATTTTATAC
4401 ATCTTTTTAAAACAATTTTATACAATTTCCTTTACTACAACATCCAAGCAATTCATTAGATGACTACAGCCTAGATGAAG
4481 GTATAAATGCCTATTACATCTACCTCATTAAAGAACTTCGTTGTAATTCTTGGGCAGTTTCCAGACTCTGTTACAGAAAC
4561 AGAGGGCTGTTTCTTTTTGTTGTCTTTAAACTTTTCAAATTAATTCAAAACTAGTATCTAATTGTCCTTTTTGCTGTGGT
4641 ATGTGGTGTAATGTTGATTGGGAATAAGAATTATGGTAGAAATAGCAGATGTTTCAAATTCTCCCATATTAGTCTCTTAG
4721 GGACGCTAGCTCCAGATTCCAGCCCCTGGGGCAATAACTTGTGAGGATTTTCCTGGTGTTACAAAAAATATTGCTGTTAA
4801 AAAACTAAGACTCAAAACCAAAAGTTGTGATTAATAATAACAGGATTATTAGTCAATAATATTTTGATTAATACTATAGA
4881 ATAGCAACAGTGAATATACCTCAAATTGAAAACTTTTAGGTTGTGTTCTTGGCTCATTCTCTCATAACCTGGATCTAAGT
4961 TGGAAAGCTGTGGCACCCTGTTTGGGTGTCCCATCTACCCTGTTTTCTGTTTCTGCAGATGGCTTGTTCAAGCTTCATTT
5041 TAAGCCTGCTCTGTCTACTTATCTTCCTTATATCCTAATAGACTTCTCTTGTGTTATTACACATTTCTCTTTTGCTCTAA
5121 TATTTCATTATTTTCCAGTTTGTCAGTACCGTTATCAGAGGGACGAGGAAGGAATAACACACCAGTTGACCATTTTGTTT
5201 CTCTGAAAATCTGAGCAATACGGAGATCCTTTTATTAGTAAAACTGAATCATTACTCATACTACAAGGGCTTTCACTTTT
5281 AAAATGTAATCCATCATTGCTTGCCATTTTTATGAAAACCAAAGTTGAAAAGTCTTCTGAATCACAGGCTATGTATAGCC
5361 ACACATGCATGACTTCAGGCTAGCATAAAGACATGTCTGCTCCTGAGCCTCTTCTTTTAAAGGGCAACCACTTGTATACC
5441 CTCTGGTGGCCACTCCTCCTTCTCCACTCCAAGGCAGCCCTGGTACTTTCCTAAGTGGCCCCTCCTACAGAGCACTTGCC
5521 GGCATTTGGCCTGCTGCTGGTGAAGACGCCCCTTACTAGCTTCATAAATGTTTTTCTGCAAGCAGGGATCCCAGACACAT
5601 ACTTTGGTTTCTAGTGTTTCAGTTACTATGTTGTATTTGAAATTCTCATTCCACAATTACCCTTTAGTTGAAGTCCTGAA
5681 GTACATGCCATGTACTCCCCCTTTATTTCTACCTTGATCAATGGCCTCTGCGGAGTGTAGTGAAAGACATCTTTTTATTA
5761 TGATCTACACTTTAAAAAACCAAAGGCTGCCTGTATTACATTGCTTTGGGGAGTTGTTAAGACTCTGTTTTTTCTACTGC
5841 TTCACATTAAACAATAATTTTGTTGAATTTTGAATTCTTAAAATTCTCACTGACAAACATTTTAGGTCAGTGTTGAGGAA
5921 AATGTGTGATGCATGTTAGAGAGGTGATGCATTCTCCCTTATGCAGGGACATGGGTATATGTGTTACATATGCTGATATA
6001 TAACCCACCATTCATCCCAGGACCACAAGGGTAGCTGTAGATAAACTGGTTATCCTAAAATCATGATTATCAGTGTTGAT
6081 CTCTGCAACCAACATTGCTTTAGGGAGTTGCTAGTCATTACCCCTGCTACAATAGATAGTATTTGTCAGTCTAAGTTACA
6161 GACAAAAAATTCTAGGTTGACTGATTAAGAAAGCCATGTGTTTTAATTTCCTTCATGTTTTAAAAACAATGGACGTAAGT
6241 GCAGAGAGACCTTTGAAAATATTAAGGGAAATCTATTTAATCCTATAGGTATGTGATGACTTGTTTTTTTGGAAAAAGGT
6321 ATTTGGAACATCAATCTGTAATTATCCATTTTCCATTCATGCATTCACTAATTCAATATTTGATATGTGTCTGGGAGTGC
6401 TGGGAATAACATAAATACAAAAAAAACCCTAAGATAATCATTCACCAGAAGCTCATAGATATAATACAGTTATATAGCTA
6481 AATGCAACCAGTTGTTTTTCCAAATGTACTCATCATCTGTAATAAAAGAAAAATGAAGTAAAACATCTGAAACCTTAACT
6561 TAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUAC--ACGACGAu 5'
            ::|||| |||||  ||||||| 
Target 5' cgTGAACC-TTATGAATGCTGCTt 3'
2058 - 2080 169.00 -19.90
2
miRNA  3' guguuugGUAAUAC---ACGACGAu 5'
                 |||| ||   ||||||| 
Target 5' ttgccggCATT-TGGCCTGCTGCTg 3'
5516 - 5539 150.00 -14.70
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||  ||   :| ||||||| 
Target 5' agCACCCCCGAGT-TGCTGCTc 3'
27 - 47 143.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
298362 4259 ClinVar
298363 4291 ClinVar
298364 4293 ClinVar
298365 4297 ClinVar
298366 4340 ClinVar
298367 4514 ClinVar
878591 4520 ClinVar
878592 4551 ClinVar
298368 4580 ClinVar
298369 4622 ClinVar
878593 4790 ClinVar
298370 4915 ClinVar
879190 4932 ClinVar
298371 4977 ClinVar
298372 5003 ClinVar
298373 5071 ClinVar
879191 5080 ClinVar
298374 5085 ClinVar
879192 5114 ClinVar
298375 5166 ClinVar
880391 5168 ClinVar
880392 5262 ClinVar
880393 5321 ClinVar
298376 5402 ClinVar
298377 5464 ClinVar
880394 5521 ClinVar
298378 5522 ClinVar
298379 5646 ClinVar
298380 5890 ClinVar
298381 5891 ClinVar
298382 5990 ClinVar
877633 6031 ClinVar
298383 6092 ClinVar
298384 6235 ClinVar
877634 6267 ClinVar
298385 6419 ClinVar
298386 6419 ClinVar
298387 6488 ClinVar
878643 6543 ClinVar
COSN17132229 36 COSMIC
COSN31590119 85 COSMIC
COSN31562316 98 COSMIC
COSN31550616 134 COSMIC
COSN30112875 158 COSMIC
COSN6052826 171 COSMIC
COSN30541630 173 COSMIC
COSN26774078 230 COSMIC
COSN6955255 246 COSMIC
COSN26644171 556 COSMIC
COSN10057790 993 COSMIC
COSN5276134 1141 COSMIC
COSN5276135 1164 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759846967 6 dbSNP
rs753179948 14 dbSNP
rs1381821657 18 dbSNP
rs765503012 19 dbSNP
rs753120499 23 dbSNP
rs1362875893 27 dbSNP
rs993728444 28 dbSNP
rs1226067829 29 dbSNP
rs1315967138 30 dbSNP
rs1256149738 31 dbSNP
rs922977439 34 dbSNP
rs376310921 36 dbSNP
rs977903453 37 dbSNP
rs1461168561 40 dbSNP
rs1189556430 41 dbSNP
rs138662264 44 dbSNP
rs1290651129 47 dbSNP
rs755549811 48 dbSNP
