miRTarBase - #MIRT248765 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATXN7L3B   
Synonyms lnc-SCA7
Description ataxin 7 like 3B
Transcript NM_001136262   
Expression
Putative miRNA Targets on ATXN7L3B
3'UTR of ATXN7L3B
(miRNA target sites are highlighted)
>ATXN7L3B|NM_001136262|3'UTR
   1 CTGCAAAATGAGAGTCTGAAAGTGGCCAGGACAATAACATAGACTGGTCCTGTGGCTTCGAGGAGTAAGCTAAGTAGAAA
  81 AAAGTAGAAAAATCAGACAAAAGTTTTAATTCCCCCTTGAAGATCCTAGCATTTAAAAACCCAAAGTGGATAATTTAGGA
 161 ATCCTTTTTTTAAAGTGTATTACCTGGAGCAAGCTCTGAAGCCCTGGGCAGGAGGAGCTGCACAGCCTGCGGGCCATGCA
 241 GTGCCTGTTGATCTCTAAACACACCAGGATGTGCGCAAGATCCTGTAGTGCCCCCAGTGCACAGGTGAGCAGTTGTGTGC
 321 CCAGCATATAAAATTTTTGGTTCCTCAGCCTTTCTGTCTGCCTGATGTCAAGGGCTTCCTGGACAGTTTGGACGTTACAG
 401 TTCGTCAGGCCGTGATCAGTGGCCTGCAGTGGGACTGCTCCTTTGATATCTGAACCTCTGTTATGGGCTTCTCTGAGACA
 481 AGTAAATGTCAGGTGCAAGATCTGGATACTAACAGTTTCAGTTTGGGAAATCCAAGAAAAAGAATTATCAAGTTTGATAG
 561 GGAAGCTCTGTAGCCTTGACTCCAGCAAGAAGAAAAGGTCAAAACCACGTGTTTCCCAAAAGTCCAGACTACAATGATTC
 641 AGCTGACTTGAGGACAAGGCCTAGCATTTGGCTGAGCAGAGCCCTCTTCCTTGCCCTCCAACCTGGTGGCATAGGCTTGG
 721 CAAATGGACAACTTGGTTGTCCAGACAGGTTGAGGATTCGGTTATGATCCCCTGGGGAGGTAGCAGGGACCTCTGCAACT
 801 ATGCATGATTTCTCAAACTTCAAGATTCATGTCTGGATGTATTATGCTGTGGATATAAGTTTAGTAGGGCGGTCATTTCC
 881 TACTCTGAGTTACTGGTTACCTAGCCAGTCCATGGGTGTGACTTGGTCCTTAAGTCAGGTCACTATCTGCCTCCCACCCT
 961 GGGGGCAGGACTGAAGTATAGAAGAGCATCATGGCTGTGCAGGAGGCTGTGGTTTGAAAACTGAGCCCAGAGGGCACTTT
1041 CAGCTGCCCTCAATAATGTGAATGGATTAGTGCTAGGAGCCAAGGAGCAGGACTGGATTATCTCATCTGACTGTGTGCAG
1121 AATCCTGTTGAATGTCCCTGTTTTCTTTGGTTGGGCAGTCAGAGCTCTGCTATGGTGAACATCCAGACTGTCACCACTTT
1201 CTGTCTGCCGCTCGAAAGGGATAGTCCTTTCCACTCGGTCCCCTTTGGATCTTCTTGACAACAGGAGCAGTCCTTTTATT
1281 GTTAGAAGTCAGAGAAAGACCTCCAGAATCTCCTGACTTTAGGGAATGGTATAGGGGAAGATGGGAAGTAAGAGTCACAT
1361 ATCAAAACTACCCTCCACTTTATTCCCTGAGCGAGGGTTTATGAAGTATAAAGGGGTGGGAGCCCCGAGGTGAGCGGGAA
1441 CGGTGCTGCTTTATTTGAAATGTTTTCTTACCTCATTCTGTGCCCCAGTAGGGGGTCCAGCCTCATCTGTCTGGCTTGGC
1521 CCTGTGTTCCTCCTGTCCCCTGCTCCACTGCCTATCTGGTGCCCCAGGTGCTGCTTGCCACTCCAGCTGTCACATTGAAC
1601 AGTTTCAATTCAGCTCTTAATGCTCCTGCTTCCGAAGCCTGCCCAATTTCTTTTTTCTTGGCCTCTGTTTTTTTTTTTTC
1681 TTTCTTTTTCCCTTGTTTTTGTAGAAGACTCAGAGGAGAATCTTTCTTATGGCTCCCTCTGTTGAGATTGGAATTGGAAG
1761 AGAACTTAATTTTTTGTATTTAAAATGCAGTGTCATGCCTATAAGCATTTCTCCTATATAGGACTGCTTTGCTAGTGTGC
1841 CCTCTTGCTGTGTCTTACTTCATAAGGAGTTGTATCTTCCCACCTCCATTTCAATACTGCCGGTTAGGACCTAAGTAGAA
1921 GAGCAGTAAAGGCTGATTGACACACAGGGGGATGGAGTTGGTCCTTGTCCATTCTCTCACCCTTGCTGTGCATGTATCAA
2001 TCCTTATCCCAGAAGGTACTATTTAGACTGTATAGACTGATTTAGATTACATACTTTAGAGGATTAAGGAAACCATAGAG
2081 TTTGGGCCTTGGAACTGTTACTGCCTTGTCCTAGAGTTGTCCTGATCAGGCTTGGGGCCTAGTTACAGATTAGTCTTAAA
2161 GAATTGCATTAACTTAAAAAAAATCAAACCTTGGCAAGAGCTAAAATAATTTGGAGATATCTTTGCCCTTGACTTGTAGA
2241 CGACATCTAAGAGGATGAAGAAAGGAGAGTCTAAGTGAGACTCTGGCCTACTTCCTAACAATGTCTTGGAAGTGGGATGA
2321 TGGTAAAGGAGAAAGGCCACAGTCCAATCCCTCTGCCTTCAGATAGGGAACTCAAATCCTGAAATTACTGTTTTCTTTCT
2401 GGCCTTTTCTCCTGGTTAGAGGAGGAAGCGGAAAGTAGTTTTGAGTAATACTTTGTTCATATTACCCCCCTTTTGTTTTT
2481 TGTTTCTGGCCCCTCTACCAATAGGGCAGTAGCCTCCTGCCCTGGATGGGTATAAGGTGGGCTTGGTCCAACAGGTGCCC
2561 AGAGGGTACATACTCCTTTCTGGGGAGAGAATGCTCCCTACCATATAGTTGACAGTGGTTAGGAACTCTCCCTTTCCCTA
2641 CCTACCTTCCTTTTAATAGCAGAATTCCTATTTTTCCCTTGATTATGTGTATTGATCACCCTGCAATCCTATTATGTATC
2721 TGAGTGTGTGTGTGTGTGTATGTGTGTGTTATGGGGGAAGGGGGGGGTTCTTTAAAATTTCTGTGGTTTGTGGCTTTTTC
2801 TTCCATACATTAGTTCCCACCATCGCATGCCCAGGGACCACTGCCTGGCATTATCGCATGCTGGGATCATCGGGGGAGGG
2881 TAGTGAAGCTCACCACTGTCCTTTGTTTTGGAGATTTTTATTTTTGCATAAGTAGTCCATCCTATACAGATAGCTGATTA
2961 ACTGTATTCCCCTTTCCCCTATGGCTGCTGGTGTAAATAAACTGCATCTCCCCATTGGTAAACAGTAATAAAATTTTAAA
3041 AAATGAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaaUACACGACGAu 5'
                     | |||||||| 
Target 5' tctggtgccccAGGTGCTGCTt 3'
1555 - 1576 147.00 -15.60
2
miRNA  3' guguuugguaauaCACGACGAu 5'
                       |||||||| 
Target 5' gtgagcgggaacgGTGCTGCTt 3'
1430 - 1451 145.00 -15.40
3
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            ||: :| | ||| | ||||| 
Target 5' ttCAGCTCTTAATGCTCCTGCTt 3'
1609 - 1631 128.00 -8.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30164552 11 COSMIC
COSN1151924 12 COSMIC
COSN31570931 58 COSMIC
COSN31611732 84 COSMIC
COSN30135231 88 COSMIC
COSN15623245 117 COSMIC
COSN24304571 272 COSMIC
COSN30111989 332 COSMIC
COSN31487830 355 COSMIC
COSN30120349 393 COSMIC
COSN31517177 404 COSMIC
COSN30118713 458 COSMIC
COSN9755400 503 COSMIC
COSN30135757 542 COSMIC
COSN31515230 543 COSMIC
COSN28686891 628 COSMIC
COSN32138128 753 COSMIC
COSN30125695 760 COSMIC
COSN31556674 803 COSMIC
COSN30142409 811 COSMIC
COSN31546127 830 COSMIC
COSN30529163 832 COSMIC
COSN23068064 837 COSMIC
COSN23336819 840 COSMIC
COSN30165588 858 COSMIC
COSN30125893 872 COSMIC
COSN30138957 898 COSMIC
COSN31485201 912 COSMIC
COSN30531519 913 COSMIC
COSN20109840 916 COSMIC
COSN8586682 932 COSMIC
COSN20109841 1160 COSMIC
COSN31488813 1178 COSMIC
COSN31517459 1215 COSMIC
COSN9755401 1215 COSMIC
COSN30509899 1237 COSMIC
COSN31483021 1237 COSMIC
COSN8586683 1266 COSMIC
COSN31589745 1336 COSMIC
COSN15623246 1387 COSMIC
COSN26643750 1428 COSMIC
COSN30510323 1445 COSMIC
COSN26638376 1483 COSMIC
COSN30129764 1506 COSMIC
COSN30130318 1520 COSMIC
COSN30116819 1598 COSMIC