rs779666055 49 dbSNP
rs1378330997 50 dbSNP
rs1455303430 51 dbSNP
rs1189669591 56 dbSNP
rs35333779 56 dbSNP
rs936374703 66 dbSNP
rs1424665498 70 dbSNP
rs561827915 82 dbSNP
rs1175842254 90 dbSNP
rs1157873791 95 dbSNP
rs1417612007 105 dbSNP
rs112542629 109 dbSNP
rs530558455 116 dbSNP
rs529131412 118 dbSNP
rs954888273 121 dbSNP
rs1165036237 128 dbSNP
rs1369106985 129 dbSNP
rs376761338 141 dbSNP
rs547252149 142 dbSNP
rs187437460 155 dbSNP
rs115784655 156 dbSNP
rs924249836 166 dbSNP
rs755615795 167 dbSNP
rs955723057 167 dbSNP
rs1266337898 183 dbSNP
rs1244352144 195 dbSNP
rs1443683758 215 dbSNP
rs949197150 216 dbSNP
rs1382821829 219 dbSNP
rs917181556 223 dbSNP
rs1046217474 230 dbSNP
rs897211301 234 dbSNP
rs1367212656 235 dbSNP
rs1163563270 236 dbSNP
rs1369708972 238 dbSNP
rs1234587344 250 dbSNP
rs1282184061 252 dbSNP
rs1339887103 261 dbSNP
rs763423243 265 dbSNP
rs1366305242 266 dbSNP
rs1171953229 268 dbSNP
rs771423703 270 dbSNP
rs1439513615 286 dbSNP
rs1048509953 293 dbSNP
rs1219413411 297 dbSNP
rs1252451552 300 dbSNP
rs909726664 312 dbSNP
rs1425119205 314 dbSNP
rs888434421 319 dbSNP
rs192736901 327 dbSNP
rs1037809803 340 dbSNP
rs1018920134 344 dbSNP
rs1487651391 350 dbSNP
rs1253275977 365 dbSNP
rs897812964 371 dbSNP
rs1388700001 375 dbSNP
rs149328911 385 dbSNP
rs998322244 388 dbSNP
rs1323997573 390 dbSNP
rs1399214977 390 dbSNP
rs1388192607 396 dbSNP
rs771425540 396 dbSNP
rs551903380 407 dbSNP
rs967578298 413 dbSNP
rs1465748810 419 dbSNP
rs1398939672 420 dbSNP
rs1167859623 425 dbSNP
rs890742612 428 dbSNP
rs536606903 435 dbSNP
rs1032120450 438 dbSNP
rs957912890 440 dbSNP
rs1431793549 441 dbSNP
rs144527777 446 dbSNP
rs1199515083 459 dbSNP
rs1457435070 467 dbSNP
rs1256258500 469 dbSNP
rs1393172991 484 dbSNP
rs916458953 485 dbSNP
rs1305232183 486 dbSNP
rs1275347822 487 dbSNP
rs949309968 491 dbSNP
rs1226355888 493 dbSNP
rs904712148 496 dbSNP
rs1311094001 497 dbSNP
rs185423638 501 dbSNP
rs114548202 504 dbSNP
rs918414120 510 dbSNP
rs929847339 511 dbSNP
rs1048931275 513 dbSNP
rs775606623 520 dbSNP
rs763158246 521 dbSNP
rs553307594 534 dbSNP
rs955690890 537 dbSNP
rs764304984 538 dbSNP
rs1464928091 542 dbSNP
rs35229927 543 dbSNP
rs578102765 548 dbSNP
rs1272607445 549 dbSNP
rs1179596751 551 dbSNP
rs942658569 552 dbSNP
rs774137998 555 dbSNP
rs545523868 556 dbSNP
rs1185548370 567 dbSNP
rs1443060119 570 dbSNP
rs970347396 572 dbSNP
rs1446673200 595 dbSNP
rs557452909 596 dbSNP
rs11190250 600 dbSNP
rs543041869 606 dbSNP
rs903337859 609 dbSNP
rs941200071 614 dbSNP
rs1306618248 617 dbSNP
rs1472088490 618 dbSNP
rs1164916799 621 dbSNP
rs1000382040 635 dbSNP
rs919375258 637 dbSNP
rs1032482977 639 dbSNP
rs929321491 643 dbSNP
rs1419456024 647 dbSNP
rs957813458 652 dbSNP
rs1165699189 658 dbSNP
rs1473209139 666 dbSNP
rs1052159911 670 dbSNP
rs1185461728 671 dbSNP
rs1440670925 686 dbSNP
rs1217143695 689 dbSNP
rs1352716142 690 dbSNP
rs1327357037 692 dbSNP
rs1385937343 693 dbSNP
rs1356555782 696 dbSNP
rs139309659 715 dbSNP
rs1445128581 717 dbSNP
rs1342983732 723 dbSNP
rs1299327815 730 dbSNP
rs943589049 734 dbSNP
rs1318653190 735 dbSNP
rs1023248093 741 dbSNP
rs1039278844 745 dbSNP
rs1161588067 745 dbSNP
rs200161344 755 dbSNP
rs970403449 760 dbSNP
rs1194314590 763 dbSNP
rs1487890367 774 dbSNP
rs753464136 776 dbSNP
rs981974552 780 dbSNP
rs1223441673 786 dbSNP
rs1451860467 788 dbSNP
rs1288668366 794 dbSNP
rs918518831 799 dbSNP
rs1319380686 815 dbSNP
rs1292636809 823 dbSNP
rs1218576286 833 dbSNP
rs575131236 842 dbSNP
rs1339026847 847 dbSNP
rs1277016721 855 dbSNP
rs1437606074 856 dbSNP
rs1335418909 857 dbSNP
rs879307176 868 dbSNP
rs1321825404 870 dbSNP
rs1266324032 875 dbSNP
rs1467320407 876 dbSNP
rs1170000913 881 dbSNP
rs1401147127 881 dbSNP
rs1477474661 889 dbSNP
rs983975011 892 dbSNP
rs1350159056 932 dbSNP
rs1478223445 933 dbSNP
rs1245833179 934 dbSNP
rs1218932595 938 dbSNP
rs1458774744 938 dbSNP
rs909925899 942 dbSNP
rs1197425793 975 dbSNP
rs144041678 976 dbSNP
rs1264294644 998 dbSNP
rs1220243723 1001 dbSNP
rs757314968 1006 dbSNP
rs1187836768 1009 dbSNP
rs1449313735 1014 dbSNP
rs1377880202 1016 dbSNP
rs1330808457 1026 dbSNP
rs891583004 1039 dbSNP
rs529157482 1046 dbSNP
rs1178130925 1047 dbSNP
rs1476490382 1049 dbSNP
rs922579755 1052 dbSNP
rs934009174 1053 dbSNP
rs1361573935 1054 dbSNP
rs1238385646 1058 dbSNP
rs1177532463 1059 dbSNP
rs767448340 1069 dbSNP
rs541283342 1077 dbSNP
rs1257177486 1091 dbSNP