COSN19655185 1668 COSMIC
COSN20109842 1680 COSMIC
COSN30543832 1691 COSMIC
COSN30543970 1693 COSMIC
COSN31609889 1727 COSMIC
COSN30532353 1734 COSMIC
COSN28741050 1758 COSMIC
COSN23012399 1776 COSMIC
COSN30541167 1788 COSMIC
COSN31550647 1788 COSMIC
COSN32056122 1813 COSMIC
COSN150096 1819 COSMIC
COSN30116887 1905 COSMIC
COSN26957908 1948 COSMIC
COSN30025318 1991 COSMIC
COSN31595915 2032 COSMIC
COSN31482421 2037 COSMIC
COSN30142733 2065 COSMIC
COSN30143062 2089 COSMIC
COSN30123859 2133 COSMIC
COSN20109848 2184 COSMIC
COSN31960819 2191 COSMIC
COSN9476388 2206 COSMIC
COSN15784714 2229 COSMIC
COSN31608155 2243 COSMIC
COSN26573780 2320 COSMIC
COSN2515639 2385 COSMIC
COSN31609315 2409 COSMIC
COSN8586684 2431 COSMIC
COSN31535279 2435 COSMIC
COSN31565813 2471 COSMIC
COSN17153157 2481 COSMIC
COSN8541368 2491 COSMIC
COSN28818081 2558 COSMIC
COSN31531415 2565 COSMIC
COSN31512792 2585 COSMIC
COSN31610516 2596 COSMIC
COSN27287497 2692 COSMIC
COSN15623247 2700 COSMIC
COSN1151925 2733 COSMIC
COSN29474225 2733 COSMIC
COSN30110737 2735 COSMIC
COSN23012401 2740 COSMIC
COSN1151926 2741 COSMIC
COSN26600424 2747 COSMIC
COSN30114060 2779 COSMIC
COSN15623248 2875 COSMIC
COSN30141721 2932 COSMIC
COSN27557800 3004 COSMIC
COSN31542044 3013 COSMIC
COSN31515172 3032 COSMIC
COSN9476389 3248 COSMIC
COSN16864615 3376 COSMIC
COSN16590036 3385 COSMIC
COSN21373672 3770 COSMIC
COSN22792650 4507 COSMIC
COSN8541369 4689 COSMIC
COSN25911852 4691 COSMIC
COSN21543426 4917 COSMIC
COSN19270051 5457 COSMIC
COSN1584808 5578 COSMIC
COSN15228264 5638 COSMIC
COSN1584809 5694 COSMIC
COSN20795422 5780 COSMIC
COSN24454112 6041 COSMIC
COSN22811661 6722 COSMIC
COSN5327625 6847 COSMIC
COSN15683685 6908 COSMIC
rs17113730 4341 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1229411524 3 dbSNP
rs1352856699 4 dbSNP
rs1397051877 7 dbSNP
rs773479272 17 dbSNP
rs549192762 24 dbSNP
rs1339022481 29 dbSNP
rs1452249259 31 dbSNP
rs1298564565 39 dbSNP
rs760882583 40 dbSNP
rs908630379 41 dbSNP
rs1226253404 44 dbSNP
rs1336267302 48 dbSNP
rs776303380 49 dbSNP
rs543078889 50 dbSNP
rs771034379 53 dbSNP
rs898636695 65 dbSNP
rs1471965360 72 dbSNP
rs1237512981 82 dbSNP
rs1003775965 87 dbSNP
rs1189025450 91 dbSNP
rs1440284089 92 dbSNP
rs1277551122 98 dbSNP
rs373171800 99 dbSNP
rs1331713084 101 dbSNP
rs1432979595 104 dbSNP
rs1228270030 112 dbSNP
rs1015115254 113 dbSNP
rs578182382 114 dbSNP
rs753866289 117 dbSNP
rs755471152 120 dbSNP
rs1445926524 123 dbSNP
rs543651149 125 dbSNP
rs938272517 127 dbSNP
rs1055365750 129 dbSNP
rs953579534 132 dbSNP
rs7959911 136 dbSNP
rs1399974393 137 dbSNP
rs1294058380 141 dbSNP
rs2001937 142 dbSNP
rs1384932113 143 dbSNP
rs192367948 145 dbSNP
rs944642905 148 dbSNP
rs1024352352 150 dbSNP
rs902952810 151 dbSNP
rs1188865390 153 dbSNP
rs1465996646 155 dbSNP
rs1352616489 160 dbSNP
rs1229055530 162 dbSNP
rs1287766609 164 dbSNP
rs1041587486 166 dbSNP
rs1032837500 167 dbSNP
rs1247545118 172 dbSNP
rs183080465 173 dbSNP
rs1488355441 176 dbSNP
rs975339028 177 dbSNP
rs1253495368 178 dbSNP
rs775011748 185 dbSNP
rs1298579620 196 dbSNP
rs1483201783 199 dbSNP
rs1181050353 201 dbSNP
rs527594494 206 dbSNP
rs547245275 208 dbSNP
rs1318231232 209 dbSNP
rs935871477 215 dbSNP
rs1054690539 216 dbSNP
rs894257012 217 dbSNP
rs1403078063 218 dbSNP
rs961496649 223 dbSNP
rs1013044088 231 dbSNP
rs1045445701 232 dbSNP
rs906840876 234 dbSNP
rs1186277481 237 dbSNP
rs1489048221 239 dbSNP
rs1220067226 240 dbSNP
rs938153626 240 dbSNP
rs1490336057 241 dbSNP
rs1055266326 245 dbSNP
rs1165393377 251 dbSNP
rs1230719395 251 dbSNP
rs1367880476 255 dbSNP
rs1422493012 256 dbSNP
rs1003870802 258 dbSNP
rs1309667937 258 dbSNP
rs1340287909 260 dbSNP
rs187952023 263 dbSNP
rs533001783 264 dbSNP
rs1295095231 265 dbSNP
rs1045417448 269 dbSNP
rs1364887248 270 dbSNP
rs995050426 274 dbSNP
rs1371185199 275 dbSNP
rs902837349 276 dbSNP
rs368236384 278 dbSNP
rs998586710 282 dbSNP
rs549696366 285 dbSNP
rs1314045989 286 dbSNP
rs1434098252 291 dbSNP
rs1054132217 292 dbSNP
rs1321695205 294 dbSNP
rs1028204708 300 dbSNP
rs1253240672 316 dbSNP
rs1277163289 329 dbSNP
rs1207378462 332 dbSNP
rs996642142 336 dbSNP
rs953490693 346 dbSNP
rs1211030650 349 dbSNP
rs1314199657 350 dbSNP
rs142153044 351 dbSNP
rs1217274532 356 dbSNP
rs1343343812 363 dbSNP
rs955334440 364 dbSNP
rs1288983295 365 dbSNP
rs535550552 368 dbSNP
rs1348138231 371 dbSNP
rs1297126526 372 dbSNP
rs625531 380 dbSNP
rs1360553127 382 dbSNP
rs1174382661 383 dbSNP
rs1469671934 387 dbSNP
rs1230889399 390 dbSNP
rs1413305178 394 dbSNP
rs1471911243 400 dbSNP
rs1483940504 403 dbSNP
rs966045009 404 dbSNP
rs1015624695 412 dbSNP
rs1484323698 413 dbSNP
rs977372387 415 dbSNP
rs1255351669 416 dbSNP
rs1322602885 418 dbSNP
rs1268666804 420 dbSNP
rs1230103252 432 dbSNP
rs1333941519 436 dbSNP
rs924568175 441 dbSNP
rs1442659902 446 dbSNP
rs1170442378 447 dbSNP
rs1380881832 460 dbSNP
rs1390491431 461 dbSNP
rs961349204 465 dbSNP
rs935906893 466 dbSNP
rs990004061 468 dbSNP
rs920017189 470 dbSNP
rs1456045754 475 dbSNP
rs959406699 480 dbSNP
rs1165559666 481 dbSNP
rs1425707975 482 dbSNP
rs1254304319 483 dbSNP
rs1170000322 487 dbSNP
rs1183275885 488 dbSNP
rs1353031792 490 dbSNP
rs1467627367 491 dbSNP
rs1210362006 492 dbSNP
rs151190293 494 dbSNP
rs192069582 499 dbSNP
rs558533863 503 dbSNP
rs1323048317 509 dbSNP
rs918051739 510 dbSNP
rs1244733014 521 dbSNP
rs1300454485 525 dbSNP
rs915708752 539 dbSNP
rs1366372481 545 dbSNP
rs948512670 549 dbSNP
rs552774473 550 dbSNP
rs906934271 552 dbSNP
rs1313632298 553 dbSNP
rs924342237 557 dbSNP
rs1459491548 558 dbSNP
rs569485946 559 dbSNP
rs1163043407 560 dbSNP
rs1054013811 564 dbSNP
rs745525345 566 dbSNP
rs1190268076 574 dbSNP
rs996526694 578 dbSNP
rs1254859601 580 dbSNP
rs578247468 584 dbSNP
rs1459605327 591 dbSNP
rs898085199 592 dbSNP
rs1210307337 593 dbSNP
rs755774515 596 dbSNP
rs377451827 599 dbSNP
rs1027840143 600 dbSNP
rs184459910 601 dbSNP
rs890939841 606 dbSNP
rs1225666561 609 dbSNP
rs1184609429 616 dbSNP
rs3892342 618 dbSNP
rs1364258611 620 dbSNP
rs1416340312 624 dbSNP
rs1019008037 625 dbSNP
rs370342400 632 dbSNP
rs966094772 634 dbSNP
rs576107066 635 dbSNP
rs140410529 636 dbSNP
rs1372245747 641 dbSNP
rs1199307689 648 dbSNP
rs1434774105 658 dbSNP
rs957330402 667 dbSNP
rs374422675 676 dbSNP
rs528324013 677 dbSNP
rs1221092533 682 dbSNP
rs1483122315 683 dbSNP
rs995509786 684 dbSNP
rs1193669436 685 dbSNP
rs1338382183 694 dbSNP
rs1430425254 705 dbSNP
rs1026965014 730 dbSNP
rs1344159884 733 dbSNP
rs1283251409 740 dbSNP
rs1410491447 742 dbSNP
rs1352358927 746 dbSNP
rs1326966026 751 dbSNP
rs1409532196 753 dbSNP
rs1268751499 755 dbSNP
rs959457289 760 dbSNP
rs561353365 761 dbSNP
rs1172930326 762 dbSNP
rs752875023 769 dbSNP
rs990446584 772 dbSNP
rs1470869767 776 dbSNP
rs915819710 779 dbSNP
rs948585632 780 dbSNP
rs981271152 789 dbSNP
rs1300167396 791 dbSNP
rs1198670264 792 dbSNP
rs1472892214 794 dbSNP
rs1179054214 801 dbSNP
rs1436808608 802 dbSNP
rs1278965982 805 dbSNP
rs928403130 806 dbSNP
rs939718213 809 dbSNP
rs1262935263 816 dbSNP
rs1036702205 822 dbSNP
rs879845060 823 dbSNP
rs1210112713 828 dbSNP
rs1277788388 829 dbSNP
rs1441635702 831 dbSNP
rs971304128 832 dbSNP
rs11557005 837 dbSNP
rs898130557 838 dbSNP
rs571757963 840 dbSNP
rs540617885 844 dbSNP
rs1175486294 847 dbSNP
rs1410089985 850 dbSNP
rs1457643576 850 dbSNP
rs1156291572 856 dbSNP
rs924193653 867 dbSNP
rs1237672307 870 dbSNP
rs930921849 871 dbSNP
rs989791819 874 dbSNP
rs1242845478 880 dbSNP
rs914208322 881 dbSNP
rs1466625975 883 dbSNP
rs748021551 884 dbSNP
rs932430660 886 dbSNP
rs564076077 887 dbSNP
rs1248190829 888 dbSNP
rs533056417 889 dbSNP
rs189485719 902 dbSNP
rs1244005672 907 dbSNP
rs1019060360 913 dbSNP
rs10579692 913 dbSNP
rs67268352 913 dbSNP
rs777446799 913 dbSNP
rs771967213 916 dbSNP
rs1435619303 918 dbSNP
rs998874533 921 dbSNP
rs1031686301 926 dbSNP
rs1400065466 932 dbSNP
rs1412839012 935 dbSNP
rs1413832750 937 dbSNP
rs1400587613 957 dbSNP
rs1164938206 961 dbSNP
rs192859927 967 dbSNP
rs1384285602 968 dbSNP
rs1351917445 972 dbSNP
rs1437709248 977 dbSNP
rs1476614790 979 dbSNP
rs1240845335 980 dbSNP
rs2605380 981 dbSNP
rs895130944 986 dbSNP
rs1343304270 990 dbSNP
rs1023343429 991 dbSNP
rs1358983595 998 dbSNP
rs142556357 999 dbSNP
rs1012374106 1012 dbSNP
rs1363752776 1021 dbSNP
rs536761060 1022 dbSNP
rs760899117 1022 dbSNP
rs1288383397 1027 dbSNP
rs981282512 1028 dbSNP
rs1350411819 1030 dbSNP
rs970800990 1032 dbSNP
rs1422281093 1035 dbSNP
rs928414540 1037 dbSNP
rs1221943994 1038 dbSNP
rs1291943157 1041 dbSNP
rs1186303418 1042 dbSNP
rs978665855 1046 dbSNP
rs961134443 1048 dbSNP
rs1197359516 1050 dbSNP
rs549161533 1051 dbSNP
rs1275595265 1052 dbSNP
rs1031103435 1054 dbSNP
rs1305989187 1056 dbSNP
rs1270549631 1059 dbSNP
rs1213834093 1062 dbSNP
rs1220617929 1063 dbSNP
rs972447721 1066 dbSNP
rs1285154350 1073 dbSNP
rs958293690 1081 dbSNP
rs1268411617 1088 dbSNP
rs1489910040 1096 dbSNP
rs1184643578 1100 dbSNP
rs919672683 1102 dbSNP
rs1308147664 1105 dbSNP
rs1463141177 1108 dbSNP
rs1352417017 1114 dbSNP
rs184801138 1126 dbSNP
rs771103393 1131 dbSNP
rs932306815 1133 dbSNP
rs1174968361 1136 dbSNP
rs535057976 1138 dbSNP
rs1252547086 1150 dbSNP
rs1179039274 1152 dbSNP
rs199727656 1154 dbSNP
rs11557006 1155 dbSNP
rs3839973 1156 dbSNP
rs66687418 1156 dbSNP
rs755332705 1156 dbSNP
rs200143738 1160 dbSNP
rs371371363 1162 dbSNP
rs1037286934 1165 dbSNP
rs1406295267 1173 dbSNP
rs1221574141 1180 dbSNP
rs896978452 1186 dbSNP
rs1288369396 1189 dbSNP
rs1163386569 1198 dbSNP
rs1392687482 1198 dbSNP
rs1297295171 1200 dbSNP
rs1370721398 1200 dbSNP
rs931244621 1202 dbSNP
rs1048340451 1204 dbSNP
rs118009023 1209 dbSNP
rs115335784 1210 dbSNP
rs755462673 1211 dbSNP
rs557543366 1214 dbSNP
rs901992384 1219 dbSNP
rs1334591035 1221 dbSNP
rs759712510 1232 dbSNP
rs998967694 1234 dbSNP
rs1462852277 1235 dbSNP
rs1031155888 1237 dbSNP
rs1285859266 1241 dbSNP
rs1357016271 1247 dbSNP
rs1433403270 1260 dbSNP
rs1314669009 1261 dbSNP
rs1305702428 1264 dbSNP
rs1246170563 1272 dbSNP
rs189266758 1278 dbSNP
rs1335126355 1285 dbSNP
rs1452451054 1292 dbSNP
rs1245193009 1293 dbSNP
rs1011151805 1294 dbSNP
rs1452285340 1301 dbSNP
rs536853407 1303 dbSNP
rs55707513 1308 dbSNP
rs147006994 1318 dbSNP
rs1251602904 1321 dbSNP
rs1437297494 1323 dbSNP
rs1383684555 1329 dbSNP
rs1181523882 1330 dbSNP
rs985549566 1334 dbSNP
rs1262318144 1335 dbSNP
rs1012025916 1338 dbSNP
rs1022931554 1349 dbSNP
rs912201663 1366 dbSNP
rs965532219 1372 dbSNP
rs1473387572 1373 dbSNP