rs1041963031 1095 dbSNP
rs1452584260 1096 dbSNP
rs1276990484 1099 dbSNP
rs903453225 1102 dbSNP
rs1242734236 1104 dbSNP
rs145981724 1123 dbSNP
rs532915254 1126 dbSNP
rs879748664 1130 dbSNP
rs1444734618 1132 dbSNP
rs969770814 1135 dbSNP
rs980409498 1150 dbSNP
rs1358463352 1159 dbSNP
rs1016891369 1170 dbSNP
rs1054637554 1171 dbSNP
rs1380600051 1183 dbSNP
rs1157682433 1193 dbSNP
rs1416884148 1194 dbSNP
rs962529742 1201 dbSNP
rs373805379 1204 dbSNP
rs1483234173 1205 dbSNP
rs551070124 1208 dbSNP
rs929348510 1220 dbSNP
rs987585963 1224 dbSNP
rs1286521999 1227 dbSNP
rs1316481763 1228 dbSNP
rs1237169712 1229 dbSNP
rs1323677908 1237 dbSNP
rs1011946728 1249 dbSNP
rs569401281 1259 dbSNP
rs564775500 1265 dbSNP
rs7903514 1269 dbSNP
rs1310989928 1272 dbSNP
rs1401696854 1273 dbSNP
rs372264458 1280 dbSNP
rs548686967 1281 dbSNP
rs867700565 1286 dbSNP
rs984480379 1289 dbSNP
rs1369812066 1291 dbSNP
rs1164926933 1294 dbSNP
rs1422712230 1295 dbSNP
rs1416419533 1297 dbSNP
rs1196472303 1299 dbSNP
rs1488868593 1304 dbSNP
rs909714694 1311 dbSNP
rs964246455 1314 dbSNP
rs936168215 1316 dbSNP
rs975481828 1317 dbSNP
rs56357118 1337 dbSNP
rs7918619 1341 dbSNP
rs1418039706 1346 dbSNP
rs1332775802 1347 dbSNP
rs1041743716 1348 dbSNP
rs1381622158 1352 dbSNP
rs1365144089 1353 dbSNP
rs568876530 1354 dbSNP
rs936258538 1355 dbSNP
rs1045510467 1359 dbSNP
rs1277378280 1360 dbSNP
rs905514351 1363 dbSNP
rs1001236551 1365 dbSNP
rs1016858882 1374 dbSNP
rs1055153082 1380 dbSNP
rs11190251 1385 dbSNP
rs1172132017 1386 dbSNP
rs1436500329 1409 dbSNP
rs1423497140 1415 dbSNP
rs571759122 1416 dbSNP
rs1268413062 1417 dbSNP
rs1013065518 1418 dbSNP
rs1044771065 1423 dbSNP
rs539227805 1424 dbSNP
rs1260115635 1426 dbSNP
rs1199319124 1427 dbSNP
rs557538771 1436 dbSNP
rs987940119 1436 dbSNP
rs41290508 1441 dbSNP
rs1003129883 1450 dbSNP
rs1329493241 1462 dbSNP
rs1312260653 1466 dbSNP
rs1439733675 1467 dbSNP
rs1368283352 1468 dbSNP
rs1233861771 1471 dbSNP
rs1304609473 1503 dbSNP
rs1465670205 1522 dbSNP
rs1350580883 1523 dbSNP
rs1203587693 1533 dbSNP
rs1400286103 1536 dbSNP
rs1166669381 1539 dbSNP
rs190725013 1542 dbSNP
rs1378598493 1543 dbSNP
rs1198552777 1573 dbSNP
rs562903697 1581 dbSNP
rs1240241742 1582 dbSNP
rs1230673319 1589 dbSNP
rs1457365358 1590 dbSNP
rs1195806191 1591 dbSNP
rs1005450750 1592 dbSNP
rs554679618 1597 dbSNP
rs1346972303 1603 dbSNP
rs372330275 1604 dbSNP
rs1452176457 1605 dbSNP
rs1017294242 1618 dbSNP
rs1345356859 1619 dbSNP
rs1310981563 1625 dbSNP
rs181646541 1631 dbSNP
rs1334675893 1635 dbSNP
rs913374970 1641 dbSNP
rs1398339941 1647 dbSNP
rs1403499462 1651 dbSNP
rs1172412486 1652 dbSNP
rs112095426 1654 dbSNP
rs1159476233 1654 dbSNP
rs398114680 1654 dbSNP
rs1395423347 1655 dbSNP
rs1439251676 1661 dbSNP
rs1362155982 1665 dbSNP
rs1455461428 1666 dbSNP
rs1168088739 1668 dbSNP
rs1444103501 1668 dbSNP
rs1353813527 1669 dbSNP
rs1462437509 1670 dbSNP
rs1209966079 1679 dbSNP
rs963843691 1683 dbSNP
rs368495736 1684 dbSNP
rs1045883824 1688 dbSNP
rs1029712128 1694 dbSNP
rs1349457006 1708 dbSNP
rs184465445 1713 dbSNP
rs1440439709 1717 dbSNP
rs977536546 1721 dbSNP
rs1341655901 1722 dbSNP
rs757534261 1730 dbSNP
rs577455362 1731 dbSNP
rs1362856296 1735 dbSNP
rs990401308 1738 dbSNP
rs1400374031 1740 dbSNP
rs1295315926 1741 dbSNP
rs1406022783 1742 dbSNP
rs1165122113 1751 dbSNP
rs1001288699 1755 dbSNP
rs1038008282 1756 dbSNP
rs1187153209 1767 dbSNP
rs1230333094 1769 dbSNP
rs1474157361 1772 dbSNP
rs1265104841 1779 dbSNP
rs1217031313 1781 dbSNP
rs1446120629 1792 dbSNP
rs1281684368 1795 dbSNP
rs536515016 1802 dbSNP
rs1252549541 1803 dbSNP
rs1292066965 1809 dbSNP
rs563079403 1811 dbSNP
rs1342888639 1812 dbSNP
rs1279274852 1817 dbSNP
rs1430431312 1819 dbSNP
rs1343712018 1820 dbSNP
rs1325768002 1826 dbSNP
rs898175985 1829 dbSNP
rs1491127491 1830 dbSNP
rs948852248 1830 dbSNP
rs111450507 1831 dbSNP
rs199655169 1831 dbSNP
rs10883406 1832 dbSNP
rs1186951861 1832 dbSNP
rs1045885228 1839 dbSNP
rs994061480 1844 dbSNP
rs549034816 1852 dbSNP
rs1451767095 1858 dbSNP
rs4919387 1866 dbSNP
rs1211239937 1869 dbSNP
rs528050746 1872 dbSNP
rs746363626 1878 dbSNP
rs1259249913 1879 dbSNP
rs547021061 1882 dbSNP
rs939103093 1883 dbSNP
rs1360319103 1892 dbSNP
rs1276925591 1901 dbSNP
rs371831712 1902 dbSNP
rs1370488796 1912 dbSNP
rs1324026453 1914 dbSNP
rs1047275821 1922 dbSNP
rs886764754 1923 dbSNP
rs1409246643 1934 dbSNP