rs972460856 1374 dbSNP
rs969967152 1383 dbSNP
rs1259569138 1384 dbSNP
rs540655708 1386 dbSNP
rs918464317 1392 dbSNP
rs557303875 1393 dbSNP
rs137952266 1394 dbSNP
rs543312911 1396 dbSNP
rs1035534935 1398 dbSNP
rs961228013 1415 dbSNP
rs1327338163 1417 dbSNP
rs1022401358 1418 dbSNP
rs181064108 1427 dbSNP
rs972574189 1436 dbSNP
rs1294183225 1439 dbSNP
rs1363912202 1441 dbSNP
rs1163233111 1442 dbSNP
rs1430672409 1443 dbSNP
rs140445567 1444 dbSNP
rs3839974 1444 dbSNP
rs919709426 1457 dbSNP
rs186408073 1463 dbSNP
rs542833351 1472 dbSNP
rs1426648258 1473 dbSNP
rs985535207 1477 dbSNP
rs1199469007 1479 dbSNP
rs910847731 1484 dbSNP
rs765675463 1485 dbSNP
rs943639101 1492 dbSNP
rs1288979938 1493 dbSNP
rs906519126 1495 dbSNP
rs1040634779 1498 dbSNP
rs749914909 1500 dbSNP
rs1339661083 1501 dbSNP
rs1225773064 1506 dbSNP
rs923509391 1506 dbSNP
rs763304698 1508 dbSNP
rs934871451 1510 dbSNP
rs1312843292 1512 dbSNP
rs1367094067 1515 dbSNP
rs559920017 1517 dbSNP
rs1398979618 1520 dbSNP
rs1052468978 1529 dbSNP
rs1053283754 1530 dbSNP
rs1372405296 1534 dbSNP
rs752705206 1535 dbSNP
rs1011623140 1541 dbSNP
rs1266064418 1543 dbSNP
rs1194322900 1545 dbSNP
rs528573704 1548 dbSNP
rs551818879 1549 dbSNP
rs1438035451 1554 dbSNP
rs571515489 1555 dbSNP
rs905833856 1560 dbSNP
rs531242394 1562 dbSNP
rs550942983 1568 dbSNP
rs1183445935 1578 dbSNP
rs1241904067 1579 dbSNP
rs1443105612 1580 dbSNP
rs1337723772 1582 dbSNP
rs1327161477 1588 dbSNP
rs111586573 1590 dbSNP
rs1189657772 1592 dbSNP
rs1372901566 1605 dbSNP
rs1019722873 1607 dbSNP
rs1002860957 1609 dbSNP
rs1035630987 1613 dbSNP
rs1365163642 1617 dbSNP
rs1179166508 1628 dbSNP
rs1474195399 1630 dbSNP
rs1436896610 1634 dbSNP
rs1205983918 1635 dbSNP
rs972513175 1638 dbSNP
rs897071635 1639 dbSNP
rs764571020 1647 dbSNP
rs78518899 1651 dbSNP
rs567942280 1653 dbSNP
rs1383814483 1665 dbSNP
rs113359210 1668 dbSNP
rs1333488534 1668 dbSNP
rs1491027745 1668 dbSNP
rs397709662 1668 dbSNP
rs58069390 1668 dbSNP
rs60711836 1668 dbSNP
rs747775888 1668 dbSNP
rs796506491 1668 dbSNP
rs1156310836 1669 dbSNP
rs1468899193 1670 dbSNP
rs1385548852 1676 dbSNP
rs952402548 1677 dbSNP
rs1390803544 1678 dbSNP
rs1242943468 1679 dbSNP
rs1435501110 1680 dbSNP
rs200316731 1681 dbSNP
rs5002508 1683 dbSNP
rs141911784 1684 dbSNP
rs1204687996 1685 dbSNP
rs1225442791 1690 dbSNP
rs1026783756 1691 dbSNP
rs1324367608 1696 dbSNP
rs1203176788 1697 dbSNP
rs1247874134 1701 dbSNP
rs565461426 1702 dbSNP
rs1283413294 1709 dbSNP
rs1431303426 1718 dbSNP
rs114397456 1721 dbSNP
rs1418604992 1723 dbSNP
rs1046291822 1724 dbSNP
rs1206266042 1728 dbSNP
rs927993342 1730 dbSNP
rs1261404021 1733 dbSNP
rs1187480719 1734 dbSNP
rs1445644270 1736 dbSNP
rs1476665390 1737 dbSNP
rs1200548106 1742 dbSNP
rs1193003522 1748 dbSNP
rs189588649 1750 dbSNP
rs1294076691 1756 dbSNP
rs1052351784 1761 dbSNP
rs1479814303 1762 dbSNP
rs181521697 1763 dbSNP
rs1341347340 1764 dbSNP
rs1173681242 1770 dbSNP
rs1268393895 1770 dbSNP
rs1413566865 1771 dbSNP
rs1457655266 1781 dbSNP
rs1345551769 1788 dbSNP
rs1017968298 1792 dbSNP
rs1402647142 1795 dbSNP
rs965039380 1802 dbSNP
rs1171554706 1803 dbSNP
rs543402487 1814 dbSNP
rs976387409 1817 dbSNP
rs923560279 1821 dbSNP
rs1382425574 1825 dbSNP
rs1481071159 1832 dbSNP
rs1388368228 1838 dbSNP
rs934881092 1842 dbSNP
rs1197379481 1849 dbSNP
rs1050582985 1862 dbSNP
rs989388133 1863 dbSNP
rs914723707 1866 dbSNP
rs889272557 1876 dbSNP
rs185974129 1884 dbSNP
rs1044583 1887 dbSNP
rs905927012 1892 dbSNP
rs779888369 1893 dbSNP
rs753407181 1901 dbSNP
rs1057146118 1902 dbSNP
rs1284626679 1913 dbSNP
rs1260726402 1924 dbSNP
rs1348972457 1925 dbSNP
rs897079955 1937 dbSNP
rs994058397 1943 dbSNP
rs1298443172 1946 dbSNP
rs1443956434 1946 dbSNP
rs191637973 1948 dbSNP
rs888255709 1950 dbSNP
rs1470556942 1955 dbSNP
rs1432160231 1961 dbSNP
rs1025288864 1965 dbSNP
rs576828043 1968 dbSNP
rs1389488 1977 dbSNP
rs965093634 1982 dbSNP
rs1479782989 1983 dbSNP
rs1023911241 1984 dbSNP
rs1253276613 1995 dbSNP
rs1197838533 1997 dbSNP
rs528610945 2001 dbSNP
rs1030585804 2002 dbSNP
rs1311055564 2003 dbSNP
rs927910646 2005 dbSNP
rs935210041 2006 dbSNP
rs1370743416 2011 dbSNP
rs748120888 2013 dbSNP
rs988114668 2016 dbSNP
rs1362051923 2022 dbSNP
rs956509592 2026 dbSNP
rs1459229872 2027 dbSNP
rs915229944 2039 dbSNP
rs1163581875 2052 dbSNP
rs1364757484 2058 dbSNP
rs1335255108 2059 dbSNP
rs1466006805 2063 dbSNP
rs1345793097 2066 dbSNP
rs946827155 2076 dbSNP
rs989049540 2085 dbSNP
rs1417542044 2087 dbSNP
rs745667537 2089 dbSNP
rs1379989226 2100 dbSNP
rs1177742013 2104 dbSNP
rs1445066724 2116 dbSNP
rs1404502537 2121 dbSNP
rs1244772365 2122 dbSNP
rs1180006348 2124 dbSNP
rs1301528948 2128 dbSNP
rs771846060 2139 dbSNP
rs545474710 2142 dbSNP
rs769709761 2144 dbSNP
rs73340767 2152 dbSNP
rs777576538 2154 dbSNP
rs1246284567 2155 dbSNP
rs980263034 2156 dbSNP
rs944902187 2163 dbSNP
rs530854107 2165 dbSNP
rs898100525 2167 dbSNP
rs938711985 2169 dbSNP
rs1164400005 2176 dbSNP
rs1451770633 2176 dbSNP
rs3832833 2176 dbSNP
rs398044514 2176 dbSNP
rs75285156 2177 dbSNP
rs1025341634 2186 dbSNP
rs181130751 2190 dbSNP
rs145879639 2191 dbSNP
rs1262427861 2200 dbSNP
rs1187736136 2207 dbSNP
rs897133743 2211 dbSNP
rs1219717320 2212 dbSNP
rs1487051801 2221 dbSNP