rs1417151351 1935 dbSNP
rs568194993 1937 dbSNP
rs1016828611 1942 dbSNP
rs1454473748 1943 dbSNP
rs899752252 1948 dbSNP
rs1172522028 1951 dbSNP
rs1251962131 1951 dbSNP
rs1415727353 1961 dbSNP
rs1461032015 1963 dbSNP
rs1326688269 1964 dbSNP
rs1008094492 1971 dbSNP
rs571969384 1976 dbSNP
rs996646909 1977 dbSNP
rs539266735 1978 dbSNP
rs1301524286 2017 dbSNP
rs1449194445 2020 dbSNP
rs1428907519 2029 dbSNP
rs748733892 2036 dbSNP
rs1363178741 2037 dbSNP
rs1384388153 2041 dbSNP
rs1335987299 2052 dbSNP
rs60812763 2059 dbSNP
rs925934955 2060 dbSNP
rs1171367412 2076 dbSNP
rs977512664 2081 dbSNP
rs1032200105 2082 dbSNP
rs957363277 2100 dbSNP
rs569437466 2105 dbSNP
rs536367330 2109 dbSNP
rs1045860060 2112 dbSNP
rs554998934 2119 dbSNP
rs12264909 2124 dbSNP
rs1486095089 2125 dbSNP
rs1278565212 2130 dbSNP
rs1242620748 2135 dbSNP
rs1354627227 2136 dbSNP
rs948968299 2137 dbSNP
rs937044569 2138 dbSNP
rs1222118520 2155 dbSNP
rs981701362 2156 dbSNP
rs1057490 2167 dbSNP
rs929505942 2179 dbSNP
rs1057491 2181 dbSNP
rs1165676467 2188 dbSNP
rs929656153 2190 dbSNP
rs1310796909 2196 dbSNP
rs1420187011 2198 dbSNP
rs188518625 2200 dbSNP
rs1157804464 2215 dbSNP
rs891082605 2222 dbSNP
rs1189281863 2224 dbSNP
rs1179828446 2228 dbSNP
rs940996224 2234 dbSNP
rs1008561884 2235 dbSNP
rs1038452083 2236 dbSNP
rs1018071631 2245 dbSNP
rs1486345908 2245 dbSNP
rs1213818638 2253 dbSNP
rs1313456784 2259 dbSNP
rs899533159 2260 dbSNP
rs768875482 2278 dbSNP
rs577492282 2281 dbSNP
rs1362301314 2283 dbSNP
rs1287925797 2287 dbSNP
rs544870218 2288 dbSNP
rs1415949671 2290 dbSNP
rs1293352986 2293 dbSNP
rs774468091 2300 dbSNP
rs1164951439 2304 dbSNP
rs142076399 2305 dbSNP
rs1283178686 2309 dbSNP
rs1031730467 2325 dbSNP
rs575050048 2326 dbSNP
rs1429480130 2338 dbSNP
rs1261391489 2340 dbSNP
rs771741634 2345 dbSNP
rs1022921942 2351 dbSNP
rs1489560927 2363 dbSNP
rs927460596 2384 dbSNP
rs1213120852 2393 dbSNP
rs1334139792 2414 dbSNP
rs12243417 2415 dbSNP
rs1485297917 2418 dbSNP
rs981647382 2431 dbSNP
rs973803817 2437 dbSNP
rs561032769 2442 dbSNP
rs539724977 2446 dbSNP
rs1326058744 2450 dbSNP
rs181359120 2451 dbSNP
rs1188656933 2456 dbSNP
rs1173463994 2466 dbSNP
rs928903748 2474 dbSNP
rs919707381 2488 dbSNP
rs141079468 2490 dbSNP
rs556145921 2493 dbSNP
rs372030800 2495 dbSNP
rs1435180966 2496 dbSNP
rs1408940763 2502 dbSNP
rs984028772 2503 dbSNP
rs17112172 2544 dbSNP
rs1172102155 2547 dbSNP
rs766419925 2552 dbSNP
rs941099125 2581 dbSNP
rs532870614 2595 dbSNP
rs535437939 2596 dbSNP
rs1197504036 2599 dbSNP
rs920912705 2605 dbSNP
rs1000689786 2606 dbSNP
rs1224943217 2615 dbSNP
rs1349677458 2616 dbSNP
rs1303690731 2626 dbSNP
rs1233029614 2627 dbSNP
rs1033056952 2631 dbSNP
rs1330257966 2642 dbSNP
rs1392512709 2658 dbSNP
rs1396367543 2665 dbSNP
rs373590483 2674 dbSNP
rs1315405614 2682 dbSNP
rs1467896346 2685 dbSNP
rs1395998438 2699 dbSNP
rs773451020 2700 dbSNP
rs932332621 2703 dbSNP
rs1173261382 2709 dbSNP
rs1452757053 2724 dbSNP
rs759152794 2728 dbSNP
rs368777072 2730 dbSNP
rs116634553 2738 dbSNP
rs1438379195 2740 dbSNP
rs891065041 2741 dbSNP
rs1249720641 2745 dbSNP
rs1439332322 2747 dbSNP
rs185487987 2751 dbSNP
rs1373521042 2760 dbSNP
rs572153509 2767 dbSNP
rs1209739302 2772 dbSNP
rs1280707765 2772 dbSNP
rs548433509 2784 dbSNP
rs893011814 2804 dbSNP
rs566952671 2806 dbSNP
rs1012058710 2807 dbSNP
rs752272762 2808 dbSNP
rs1346935288 2831 dbSNP
rs533966822 2840 dbSNP
rs1034628877 2842 dbSNP
rs1305497310 2850 dbSNP
rs1417098945 2859 dbSNP
rs1376465997 2869 dbSNP
rs558544630 2874 dbSNP
rs958852222 2885 dbSNP
rs190639340 2891 dbSNP
rs1002848777 2901 dbSNP
rs920092544 2907 dbSNP
rs1469691386 2922 dbSNP
rs1362070820 2923 dbSNP
rs758129536 2928 dbSNP
rs1476119955 2936 dbSNP
rs1258005372 2937 dbSNP
rs929704667 2938 dbSNP
rs1203829829 2941 dbSNP
rs1233539470 2943 dbSNP
rs1285908777 2956 dbSNP
rs951041840 2960 dbSNP
rs1205284847 2967 dbSNP
rs1349343748 2968 dbSNP
rs983752791 2969 dbSNP
rs538549571 2971 dbSNP
rs909368597 2973 dbSNP
rs556797018 2976 dbSNP
rs973803584 2987 dbSNP
rs1455013816 3003 dbSNP
rs1175942321 3005 dbSNP
rs376104229 3011 dbSNP
rs1409899878 3012 dbSNP
rs1327532081 3014 dbSNP
rs932280404 3018 dbSNP
rs1167146243 3020 dbSNP
rs1382913238 3020 dbSNP
rs1448494755 3027 dbSNP
rs1462986329 3034 dbSNP
rs1323539741 3035 dbSNP
rs1369819265 3040 dbSNP
rs542807564 3042 dbSNP
rs760099350 3049 dbSNP
rs149854290 3051 dbSNP
rs934572379 3055 dbSNP