rs1261872766 2222 dbSNP
rs1276418993 2232 dbSNP
rs1361162739 2233 dbSNP
rs1264030691 2234 dbSNP
rs1480666524 2238 dbSNP
rs530303973 2242 dbSNP
rs1023374829 2243 dbSNP
rs969508442 2245 dbSNP
rs929894290 2249 dbSNP
rs1398717007 2254 dbSNP
rs1425434977 2267 dbSNP
rs1339886279 2271 dbSNP
rs1303844330 2272 dbSNP
rs1048332012 2273 dbSNP
rs1184146286 2274 dbSNP
rs888360655 2276 dbSNP
rs546806813 2292 dbSNP
rs1422585138 2294 dbSNP
rs1364009541 2296 dbSNP
rs1161885230 2300 dbSNP
rs1006760601 2304 dbSNP
rs1161242204 2310 dbSNP
rs1373552878 2318 dbSNP
rs981969136 2324 dbSNP
rs1035242685 2326 dbSNP
rs566685142 2329 dbSNP
rs956650383 2335 dbSNP
rs1490737001 2336 dbSNP
rs1039480882 2342 dbSNP
rs900934134 2344 dbSNP
rs1398248661 2348 dbSNP
rs1253482937 2352 dbSNP
rs915282402 2362 dbSNP
rs1217269317 2365 dbSNP
rs1316360013 2366 dbSNP
rs1317855266 2370 dbSNP
rs946712718 2371 dbSNP
rs986504721 2384 dbSNP
rs1329535982 2385 dbSNP
rs1323203226 2389 dbSNP
rs1392208075 2396 dbSNP
rs997867708 2399 dbSNP
rs73190463 2404 dbSNP
rs867819985 2410 dbSNP
rs1463985026 2413 dbSNP
rs1422907387 2415 dbSNP
rs1040558429 2417 dbSNP
rs1481159877 2427 dbSNP
rs897981089 2428 dbSNP
rs557615004 2430 dbSNP
rs1049337481 2431 dbSNP
rs1253032598 2432 dbSNP
rs888146233 2444 dbSNP
rs1389487 2449 dbSNP
rs1264354048 2450 dbSNP
rs1389486 2452 dbSNP
rs904958849 2453 dbSNP
rs1003690729 2465 dbSNP
rs1239958500 2465 dbSNP
rs1311171424 2465 dbSNP
rs556893356 2469 dbSNP
rs1242517976 2470 dbSNP
rs1034884175 2471 dbSNP
rs1442519785 2475 dbSNP
rs1399355637 2476 dbSNP
rs143775776 2476 dbSNP
rs1453985455 2477 dbSNP
rs1009473980 2478 dbSNP
rs1190314508 2482 dbSNP
rs1419997552 2483 dbSNP
rs1429293858 2487 dbSNP
rs1170028867 2488 dbSNP
rs1352771984 2492 dbSNP
rs573874250 2492 dbSNP
rs1022177137 2494 dbSNP
rs536514990 2496 dbSNP
rs1439526791 2498 dbSNP
rs1244158685 2502 dbSNP
rs980274284 2508 dbSNP
rs927403826 2509 dbSNP
rs553212004 2518 dbSNP
rs1185925975 2519 dbSNP
rs1441203861 2531 dbSNP
rs1277982949 2536 dbSNP
rs986170089 2538 dbSNP
rs1337949424 2541 dbSNP
rs1406058057 2543 dbSNP
rs774041618 2544 dbSNP
rs910517801 2549 dbSNP
rs573025014 2552 dbSNP
rs8744 2558 dbSNP
rs375764684 2560 dbSNP
rs976552333 2565 dbSNP
rs903952208 2568 dbSNP
rs992881520 2571 dbSNP
rs918651788 2579 dbSNP
rs545783678 2586 dbSNP
rs930033851 2589 dbSNP
rs1048870329 2590 dbSNP
rs1363108427 2592 dbSNP
rs1156410373 2599 dbSNP
rs1418747782 2599 dbSNP
rs1386188051 2602 dbSNP
rs1213554963 2614 dbSNP
rs1293078447 2619 dbSNP
rs1472091068 2620 dbSNP
rs868284885 2628 dbSNP
rs754937042 2629 dbSNP
rs1049224097 2630 dbSNP
rs1223643856 2630 dbSNP
rs565271951 2632 dbSNP
rs1459890370 2639 dbSNP
rs112276890 2641 dbSNP
rs1394757311 2642 dbSNP
rs1039531156 2645 dbSNP
rs559043121 2645 dbSNP
rs900986068 2647 dbSNP
rs750677863 2649 dbSNP
rs1485425963 2657 dbSNP
rs1052158966 2662 dbSNP
rs1431428122 2668 dbSNP
rs528398353 2671 dbSNP
rs186369470 2674 dbSNP
rs767095219 2682 dbSNP
rs1295820195 2685 dbSNP
rs1398992837 2688 dbSNP
rs1022344651 2693 dbSNP
rs1325901546 2694 dbSNP
rs968998185 2698 dbSNP
rs1413551751 2701 dbSNP
rs1417711585 2707 dbSNP
rs1056134908 2722 dbSNP
rs1001761351 2723 dbSNP
rs112092486 2724 dbSNP
rs1193116234 2724 dbSNP
rs1223469399 2724 dbSNP
rs1491223178 2724 dbSNP
rs3031589 2724 dbSNP
rs772709305 2724 dbSNP
rs1491274404 2725 dbSNP
rs1428721116 2726 dbSNP
rs201982606 2729 dbSNP
rs199589484 2732 dbSNP
rs1468646075 2733 dbSNP
rs78949164 2733 dbSNP
rs1275751299 2737 dbSNP
rs1320854321 2741 dbSNP
rs1345722234 2743 dbSNP
rs1346152523 2745 dbSNP
rs1276201326 2747 dbSNP
rs561302529 2751 dbSNP
rs1349591136 2753 dbSNP
rs992994560 2755 dbSNP
rs1286731549 2758 dbSNP
rs201619612 2759 dbSNP
rs1398826570 2760 dbSNP
rs1467631469 2760 dbSNP
rs1480833226 2760 dbSNP
rs34295267 2760 dbSNP
rs397750950 2760 dbSNP
rs200058810 2761 dbSNP
rs1189658443 2767 dbSNP
rs1245858457 2774 dbSNP
rs1199106591 2776 dbSNP
rs918715787 2787 dbSNP
rs764652692 2791 dbSNP
rs984143953 2806 dbSNP
rs909851070 2808 dbSNP
rs1009359450 2810 dbSNP
rs942634879 2814 dbSNP
rs1022062537 2821 dbSNP
rs1039625803 2825 dbSNP
rs1405209835 2826 dbSNP
rs530337285 2832 dbSNP
rs933864928 2839 dbSNP
rs1052689844 2842 dbSNP
rs1017625668 2848 dbSNP
rs1375300883 2849 dbSNP
rs1320825964 2850 dbSNP
rs1331207689 2856 dbSNP
rs892222933 2857 dbSNP
rs946419153 2862 dbSNP
rs976225623 2863 dbSNP
rs1174063802 2865 dbSNP
rs919347799 2866 dbSNP
rs1043414622 2867 dbSNP
rs1178994071 2870 dbSNP
rs1441260931 2871 dbSNP
rs904825560 2872 dbSNP
rs984975404 2873 dbSNP
rs1001855998 2877 dbSNP
rs1483543625 2881 dbSNP
rs1284957895 2884 dbSNP
rs1034622578 2889 dbSNP
rs1286347481 2891 dbSNP
rs1316108604 2896 dbSNP
rs949023051 2902 dbSNP
rs1213446533 2929 dbSNP
rs17856289 2930 dbSNP
rs386764298 2932 dbSNP
rs542661691 2932 dbSNP
rs532048757 2935 dbSNP
rs1200432045 2936 dbSNP
rs17850452 2936 dbSNP
rs1045040600 2937 dbSNP
rs560410731 2938 dbSNP
rs1268186844 2945 dbSNP
rs926343843 2949 dbSNP
rs896063610 2951 dbSNP
rs1014440812 2957 dbSNP
rs939023665 2962 dbSNP
rs1026195954 2968 dbSNP
rs752077913 2971 dbSNP
rs1418101959 2973 dbSNP
rs1160782958 2979 dbSNP
rs532608132 2982 dbSNP
rs1258229613 3000 dbSNP
rs1179586586 3009 dbSNP
rs1482617456 3013 dbSNP