rs1243571606 3059 dbSNP
rs1193481207 3062 dbSNP
rs781407152 3065 dbSNP
rs1446022675 3071 dbSNP
rs1337305255 3081 dbSNP
rs1053068657 3082 dbSNP
rs1213975386 3088 dbSNP
rs892949658 3096 dbSNP
rs1429595776 3099 dbSNP
rs1336180960 3101 dbSNP
rs947254713 3110 dbSNP
rs1273795690 3113 dbSNP
rs936595983 3117 dbSNP
rs1044435285 3120 dbSNP
rs1271091142 3125 dbSNP
rs1430319212 3142 dbSNP
rs892313953 3147 dbSNP
rs905961443 3149 dbSNP
rs1328062931 3153 dbSNP
rs572881890 3154 dbSNP
rs1393743257 3176 dbSNP
rs1002796420 3182 dbSNP
rs1164144306 3183 dbSNP
rs1010297661 3184 dbSNP
rs1421427653 3187 dbSNP
rs796569875 3195 dbSNP
rs1474904504 3199 dbSNP
rs180982477 3205 dbSNP
rs1195025383 3210 dbSNP
rs1468545397 3218 dbSNP
rs1251774205 3221 dbSNP
rs564893685 3232 dbSNP
rs1212394615 3234 dbSNP
rs1212029847 3249 dbSNP
rs1252556054 3254 dbSNP
rs1440022628 3256 dbSNP
rs1274200063 3260 dbSNP
rs1214329287 3261 dbSNP
rs1337762144 3267 dbSNP
rs1035646100 3269 dbSNP
rs907188880 3273 dbSNP
rs1370366609 3280 dbSNP
rs886480115 3287 dbSNP
rs1005526724 3294 dbSNP
rs1003319452 3297 dbSNP
rs1329355890 3320 dbSNP
rs1409146522 3321 dbSNP
rs532095456 3326 dbSNP
rs1371713178 3327 dbSNP
rs1475372490 3331 dbSNP
rs1393991274 3333 dbSNP
rs1169041561 3336 dbSNP
rs544927520 3357 dbSNP
rs147917263 3401 dbSNP
rs1466688689 3403 dbSNP
rs1204349724 3424 dbSNP
rs1282853213 3440 dbSNP
rs958902754 3461 dbSNP
rs207471307 3470 dbSNP
rs974923532 3479 dbSNP
rs1028035121 3483 dbSNP
rs1225526472 3484 dbSNP
rs750792416 3499 dbSNP
rs953782354 3506 dbSNP
rs1162213793 3509 dbSNP
rs557887408 3511 dbSNP
rs912198716 3514 dbSNP
rs1368501359 3516 dbSNP
rs1314447142 3519 dbSNP
rs756556486 3535 dbSNP
rs1374454636 3550 dbSNP
rs1173415253 3554 dbSNP
rs1325267882 3561 dbSNP
rs1324533960 3562 dbSNP
rs951647688 3577 dbSNP
rs780560892 3586 dbSNP
rs548739978 3593 dbSNP
rs1319937789 3597 dbSNP
rs1231484715 3602 dbSNP
rs566885209 3612 dbSNP
rs989105762 3616 dbSNP
rs141799782 3636 dbSNP
rs947183944 3644 dbSNP
rs1283595230 3673 dbSNP
rs1317611896 3673 dbSNP
rs552208328 3677 dbSNP
rs1223181703 3678 dbSNP
rs1348524942 3696 dbSNP
rs766096850 3700 dbSNP
rs1260051425 3702 dbSNP
rs116031404 3706 dbSNP
rs753520585 3707 dbSNP
rs1265925626 3709 dbSNP
rs537840225 3712 dbSNP
rs1300721115 3713 dbSNP
rs938764948 3721 dbSNP
rs1057168229 3723 dbSNP
rs556886606 3732 dbSNP
rs1157696310 3735 dbSNP
rs975012220 3737 dbSNP
rs1185088055 3744 dbSNP
rs1004896921 3745 dbSNP
rs1254431688 3748 dbSNP
rs936564924 3760 dbSNP
rs1458094251 3768 dbSNP
rs1486295356 3770 dbSNP
rs1241640595 3774 dbSNP
rs1053648432 3779 dbSNP
rs577018616 3784 dbSNP
rs1327067254 3792 dbSNP
rs569115244 3794 dbSNP
rs1274973785 3805 dbSNP
rs1016902480 3807 dbSNP
rs201016892 3816 dbSNP
rs1310261648 3817 dbSNP
rs1383602531 3826 dbSNP
rs117445346 3827 dbSNP
rs1029165345 3828 dbSNP
rs748303676 3839 dbSNP
rs1002959756 3840 dbSNP
rs1461338498 3845 dbSNP
rs986537126 3855 dbSNP
rs534620162 3856 dbSNP
rs772402589 3858 dbSNP
rs147059330 3859 dbSNP
rs1342224394 3861 dbSNP
rs1019375651 3864 dbSNP
rs1172954974 3864 dbSNP
rs1429392887 3884 dbSNP
rs1055768290 3888 dbSNP
rs1186829926 3891 dbSNP
rs955874688 3894 dbSNP
rs187098040 3896 dbSNP
rs1253642094 3900 dbSNP
rs1292733126 3902 dbSNP
rs1356221673 3904 dbSNP
rs192441686 3908 dbSNP
rs1259135109 3914 dbSNP
rs1027271346 3917 dbSNP
rs947299904 3922 dbSNP
rs7913307 3928 dbSNP
rs576954494 3931 dbSNP
rs1225654546 3942 dbSNP
rs927109933 3952 dbSNP
rs749478724 3958 dbSNP
rs1288624865 3973 dbSNP
rs938546029 3978 dbSNP
rs1300332119 3979 dbSNP
rs1354245857 3981 dbSNP
rs1462810763 3981 dbSNP
rs760556421 3982 dbSNP
rs907968955 3983 dbSNP
rs61870398 3992 dbSNP
rs975145301 3998 dbSNP
rs1193062647 4003 dbSNP
rs774134015 4003 dbSNP
rs563201284 4005 dbSNP
rs1432579192 4007 dbSNP
rs1265175364 4010 dbSNP
rs1256153133 4013 dbSNP
rs920906969 4015 dbSNP
rs1197409634 4027 dbSNP
rs1480842695 4029 dbSNP
rs1423935468 4035 dbSNP
rs1446273283 4055 dbSNP
rs957725332 4060 dbSNP
rs1189040579 4071 dbSNP
rs1349565574 4074 dbSNP
rs1361661945 4077 dbSNP
rs1231877001 4078 dbSNP
rs1329928287 4079 dbSNP
rs1309792891 4082 dbSNP
rs1392422807 4083 dbSNP
rs1037713360 4089 dbSNP
rs899197533 4092 dbSNP
rs1436868895 4093 dbSNP
rs1376276800 4103 dbSNP
rs913841316 4104 dbSNP
rs996414334 4106 dbSNP
rs1365546585 4108 dbSNP
rs1183928615 4109 dbSNP
rs1050696140 4112 dbSNP
rs1419556816 4115 dbSNP
rs1302538639 4137 dbSNP
rs1250857446 4139 dbSNP
rs890602158 4147 dbSNP
rs55700651 4149 dbSNP
rs59204762 4151 dbSNP
rs1362283649 4163 dbSNP
rs1432778951 4169 dbSNP
rs1199462333 4175 dbSNP
rs1342281285 4182 dbSNP
rs752120770 4200 dbSNP
rs546485683 4203 dbSNP
rs1261921927 4211 dbSNP
rs1240438229 4219 dbSNP
rs982313344 4230 dbSNP
rs10490941 4259 dbSNP
rs938718256 4262 dbSNP
rs183002353 4272 dbSNP
rs1333764797 4279 dbSNP
rs955824203 4281 dbSNP
rs1010437262 4282 dbSNP
rs886046594 4291 dbSNP
rs201701928 4293 dbSNP
rs74152722 4297 dbSNP
rs1159191209 4298 dbSNP
rs560743000 4299 dbSNP
rs1411135838 4318 dbSNP
rs1156772229 4326 dbSNP
rs979975478 4337 dbSNP
rs759599665 4339 dbSNP
rs764641759 4340 dbSNP
rs527841129 4358 dbSNP
rs1263281719 4361 dbSNP
rs1346220611 4371 dbSNP
rs959839665 4381 dbSNP
rs992676810 4382 dbSNP
rs907915852 4383 dbSNP
rs996534792 4396 dbSNP
rs1242930772 4400 dbSNP
rs940776896 4403 dbSNP
rs1028058486 4414 dbSNP
rs1319135131 4416 dbSNP
rs1434464678 4419 dbSNP
rs1201603586 4421 dbSNP
rs1462905194 4430 dbSNP
rs957693052 4448 dbSNP
rs1162408983 4449 dbSNP
rs1471638660 4462 dbSNP
rs1374429905 4463 dbSNP
rs1247820038 4471 dbSNP
rs1464056818 4477 dbSNP
rs1038216904 4482 dbSNP
rs757728762 4497 dbSNP
rs1216129174 4499 dbSNP
rs187671144 4500 dbSNP
rs1436847811 4501 dbSNP
rs931985718 4510 dbSNP
rs138423739 4514 dbSNP
rs1381915856 4520 dbSNP
rs763822568 4521 dbSNP
rs966992763 4532 dbSNP
rs982062151 4537 dbSNP
rs1452288708 4546 dbSNP
rs1172814692 4548 dbSNP
rs1378067170 4549 dbSNP
rs1009446425 4551 dbSNP
rs927762541 4555 dbSNP
rs1052608910 4559 dbSNP
rs149131820 4575 dbSNP
rs886046595 4580 dbSNP
rs892668272 4584 dbSNP
rs1398290240 4589 dbSNP
rs1168857057 4590 dbSNP
rs370429256 4599 dbSNP
rs1448455939 4616 dbSNP
rs56206689 4622 dbSNP
rs1194932774 4625 dbSNP
rs991564987 4626 dbSNP
rs1246636904 4672 dbSNP
rs1395948942 4673 dbSNP
rs568331928 4675 dbSNP
rs536567466 4689 dbSNP
rs781541787 4700 dbSNP
rs1369075210 4702 dbSNP
rs1233964862 4704 dbSNP
rs1048842896 4707 dbSNP
rs1340265157 4712 dbSNP
rs548136735 4725 dbSNP
rs887129592 4726 dbSNP
rs940242975 4728 dbSNP
rs1304629229 4730 dbSNP
rs1434143804 4744 dbSNP
rs1337338894 4746 dbSNP
rs968325646 4748 dbSNP
rs1308371757 4749 dbSNP
rs1368305741 4752 dbSNP
rs1428758096 4752 dbSNP
rs1175050201 4777 dbSNP
rs1314395304 4779 dbSNP
rs1041324284 4783 dbSNP
rs1190005308 4783 dbSNP
rs1225951605 4783 dbSNP
rs148302095 4790 dbSNP
rs997003874 4791 dbSNP
rs756503233 4792 dbSNP
rs1198753459 4796 dbSNP
rs1282744127 4799 dbSNP
rs1211795575 4812 dbSNP
rs1311702561 4814 dbSNP
rs1276536079 4818 dbSNP
rs893517447 4820 dbSNP
rs1010618568 4821 dbSNP
rs1034188399 4831 dbSNP
rs533964181 4845 dbSNP
rs993186176 4853 dbSNP
rs1034970922 4855 dbSNP
rs907697224 4862 dbSNP
rs1448243978 4866 dbSNP
rs1358103601 4872 dbSNP
rs756112583 4896 dbSNP
rs1403003661 4903 dbSNP
rs76530337 4915 dbSNP
rs1158986997 4926 dbSNP
rs754320827 4929 dbSNP
rs920697890 4930 dbSNP
rs576990987 4932 dbSNP
rs1168292643 4941 dbSNP
rs986138488 4944 dbSNP
rs952746673 4946 dbSNP
rs537873907 4949 dbSNP
rs778853328 4954 dbSNP
rs1268698897 4958 dbSNP
rs1227651930 4964 dbSNP
rs1326843091 4970 dbSNP
rs886046596 4977 dbSNP
rs1294862135 4978 dbSNP
rs541806263 4981 dbSNP
rs911930659 4991 dbSNP
rs1377966208 4997 dbSNP
rs908520275 4998 dbSNP
rs1432290663 4999 dbSNP
rs886046597 5003 dbSNP
rs748261749 5004 dbSNP
rs1420525633 5006 dbSNP
rs758489124 5017 dbSNP
rs1423515956 5035 dbSNP
rs1411890345 5038 dbSNP
rs556138733 5041 dbSNP
rs892621937 5048 dbSNP
rs778159694 5050 dbSNP
rs1370263090 5052 dbSNP
rs1380992013 5057 dbSNP
rs1295433507 5058 dbSNP
rs879420594 5062 dbSNP
rs904281127 5063 dbSNP
rs1310151665 5068 dbSNP
rs73345141 5071 dbSNP
rs1033966106 5080 dbSNP
rs1296184859 5084 dbSNP
rs200422911 5085 dbSNP
rs1212761274 5088 dbSNP
rs902162129 5089 dbSNP
rs542520901 5092 dbSNP
rs1348443688 5096 dbSNP
rs1035102231 5097 dbSNP
rs959245623 5100 dbSNP
rs1389678428 5103 dbSNP
rs1014160288 5110 dbSNP
rs76656125 5114 dbSNP
rs190644094 5118 dbSNP
rs951883284 5147 dbSNP
rs1191640959 5151 dbSNP
rs1488046549 5151 dbSNP
rs141301007 5152 dbSNP
rs1415845347 5154 dbSNP
rs1342405753 5156 dbSNP
rs973649815 5161 dbSNP
rs984599821 5163 dbSNP
rs2300983 5166 dbSNP
rs12241912 5168 dbSNP
rs1302604933 5173 dbSNP
rs1351961138 5179 dbSNP
rs1386658040 5186 dbSNP
rs1365969603 5193 dbSNP
rs1452029388 5199 dbSNP
rs1288660597 5207 dbSNP