rs552722109 3014 dbSNP
rs571281528 3024 dbSNP
rs1351073821 3038 dbSNP
rs984583377 3039 dbSNP
rs1405120337 3050 dbSNP
rs1324001388 3051 dbSNP
rs76361407 3055 dbSNP
rs1343094148 3062 dbSNP
rs1228280892 3065 dbSNP
rs550320134 3065 dbSNP
rs1341137520 3075 dbSNP
rs760780934 3082 dbSNP
rs867412379 3085 dbSNP
rs149620078 3086 dbSNP
rs1360205681 3098 dbSNP
rs1297323682 3101 dbSNP
rs1458265320 3103 dbSNP
rs1222037218 3108 dbSNP
rs975381552 3111 dbSNP
rs759823003 3134 dbSNP
rs922554957 3135 dbSNP
rs1007512712 3136 dbSNP
rs536551358 3143 dbSNP
rs987994405 3148 dbSNP
rs901724778 3151 dbSNP
rs997518878 3156 dbSNP
rs1291386486 3159 dbSNP
rs1026294740 3161 dbSNP
rs1489646778 3162 dbSNP
rs1451117899 3170 dbSNP
rs1184123305 3171 dbSNP
rs913699051 3183 dbSNP
rs946498355 3184 dbSNP
rs1175997407 3187 dbSNP
rs1043893646 3190 dbSNP
rs767977805 3191 dbSNP
rs1425767977 3192 dbSNP
rs1216918345 3205 dbSNP
rs937695623 3210 dbSNP
rs1302184844 3211 dbSNP
rs1056110805 3217 dbSNP
rs980259382 3223 dbSNP
rs565472202 3224 dbSNP
rs1162524795 3232 dbSNP
rs896074938 3234 dbSNP
rs1014900260 3249 dbSNP
rs553348936 3255 dbSNP
rs1411124561 3262 dbSNP
rs1328904107 3268 dbSNP
rs887302826 3270 dbSNP
rs1476524758 3272 dbSNP
rs1422325257 3275 dbSNP
rs1199043691 3277 dbSNP
rs1434556018 3280 dbSNP
rs1265688883 3283 dbSNP
rs1209687383 3292 dbSNP
rs1353439063 3297 dbSNP
rs1005701294 3299 dbSNP
rs991797677 3299 dbSNP
rs1017476233 3300 dbSNP
rs191027213 3312 dbSNP
rs77898204 3317 dbSNP
rs1317332854 3323 dbSNP
rs144351913 3326 dbSNP
rs575667882 3328 dbSNP
rs753187596 3335 dbSNP
rs544654410 3338 dbSNP
rs1329629070 3341 dbSNP
rs1298921718 3351 dbSNP
rs903721399 3353 dbSNP
rs144934880 3357 dbSNP
rs1333236258 3360 dbSNP
rs955309306 3362 dbSNP
rs588875 3364 dbSNP
rs748952614 3367 dbSNP
rs1467255010 3368 dbSNP
rs757874239 3372 dbSNP
rs1198569457 3382 dbSNP
rs913804174 3385 dbSNP
rs946563262 3388 dbSNP
rs758945041 3389 dbSNP
rs926369296 3399 dbSNP
rs1177245001 3414 dbSNP
rs574539643 3423 dbSNP
rs17113716 3429 dbSNP
rs1437322479 3430 dbSNP
rs1056162426 3431 dbSNP
rs560447245 3432 dbSNP
rs1197302780 3437 dbSNP
rs1202320732 3440 dbSNP
rs886436542 3441 dbSNP
rs917560059 3442 dbSNP
rs1255682774 3448 dbSNP
rs1006343628 3451 dbSNP
rs1354061859 3464 dbSNP
rs647129 3467 dbSNP
rs552517244 3472 dbSNP
rs1335166224 3481 dbSNP
rs1334212971 3482 dbSNP
rs563064003 3483 dbSNP
rs970127212 3490 dbSNP
rs1476162216 3491 dbSNP
rs530527498 3494 dbSNP
rs550601683 3496 dbSNP
rs1395136829 3499 dbSNP
rs552737681 3499 dbSNP
rs567363275 3508 dbSNP
rs1407771080 3509 dbSNP
rs536290989 3509 dbSNP
rs187702399 3516 dbSNP
rs1038466051 3531 dbSNP
rs899928084 3540 dbSNP
rs996861690 3541 dbSNP
rs1406785589 3556 dbSNP
rs1451862259 3568 dbSNP
rs1217543198 3573 dbSNP
rs1489425668 3575 dbSNP
rs1334390683 3576 dbSNP
rs1327989913 3581 dbSNP
rs1349841252 3589 dbSNP
rs1029631371 3590 dbSNP
rs1229799138 3591 dbSNP
rs1338125748 3593 dbSNP
rs989001757 3596 dbSNP
rs1400216114 3598 dbSNP
rs566797595 3604 dbSNP
rs913611991 3605 dbSNP
rs1362140584 3613 dbSNP
rs1296708572 3614 dbSNP
rs945038562 3622 dbSNP
rs1415011514 3624 dbSNP
rs112643838 3639 dbSNP
rs925029033 3640 dbSNP
rs1009551559 3647 dbSNP
rs590166 3648 dbSNP
rs1261363040 3649 dbSNP
rs1216192296 3653 dbSNP
rs536619168 3653 dbSNP
rs967959035 3655 dbSNP
rs1290336647 3657 dbSNP
rs1211506197 3672 dbSNP
rs1354236108 3674 dbSNP
rs1292129508 3676 dbSNP
rs115535882 3687 dbSNP
rs926420917 3700 dbSNP
rs537642573 3701 dbSNP
rs554684755 3703 dbSNP
rs1341968312 3704 dbSNP
rs1254437573 3705 dbSNP
rs1449163177 3707 dbSNP
rs1429591210 3714 dbSNP
rs17179875 3716 dbSNP
rs991940226 3718 dbSNP
rs1394444192 3720 dbSNP
rs1372193419 3726 dbSNP
rs540258480 3728 dbSNP
rs1478815171 3730 dbSNP
rs76826943 3731 dbSNP
rs1429405187 3733 dbSNP
rs929005401 3734 dbSNP
rs577134235 3738 dbSNP
rs908793277 3740 dbSNP
rs1006227648 3741 dbSNP
rs1037683661 3743 dbSNP
rs941581262 3746 dbSNP
rs1247054067 3750 dbSNP
rs1200821212 3751 dbSNP
rs1038519576 3759 dbSNP
rs749363819 3761 dbSNP
rs905955295 3762 dbSNP
rs1382633161 3769 dbSNP
rs375454926 3771 dbSNP
rs1051147387 3772 dbSNP
rs1036290276 3774 dbSNP
rs960192904 3779 dbSNP
rs1010481123 3782 dbSNP
rs1434821547 3785 dbSNP
rs891208408 3787 dbSNP
rs1020503950 3789 dbSNP
rs191001680 3795 dbSNP
rs1467647385 3797 dbSNP
rs1020916054 3805 dbSNP
rs968904321 3807 dbSNP
rs781279539 3809 dbSNP
rs1427580341 3814 dbSNP
rs1174088981 3817 dbSNP
rs1223360482 3821 dbSNP
rs1452292844 3822 dbSNP
rs1254821093 3824 dbSNP
rs1179109636 3827 dbSNP
rs1459078868 3828 dbSNP
rs1353259806 3831 dbSNP
rs562942051 3834 dbSNP
rs1230671415 3838 dbSNP
rs1203255378 3840 dbSNP
rs746172819 3844 dbSNP
rs1280238457 3845 dbSNP
rs535349419 3849 dbSNP
rs775053707 3857 dbSNP
rs762404638 3859 dbSNP
rs1310467179 3860 dbSNP
rs1449636458 3861 dbSNP
rs959219370 3864 dbSNP
rs991991291 3865 dbSNP
rs374032330 3879 dbSNP
rs1375419659 3887 dbSNP
rs1487074450 3897 dbSNP
rs950462267 3904 dbSNP
rs1448914921 3905 dbSNP
rs983523545 3906 dbSNP
rs908852407 3915 dbSNP
rs1360993814 3920 dbSNP
rs974500209 3923 dbSNP
rs1434348092 3929 dbSNP
rs377567182 3935 dbSNP
rs1159096598 3937 dbSNP
rs1268891227 3939 dbSNP
rs1441430737 3940 dbSNP
rs1405760040 3942 dbSNP
rs933147844 3949 dbSNP
rs755850018 3963 dbSNP
rs183363081 3969 dbSNP
rs560995777 3972 dbSNP
rs1454095832 3973 dbSNP
rs780047463 3977 dbSNP
rs907811368 3994 dbSNP
rs1157743731 4002 dbSNP
rs941896114 4004 dbSNP
rs921497956 4007 dbSNP
rs932859894 4008 dbSNP
rs1306837844 4009 dbSNP
rs1051196064 4014 dbSNP
rs1382537791 4024 dbSNP
rs891209318 4026 dbSNP
rs1418036809 4038 dbSNP
rs1305193275 4053 dbSNP
rs1038135106 4059 dbSNP
rs1361490541 4062 dbSNP
rs529788990 4063 dbSNP
rs945458433 4068 dbSNP
rs1421230052 4073 dbSNP
rs1042795976 4076 dbSNP
rs1343221492 4085 dbSNP
rs1158238503 4109 dbSNP
rs773390477 4110 dbSNP
rs1404462288 4115 dbSNP
rs1185209763 4117 dbSNP
rs1000852905 4122 dbSNP
rs1033637484 4124 dbSNP
rs1218353363 4126 dbSNP
rs1260533330 4128 dbSNP
rs1485057377 4128 dbSNP
rs1240414174 4135 dbSNP
rs895873275 4147 dbSNP
rs546636079 4148 dbSNP
rs895058713 4150 dbSNP
rs1232815053 4155 dbSNP
rs1341227064 4158 dbSNP
rs1280266687 4161 dbSNP
rs11335906 4162 dbSNP
rs1288120876 4162 dbSNP
rs1460412737 4162 dbSNP
rs1491010585 4162 dbSNP
rs200540795 4162 dbSNP
rs201791606 4162 dbSNP
rs398020148 4162 dbSNP
rs771485668 4162 dbSNP
rs201188244 4163 dbSNP
rs1423723277 4164 dbSNP
rs1010365091 4167 dbSNP
rs1260443141 4169 dbSNP
rs868519758 4174 dbSNP
rs142295944 4176 dbSNP
rs950536915 4178 dbSNP
rs1489748321 4200 dbSNP
rs146380177 4201 dbSNP
rs1016412347 4205 dbSNP
rs1213624437 4206 dbSNP
rs1490038077 4206 dbSNP
rs1032447118 4219 dbSNP
rs963038659 4222 dbSNP
rs746274123 4224 dbSNP
rs974376836 4226 dbSNP
rs921551128 4232 dbSNP
rs1252091766 4234 dbSNP
rs1326113013 4235 dbSNP
rs552493428 4245 dbSNP
rs1387191664 4247 dbSNP
rs1372924583 4251 dbSNP
rs1323731404 4260 dbSNP
rs964407247 4270 dbSNP
rs1400327457 4271 dbSNP
rs974780008 4278 dbSNP
rs1460151490 4279 dbSNP
rs923018076 4290 dbSNP
rs139527200 4292 dbSNP
rs983295811 4293 dbSNP
rs1251558080 4294 dbSNP
rs538079377 4297 dbSNP
rs912703099 4300 dbSNP
rs1193508863 4307 dbSNP
rs1378180980 4308 dbSNP
rs1240069273 4312 dbSNP
rs945524165 4315 dbSNP
rs1042501577 4325 dbSNP
rs114459677 4331 dbSNP
rs1235700344 4332 dbSNP
rs936691457 4337 dbSNP
rs17113730 4341 dbSNP
rs895065412 4346 dbSNP
rs1424298065 4353 dbSNP
rs1013483697 4357 dbSNP
rs1025239282 4366 dbSNP
rs1330299599 4373 dbSNP
rs1291809991 4380 dbSNP
rs886300303 4382 dbSNP
rs1392407898 4384 dbSNP
rs1005104587 4398 dbSNP
rs1306991893 4399 dbSNP
rs776141655 4404 dbSNP
rs1057023339 4407 dbSNP
rs574725074 4409 dbSNP
rs533993931 4411 dbSNP
rs963089494 4412 dbSNP
rs1315275661 4424 dbSNP
rs974386683 4425 dbSNP
rs1028593439 4426 dbSNP
rs1358240876 4429 dbSNP
rs553759197 4437 dbSNP
rs369624428 4438 dbSNP
rs553798541 4438 dbSNP
rs1468699365 4440 dbSNP
rs1256986704 4442 dbSNP
rs954308014 4444 dbSNP
rs1484840178 4451 dbSNP
rs200201136 4451 dbSNP
rs138993985 4452 dbSNP
rs369580498 4454 dbSNP
rs372243871 4455 dbSNP
rs987099952 4469 dbSNP
rs144185842 4478 dbSNP
rs2605379 4483 dbSNP
rs978659463 4486 dbSNP
rs1334613160 4494 dbSNP
rs1312873892 4496 dbSNP
rs150647559 4501 dbSNP
rs576643667 4502 dbSNP
rs1018535749 4503 dbSNP
rs1384402198 4508 dbSNP
rs373270897 4510 dbSNP
rs1420629241 4511 dbSNP
rs1423401428 4516 dbSNP
rs936701401 4524 dbSNP
rs1387598878 4525 dbSNP
rs1157297543 4528 dbSNP
rs114983701 4529 dbSNP
rs562232304 4531 dbSNP
rs949349715 4532 dbSNP
rs1189751130 4533 dbSNP
rs1029972926 4535 dbSNP
rs576876761 4538 dbSNP
rs1462609221 4540 dbSNP
rs886353198 4547 dbSNP
rs1488473617 4550 dbSNP
rs1004753111 4554 dbSNP
rs1398795121 4560 dbSNP
rs188530087 4562 dbSNP
rs1014803307 4568 dbSNP
rs540286753 4573 dbSNP
rs1337750293 4580 dbSNP
rs1382515573 4583 dbSNP
rs192906568 4587 dbSNP
rs927238069 4598 dbSNP
rs376955930 4602 dbSNP
rs1328512781 4603 dbSNP
rs532175314 4608 dbSNP
rs1400599927 4609 dbSNP
rs1392161816 4610 dbSNP
rs1459883081 4625 dbSNP
rs1417289959 4627 dbSNP
rs1194600112 4630 dbSNP
rs1226109104 4633 dbSNP
rs1476541776 4638 dbSNP
rs1243603875 4642 dbSNP
rs1190842796 4643 dbSNP
rs995854908 4647 dbSNP
rs1290433911 4658 dbSNP
rs570369775 4662 dbSNP
rs954402294 4663 dbSNP
rs551871723 4685 dbSNP
rs184869543 4691 dbSNP
rs946159556 4692 dbSNP
rs188138553 4704 dbSNP
rs1430390576 4705 dbSNP
rs967332611 4705 dbSNP
rs978289400 4706 dbSNP
rs1332049841 4714 dbSNP
rs559260609 4726 dbSNP
rs1439374223 4728 dbSNP
rs1393804374 4729 dbSNP
rs904723967 4738 dbSNP
rs1411863464 4739 dbSNP
rs1482189518 4741 dbSNP
rs958121214 4748 dbSNP
rs567874064 4750 dbSNP
rs1180320534 4754 dbSNP
rs1195369529 4758 dbSNP
rs990930385 4768 dbSNP
rs534029155 4770 dbSNP
rs936185536 4774 dbSNP
rs1040253368 4783 dbSNP
rs1204680857 4786 dbSNP
rs1264182041 4791 dbSNP
rs916647180 4798 dbSNP
rs751504494 4804 dbSNP
rs34999147 4806 dbSNP
rs900094099 4806 dbSNP
rs998830121 4806 dbSNP
rs1346094808 4813 dbSNP
rs1030023781 4814 dbSNP
rs757132264 4820 dbSNP
rs1332111992 4830 dbSNP
rs1421609702 4830 dbSNP
rs1444395968 4831 dbSNP
rs890121235 4832 dbSNP
rs1415276256 4833 dbSNP
rs1046823122 4834 dbSNP
rs907792604 4839 dbSNP
rs1004667042 4841 dbSNP
rs1394460300 4845 dbSNP
rs940563423 4851 dbSNP
rs1014687400 4854 dbSNP
rs771689021 4857 dbSNP
rs1177794014 4861 dbSNP
rs1203351650 4866 dbSNP
rs772734089 4875 dbSNP
rs547529313 4879 dbSNP
rs1282908337 4881 dbSNP
rs1446358840 4881 dbSNP
rs1347627191 4898 dbSNP