rs986254543 5212 dbSNP
rs976739476 5214 dbSNP
rs776629393 5215 dbSNP
rs554922652 5222 dbSNP
rs1279540880 5223 dbSNP
rs1353066017 5235 dbSNP
rs1436668789 5237 dbSNP
rs1378222681 5239 dbSNP
rs1176740633 5244 dbSNP
rs1432490214 5251 dbSNP
rs988381164 5262 dbSNP
rs922613528 5265 dbSNP
rs932874823 5273 dbSNP
rs1250619200 5282 dbSNP
rs1202518126 5286 dbSNP
rs1290090983 5287 dbSNP
rs745792225 5296 dbSNP
rs1256032805 5298 dbSNP
rs1049983162 5306 dbSNP
rs914156906 5321 dbSNP
rs1290665972 5322 dbSNP
rs1410827260 5325 dbSNP
rs1279244024 5360 dbSNP
rs759234662 5360 dbSNP
rs549833297 5365 dbSNP
rs1323174154 5370 dbSNP
rs1397961514 5376 dbSNP
rs946865443 5377 dbSNP
rs946932507 5401 dbSNP
rs769776249 5402 dbSNP
rs905401017 5403 dbSNP
rs937088083 5409 dbSNP
rs1003713507 5410 dbSNP
rs1055490860 5425 dbSNP
rs1161198190 5440 dbSNP
rs1259937701 5451 dbSNP
rs1472802769 5452 dbSNP
rs1410892751 5453 dbSNP
rs1179610602 5456 dbSNP
rs774065242 5459 dbSNP
rs1443758535 5462 dbSNP
rs1056844 5464 dbSNP
rs1218785694 5474 dbSNP
rs1255447240 5479 dbSNP
rs1482603474 5489 dbSNP
rs1270585740 5492 dbSNP
rs1014357916 5494 dbSNP
rs1474948953 5502 dbSNP
rs115283180 5508 dbSNP
rs1416146685 5516 dbSNP
rs548503022 5521 dbSNP
rs886046598 5522 dbSNP
rs994790543 5523 dbSNP
rs1027488059 5534 dbSNP
rs1390851735 5543 dbSNP
rs1322494576 5548 dbSNP
rs1457668720 5549 dbSNP
rs953216840 5550 dbSNP
rs1387685091 5560 dbSNP
rs1361651428 5567 dbSNP
rs1156659581 5568 dbSNP
rs1473610199 5586 dbSNP
rs1004759624 5602 dbSNP
rs986200405 5613 dbSNP
rs1019458787 5614 dbSNP
rs547442300 5616 dbSNP
rs1249299379 5623 dbSNP
rs566649622 5628 dbSNP
rs1209944502 5630 dbSNP
rs762546676 5636 dbSNP
rs966047206 5640 dbSNP
rs1000984 5646 dbSNP
rs566799599 5649 dbSNP
rs1446594491 5661 dbSNP
rs1029593893 5664 dbSNP
rs1211997584 5677 dbSNP
rs1357415417 5678 dbSNP
rs1380812402 5686 dbSNP
rs1242816436 5692 dbSNP
rs1367480414 5693 dbSNP
rs954066404 5700 dbSNP
rs915526396 5702 dbSNP
rs914121541 5703 dbSNP
rs968694240 5711 dbSNP
rs1162310039 5713 dbSNP
rs979692276 5722 dbSNP
rs926773233 5724 dbSNP
rs938196303 5727 dbSNP
rs1449457375 5732 dbSNP
rs1246732089 5733 dbSNP
rs1055447637 5734 dbSNP
rs1452571941 5735 dbSNP
rs1278038247 5737 dbSNP
rs552383025 5738 dbSNP
rs1208330655 5739 dbSNP
rs1344556421 5740 dbSNP
rs761502080 5743 dbSNP
rs1227763256 5749 dbSNP
rs1239347737 5757 dbSNP
rs949713004 5757 dbSNP
rs1479778951 5760 dbSNP
rs1176883518 5762 dbSNP
rs1363044917 5763 dbSNP
rs1268361064 5771 dbSNP
rs1036432628 5774 dbSNP
rs376877690 5774 dbSNP
rs1322622385 5784 dbSNP
rs182533457 5785 dbSNP
rs894800483 5792 dbSNP
rs1172203605 5802 dbSNP
rs532975247 5803 dbSNP
rs1428555199 5808 dbSNP
rs1049006759 5813 dbSNP
rs1174860045 5815 dbSNP
rs550092922 5817 dbSNP
rs1246542787 5823 dbSNP
rs887661994 5828 dbSNP
rs1484198535 5843 dbSNP
rs1252822670 5847 dbSNP
rs1005215513 5848 dbSNP
rs1014730412 5856 dbSNP
rs545738955 5871 dbSNP
rs11190252 5890 dbSNP
rs886046599 5891 dbSNP
rs1274094629 5893 dbSNP
rs1439530520 5900 dbSNP
rs888921478 5906 dbSNP
rs1402873594 5911 dbSNP
rs1352037642 5913 dbSNP
rs1308281937 5919 dbSNP
rs1330319798 5927 dbSNP
rs1377211767 5933 dbSNP
rs1448635490 5941 dbSNP
rs1352304283 5944 dbSNP
rs1300998736 5945 dbSNP
rs1029728084 5954 dbSNP
rs1007415676 5956 dbSNP
rs1415601944 5958 dbSNP
rs1344202295 5959 dbSNP
rs537943594 5963 dbSNP
rs368793758 5972 dbSNP
rs1009687800 5973 dbSNP
rs1465034899 5976 dbSNP
rs35288704 5977 dbSNP
rs1479765963 5978 dbSNP
rs1021371415 5979 dbSNP
rs968043777 5989 dbSNP
rs188328622 5990 dbSNP
rs1210898910 5992 dbSNP
rs1441841534 5993 dbSNP
rs926897407 5995 dbSNP
rs968301840 6005 dbSNP
rs1221558840 6010 dbSNP
rs1330986297 6011 dbSNP
rs1288711636 6015 dbSNP
rs959493196 6016 dbSNP
rs992744899 6018 dbSNP
rs1370710413 6021 dbSNP
rs1285514203 6022 dbSNP
rs755371355 6026 dbSNP
rs760653453 6029 dbSNP
rs114201692 6031 dbSNP
rs949839300 6041 dbSNP
rs1335350336 6053 dbSNP
rs1192074991 6057 dbSNP
rs1459251644 6058 dbSNP
rs554479024 6063 dbSNP
rs918905779 6073 dbSNP
rs1478638956 6076 dbSNP
rs930307430 6087 dbSNP
rs1389896706 6088 dbSNP
rs572392805 6090 dbSNP
rs80332976 6092 dbSNP
rs916373703 6102 dbSNP
rs1417623713 6115 dbSNP
rs1426634238 6120 dbSNP
rs192215202 6122 dbSNP
rs1182603664 6126 dbSNP
rs1472521992 6127 dbSNP
rs1048724008 6131 dbSNP
rs1201735251 6132 dbSNP
rs1466182251 6134 dbSNP
rs1268591992 6136 dbSNP
rs1214802954 6139 dbSNP