rs899034218 4905 dbSNP
rs1290246106 4910 dbSNP
rs995948136 4912 dbSNP
rs781067030 4913 dbSNP
rs890197725 4914 dbSNP
rs1008574033 4916 dbSNP
rs12298732 4929 dbSNP
rs1325073323 4935 dbSNP
rs1337870692 4935 dbSNP
rs917288058 4938 dbSNP
rs1262491605 4939 dbSNP
rs191365081 4941 dbSNP
rs556258257 4947 dbSNP
rs1261128174 4955 dbSNP
rs77701788 4956 dbSNP
rs1176193779 4957 dbSNP
rs1475324366 4961 dbSNP
rs926078548 4962 dbSNP
rs1185354084 4965 dbSNP
rs1485526224 4969 dbSNP
rs1261697986 4970 dbSNP
rs936053935 4975 dbSNP
rs1261036978 4985 dbSNP
rs1315702652 4991 dbSNP
rs1283639865 4993 dbSNP
rs1234038344 4996 dbSNP
rs780184740 4997 dbSNP
rs1414421859 5006 dbSNP
rs1354564621 5007 dbSNP
rs921413133 5008 dbSNP
rs1455280346 5010 dbSNP
rs1481498562 5010 dbSNP
rs1200768088 5014 dbSNP
rs1158311525 5019 dbSNP
rs1343422790 5019 dbSNP
rs1461449107 5019 dbSNP
rs1419429446 5024 dbSNP
rs1162284051 5026 dbSNP
rs559317679 5033 dbSNP
rs1262829473 5034 dbSNP
rs1485168777 5036 dbSNP
rs73360983 5036 dbSNP
rs1241984213 5045 dbSNP
rs1214864216 5047 dbSNP
rs1336982514 5060 dbSNP
rs1161668791 5085 dbSNP
rs990981312 5089 dbSNP
rs1308374849 5095 dbSNP
rs1296011781 5096 dbSNP
rs1023759574 5103 dbSNP
rs749505217 5104 dbSNP
rs1418644775 5105 dbSNP
rs1441573983 5112 dbSNP
rs1396002713 5113 dbSNP
rs1162220549 5117 dbSNP
rs1460590069 5130 dbSNP
rs1373347854 5133 dbSNP
rs572724665 5144 dbSNP
rs556002243 5151 dbSNP
rs1036417731 5153 dbSNP
rs572725970 5154 dbSNP
rs982135904 5155 dbSNP
rs542174880 5165 dbSNP
rs75857217 5169 dbSNP
rs1251216140 5170 dbSNP
rs1034211633 5171 dbSNP
rs1481008115 5185 dbSNP
rs1365361208 5187 dbSNP
rs1014159732 5194 dbSNP
rs958783630 5194 dbSNP
rs1296658014 5203 dbSNP
rs1373184823 5204 dbSNP
rs59815789 5204 dbSNP
rs545804287 5205 dbSNP
rs1284628940 5208 dbSNP
rs967243083 5212 dbSNP
rs1385672997 5214 dbSNP
rs772409590 5215 dbSNP
rs977405063 5220 dbSNP
rs1316129569 5223 dbSNP
rs1354283408 5230 dbSNP
rs1216160433 5233 dbSNP
rs1174735950 5239 dbSNP
rs1455959341 5239 dbSNP
rs1050184144 5241 dbSNP
rs1393748095 5242 dbSNP
rs150217292 5251 dbSNP
rs376530700 5251 dbSNP
rs1419710326 5252 dbSNP
rs957500051 5254 dbSNP
rs1223375411 5257 dbSNP
rs1194274433 5261 dbSNP
rs2605378 5266 dbSNP
rs921475673 5267 dbSNP
rs17180010 5277 dbSNP
rs1179466595 5286 dbSNP
rs139806885 5289 dbSNP
rs902874973 5292 dbSNP
rs999843891 5296 dbSNP
rs1367093713 5298 dbSNP
rs1389321117 5298 dbSNP
rs1369628768 5299 dbSNP
rs1032632500 5304 dbSNP
rs908815194 5305 dbSNP
rs561642252 5309 dbSNP
rs75447283 5318 dbSNP
rs1436899498 5322 dbSNP
rs527521037 5325 dbSNP
rs1374061454 5329 dbSNP
rs547171708 5330 dbSNP
rs115122140 5336 dbSNP
rs1365574864 5337 dbSNP
rs1418706449 5338 dbSNP
rs898808982 5346 dbSNP
rs1190333328 5350 dbSNP
rs1347629771 5355 dbSNP
rs1444218634 5356 dbSNP
rs1277948671 5358 dbSNP
rs1199778494 5361 dbSNP
rs1351400750 5363 dbSNP
rs1280134892 5367 dbSNP
rs539517135 5369 dbSNP
rs982635066 5376 dbSNP
rs145585426 5377 dbSNP
rs1353931664 5385 dbSNP
rs1333966543 5387 dbSNP
rs1024063291 5389 dbSNP
rs1387847116 5394 dbSNP
rs1157353485 5395 dbSNP
rs535849087 5401 dbSNP
rs1456707472 5402 dbSNP
rs1418697932 5409 dbSNP
rs962393826 5426 dbSNP
rs973369231 5428 dbSNP
rs998709424 5433 dbSNP
rs17113736 5435 dbSNP
rs1361794120 5441 dbSNP
rs957591473 5442 dbSNP
rs931862909 5446 dbSNP
rs1229114045 5450 dbSNP
rs975403228 5456 dbSNP
rs1289154312 5461 dbSNP
rs1450007709 5462 dbSNP
rs1207224050 5464 dbSNP
rs985947180 5468 dbSNP
rs572760683 5469 dbSNP
rs1332308458 5472 dbSNP
rs1283958606 5477 dbSNP
rs535262629 5481 dbSNP
rs955420476 5487 dbSNP
rs558042408 5488 dbSNP
rs1435037499 5491 dbSNP
rs1177114326 5497 dbSNP
rs576886156 5502 dbSNP
rs1328087586 5507 dbSNP
rs935684557 5509 dbSNP
rs545539178 5521 dbSNP
rs1460064053 5529 dbSNP
rs1054089150 5539 dbSNP
rs761799209 5541 dbSNP
rs940281134 5547 dbSNP
rs12825867 5550 dbSNP
rs1168723478 5551 dbSNP
rs974729092 5552 dbSNP
rs1162292000 5553 dbSNP
rs1012480592 5561 dbSNP
rs1023821908 5563 dbSNP
rs1464421333 5570 dbSNP
rs139659446 5572 dbSNP
rs1003712804 5573 dbSNP
rs1015456847 5580 dbSNP
rs962120003 5585 dbSNP
rs994802417 5586 dbSNP
rs775073545 5587 dbSNP
rs1268834619 5605 dbSNP
rs1399514729 5607 dbSNP
rs532654532 5612 dbSNP
rs953311392 5622 dbSNP
rs1444515399 5623 dbSNP
rs1438725033 5624 dbSNP
rs986042035 5634 dbSNP
rs903021023 5636 dbSNP
rs1338389406 5647 dbSNP
rs1383261767 5648 dbSNP
rs1398328840 5658 dbSNP
rs575677131 5659 dbSNP
rs1166552855 5661 dbSNP
rs1448777908 5664 dbSNP
rs1395548092 5665 dbSNP
rs1195428505 5667 dbSNP
rs541412639 5671 dbSNP
rs1476730491 5674 dbSNP
rs1245644394 5675 dbSNP
rs2252250 5682 dbSNP
rs1439232733 5688 dbSNP
rs1272919820 5689 dbSNP
rs966308048 5698 dbSNP
rs1204817027 5702 dbSNP
rs145296973 5703 dbSNP
rs183884168 5705 dbSNP
rs1306224089 5706 dbSNP
rs1354306467 5708 dbSNP
rs924363563 5708 dbSNP
rs893011936 5714 dbSNP
rs997270517 5719 dbSNP
rs1258828401 5720 dbSNP
rs1028301710 5734 dbSNP
rs751024851 5748 dbSNP
rs1307670914 5752 dbSNP
rs1428790711 5752 dbSNP
rs1375870506 5760 dbSNP
rs1054139261 5764 dbSNP
rs1423815422 5766 dbSNP
rs564087303 5769 dbSNP
rs533472435 5770 dbSNP
rs2641468 5773 dbSNP
rs1045767990 5774 dbSNP
rs1181055428 5775 dbSNP
rs756396001 5780 dbSNP
rs906776845 5781 dbSNP