rs1314844311 6152 dbSNP
rs1228491362 6164 dbSNP
rs887452841 6164 dbSNP
rs1169378633 6168 dbSNP
rs1400502152 6173 dbSNP
rs1007363389 6174 dbSNP
rs1312247227 6182 dbSNP
rs1040602812 6184 dbSNP
rs1437969188 6188 dbSNP
rs1366548548 6189 dbSNP
rs576180531 6197 dbSNP
rs1323642965 6201 dbSNP
rs1010047850 6206 dbSNP
rs543904506 6233 dbSNP
rs886046600 6235 dbSNP
rs562028646 6236 dbSNP
rs1276495612 6254 dbSNP
rs1383520150 6269 dbSNP
rs772993193 6269 dbSNP
rs1359824677 6274 dbSNP
rs765785143 6286 dbSNP
rs1451326305 6294 dbSNP
rs1000825478 6298 dbSNP
rs1185802510 6302 dbSNP
rs1484785704 6312 dbSNP
rs1266949545 6319 dbSNP
rs1221906197 6337 dbSNP
rs752667154 6339 dbSNP
rs1289037918 6343 dbSNP
rs184592729 6348 dbSNP
rs1229975315 6358 dbSNP
rs997337758 6361 dbSNP
rs1033859543 6365 dbSNP
rs959607481 6367 dbSNP
rs992465077 6377 dbSNP
rs1025547673 6380 dbSNP
rs1294465386 6383 dbSNP
rs961598180 6384 dbSNP
rs1363938860 6387 dbSNP
rs34131206 6393 dbSNP
rs968479225 6417 dbSNP
rs1289573440 6418 dbSNP
rs11405417 6419 dbSNP
rs1430502048 6419 dbSNP
rs1269265540 6427 dbSNP
rs1452594851 6428 dbSNP
rs1031705019 6429 dbSNP
rs1490105057 6440 dbSNP
rs1201489831 6446 dbSNP
rs1266344421 6447 dbSNP
rs1240821774 6452 dbSNP
rs960863957 6457 dbSNP
rs188726020 6460 dbSNP
rs1250234560 6466 dbSNP
rs972196065 6469 dbSNP
rs919027006 6476 dbSNP
rs1314444523 6478 dbSNP
rs1477783320 6479 dbSNP
rs192674807 6484 dbSNP
rs10883407 6488 dbSNP
rs984461109 6506 dbSNP
rs1162414162 6510 dbSNP
rs540618488 6516 dbSNP
rs1410627398 6522 dbSNP
rs184330466 6540 dbSNP
rs1296504635 6543 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.378 2.1e-4 0.423 3.4e-5 83 Click to see details
GSE17498 Multiple myeloma 0.515 3.4e-4 0.398 5.5e-3 40 Click to see details
GSE21849 B cell lymphoma -0.575 5.5e-4 -0.355 2.9e-2 29 Click to see details
GSE42095 Differentiated embryonic stem cells -0.618 8.4e-4 -0.559 2.8e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.485 1.5e-2 0.696 3.3e-4 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.465 1.9e-2 -0.298 1.0e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.165 7.3e-2 0.093 2.1e-1 79 Click to see details
GSE28260 Renal cortex and medulla -0.345 1.2e-1 -0.225 2.3e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.25 2.2e-1 0.021 4.7e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.166 2.2e-1 -0.214 1.6e-1 24 Click to see details
GSE19536 Breast cancer 0.073 2.4e-1 0.008 4.7e-1 100 Click to see details
GSE38226 Liver fibrosis 0.14 2.7e-1 0.238 1.5e-1 21 Click to see details
GSE17306 Multiple myeloma 0.076 3.0e-1 0.116 2.1e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.074 3.6e-1 0.063 3.8e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.033 3.8e-1 0.058 2.9e-1 90 Click to see details
GSE21687 Ependynoma primary tumors -0.037 3.9e-1 -0.013 4.6e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.054 4.0e-1 -0.082 3.5e-1 25 Click to see details
GSE28544 Breast cancer 0.053 4.0e-1 0.038 4.3e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.007 4.8e-1 -0.008 4.8e-1 32 Click to see details
GSE27834 Pluripotent stem cells -0.009 4.9e-1 0.153 2.9e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.009 4.9e-1 0.153 2.9e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.611 0 0.630 0 32 Click to see details
BLCA 0.563 0.01 0.577 0.01 18 Click to see details
BRCA -0.242 0.01 -0.280 0 84 Click to see details
COAD -0.716 0.02 -0.833 0.01 8 Click to see details
HNSC 0.281 0.04 0.241 0.06 42 Click to see details
ESCA -0.467 0.07 -0.609 0.02 11 Click to see details
CHOL -0.477 0.1 -0.383 0.15 9 Click to see details
PCPG -0.945 0.11 -1.000 0.5 3 Click to see details
PAAD -0.735 0.13 -0.200 0.4 4 Click to see details
KIRP -0.191 0.15 -0.254 0.08 32 Click to see details
LUSC 0.152 0.18 0.060 0.36 38 Click to see details
PRAD 0.13 0.18 0.120 0.2 50 Click to see details
KICH 0.169 0.21 -0.030 0.44 25 Click to see details
LIHC -0.118 0.21 -0.163 0.13 49 Click to see details
LUAD 0.249 0.22 0.322 0.15 12 Click to see details
KIRC 0.075 0.27 0.096 0.22 68 Click to see details
UCEC -0.081 0.37 -0.016 0.47 19 Click to see details
CESC -0.124 0.46 -0.500 0.33 3 Click to see details
THCA -0.003 0.49 -0.174 0.09 59 Click to see details
THCA -0.003 0.49 -0.174 0.09 59 Click to see details
THCA -0.003 0.49 -0.174 0.09 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding