miRTarBase - #MIRT251487 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DYNLL2   
Synonyms DNCL1B, Dlc2, RSPH22
Description dynein light chain LC8-type 2
Transcript NM_080677   
Expression
Putative miRNA Targets on DYNLL2
3'UTR of DYNLL2
(miRNA target sites are highlighted)
>DYNLL2|NM_080677|3'UTR
   1 GTGGCCATGGTGAAGGTGTCAGTGGCGGCGGCAGCGATGGCAAGCAGGCGGCGTTGCTGGGACTGTTTTGCACTGGAGCC
  81 AGCATCAGGATGTCCTCTCCAATGGCTGTGCTACTGCATGGACTGTATACTCGATTTCATGTGTATGTCGCAGTAAACAA
 161 AACCAAACCTCTTTCTGTTTAGTTGCCTGGGGGAAGAAGGCTGCTTTATGTTTATTTTTCAAGACTTTAAAAATATTTTT
 241 TGGTTGTATTGCACTAGGAAATCTCTCCCACCTCTCCCTTTTCTCTTTCTTTCCCTATACAAAATAAAAGGCCCACCATA
 321 GAGACTAGGCGGCCGAAAGACTAGGAGGGCTGAGGAAAAGAAATAGGTCTCTGGAGGTGGAACTAAAACTGTGCAGCTGC
 401 CTCTTCCTGGCGGTGGATGCTGCTTTGGGAGGGCCAGGGAGGCTGCAGGGGGACAGTGTTGGGATTGTCAAGGAAAAAGG
 481 GGTAGGAAGGAAGGTGGAGGGATTGATCTAGTACCAGGGAGAATATTCCACTGAACTGTGATTCTATGGCTTGGGGCGGA
 561 GGGTGGGGTGGGGATGCCTTCTTTAGGGGCCCTGAGATGTGTTTGTCTGTGGTGTGTGGGAGTGGGGAGCAGATTTGTCT
 641 TGCTGTCTTTGTCAGAATTTCTAAGTAAGGGCTGTGTCTTTGTGGATTACCTTCTTTTGTTCTTCCTGCCAGAGATCATG
 721 ACAGGAGGATGCTGGGGTAGGATTAGCTTGAATCTTTTTTTTCTTTACATTTTTCTCCTGTCTGCTCCCTGCTTAGCCCT
 801 CAGTTTCCTCATTCCTCTGGAGTTCTCTTAGAGCAGCCCCTGTTGTTAGTTGGCTGGCAAGGGAATTTCTGGTGACTGTA
 881 GTTCCTTAGTTAGGTCTTAGCAATCAAACCAAATTGATGTCTCCCTTGACTCTTCTGTGTATATGTGTGAATATGTGTGT
 961 ATATGTGTGTGTATGTGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugGUAAUACACGACGAu 5'
                 |: |:  ||||||| 
Target 5' ttcctggCGGTGGATGCTGCTt 3'
404 - 425 143.00 -11.60
2
miRNA  3' gugUUUGGUAAU-ACACGACGAu 5'
             :|||:|  | ||||| ||| 
Target 5' gtgGAACTAAAACTGTGCAGCTg 3'
377 - 399 131.00 -11.60
3
miRNA  3' guguuuGGUAAU--ACACGACGAu 5'
                ||| |:  |||||| || 
Target 5' tcctctCCAATGGCTGTGCTACTg 3'
93 - 116 126.00 -11.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM4188643 1 COSMIC
COSN30180696 7 COSMIC
COSN30515014 26 COSMIC
COSN30144045 31 COSMIC
COSN1199096 39 COSMIC
COSN30496560 45 COSMIC
COSN30110709 51 COSMIC
COSN30516645 52 COSMIC
COSN17132177 69 COSMIC
COSN30485288 96 COSMIC
COSN30516855 120 COSMIC
COSN30181971 124 COSMIC
COSN31587017 127 COSMIC
COSN31605102 224 COSMIC
COSN7440862 474 COSMIC
COSN9671514 529 COSMIC
COSN1724134 874 COSMIC
COSN25863346 1466 COSMIC
COSN15147648 1772 COSMIC
COSN22804944 1862 COSMIC
COSN27977242 2287 COSMIC
COSN1724135 2363 COSMIC
COSN29243869 2383 COSMIC
COSN21416417 2556 COSMIC
COSN21552688 3113 COSMIC
COSN29333530 3252 COSMIC
COSN6107934 3369 COSMIC
COSN1724136 3709 COSMIC
COSN19480571 3711 COSMIC
COSN8244477 4067 COSMIC
COSN29950278 4074 COSMIC
COSN26202705 4149 COSMIC
COSN20670194 5586 COSMIC
COSN9671515 5616 COSMIC
COSN25855820 5906 COSMIC
COSN5418533 5973 COSMIC
COSN25742933 6002 COSMIC
COSN1724137 6044 COSMIC
COSN1724138 6107 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs924205898 2 dbSNP
rs1433824150 6 dbSNP
rs377760636 7 dbSNP
rs200481800 8 dbSNP
rs1461409303 15 dbSNP
rs746158448 16 dbSNP
rs374144805 21 dbSNP
rs763089795 24 dbSNP
rs368513542 25 dbSNP
rs760693436 27 dbSNP
rs909411221 28 dbSNP
rs769093945 30 dbSNP
rs777131527 36 dbSNP
rs762164785 37 dbSNP
rs371611185 39 dbSNP
rs751151868 41 dbSNP
rs369484056 43 dbSNP
rs1431247611 45 dbSNP
rs767103775 46 dbSNP
rs752199536 48 dbSNP
rs535023430 50 dbSNP
rs1216533385 51 dbSNP
rs777786474 53 dbSNP
rs1356853106 61 dbSNP
rs1050682461 66 dbSNP
rs1313058607 69 dbSNP
rs1254268026 72 dbSNP
rs372037785 80 dbSNP
rs1299739645 83 dbSNP
rs1462316493 89 dbSNP
rs892392359 91 dbSNP
rs1168481313 92 dbSNP
rs1006029116 96 dbSNP
rs1476199961 101 dbSNP
rs1489908552 119 dbSNP
rs1187455105 121 dbSNP
rs760617745 123 dbSNP
rs1196484398 129 dbSNP
rs1245852452 130 dbSNP
rs1014766893 132 dbSNP
rs546944674 133 dbSNP
rs372402569 134 dbSNP
rs997554375 137 dbSNP
rs1216127067 139 dbSNP
rs571670186 147 dbSNP
rs764117085 151 dbSNP
rs1293420650 164 dbSNP
rs1232299374 166 dbSNP
rs753864633 167 dbSNP
rs1308698380 169 dbSNP
rs1428597424 169 dbSNP
rs145820835 170 dbSNP
rs953198842 172 dbSNP
rs1395529705 181 dbSNP
rs985883923 187 dbSNP
rs187859298 190 dbSNP
rs1021406474 193 dbSNP
rs1164371713 196 dbSNP
rs1372028329 200 dbSNP
rs1384659774 201 dbSNP
rs1365689987 209 dbSNP
rs190895072 211 dbSNP
rs1002012086 215 dbSNP
rs1236789662 221 dbSNP
rs1196020380 223 dbSNP
rs1034197980 228 dbSNP
rs1439018932 229 dbSNP
rs1212448317 236 dbSNP
rs1306058811 237 dbSNP
rs1296111933 238 dbSNP
rs1342016634 247 dbSNP
rs1239375157 266 dbSNP
rs1334916024 268 dbSNP
rs1229267177 270 dbSNP
rs960741233 272 dbSNP
rs979607644 277 dbSNP
rs1013599694 279 dbSNP
rs536425372 279 dbSNP
rs761198615 284 dbSNP
rs1403637977 285 dbSNP
rs1387262503 294 dbSNP
rs1026351834 295 dbSNP
rs935599133 306 dbSNP
rs1453374058 308 dbSNP
rs950695041 313 dbSNP
rs1363519442 315 dbSNP
rs1209530142 318 dbSNP
rs992858856 319 dbSNP
rs985469725 321 dbSNP
rs1252871618 322 dbSNP
rs554502436 331 dbSNP
rs1197394801 332 dbSNP
rs749994305 335 dbSNP
rs573061023 336 dbSNP
rs974918030 357 dbSNP
rs921016652 359 dbSNP
rs376105178 365 dbSNP
rs948074951 367 dbSNP
rs138574553 370 dbSNP
rs1302527436 374 dbSNP
rs887876702 377 dbSNP
rs1434277119 390 dbSNP
rs1328248329 394 dbSNP
rs941836303 399 dbSNP
rs756792245 400 dbSNP
rs74470907 412 dbSNP
rs1044045879 413 dbSNP
rs903742889 418 dbSNP
rs576441333 420 dbSNP
rs1476712446 429 dbSNP
rs997435911 435 dbSNP
rs1455934328 438 dbSNP
rs1030691422 439 dbSNP
rs1193199615 450 dbSNP
rs543849978 452 dbSNP
rs1013715851 455 dbSNP
rs1212607325 456 dbSNP
rs1485863845 458 dbSNP
rs562221344 461 dbSNP
rs1228265100 471 dbSNP
rs1007248721 472 dbSNP
rs950724305 475 dbSNP
rs1226727524 476 dbSNP
rs1338545841 479 dbSNP
rs1436383127 479 dbSNP
rs1021353970 486 dbSNP
rs968463743 487 dbSNP
rs1375217306 491 dbSNP
rs150717233 494 dbSNP
rs1244116507 501 dbSNP
rs755391385 503 dbSNP
rs1477182504 504 dbSNP
rs1358674761 506 dbSNP
rs1189587368 509 dbSNP
rs1475371900 523 dbSNP
rs781525575 524 dbSNP
rs923478106 527 dbSNP
rs1215341950 531 dbSNP
rs954874077 532 dbSNP
rs543169163 540 dbSNP
rs992406044 544 dbSNP
rs918183088 547 dbSNP
rs1197987041 549 dbSNP
rs1464264024 553 dbSNP
rs1209353924 558 dbSNP
rs948051742 559 dbSNP
rs980747351 560 dbSNP
rs991313983 565 dbSNP
rs913623367 566 dbSNP
rs1444767433 567 dbSNP
rs909264149 569 dbSNP
rs916581746 570 dbSNP
rs1464558698 572 dbSNP
rs1186168733 579 dbSNP
rs1043358397 580 dbSNP
rs925198950 581 dbSNP
rs937975796 584 dbSNP
rs1036440148 585 dbSNP
rs1179776066 590 dbSNP
rs1471025585 596 dbSNP
rs896344522 612 dbSNP
rs1177925417 615 dbSNP
rs1456432753 618 dbSNP
rs1274989666 622 dbSNP
rs1214326071 625 dbSNP
rs1013413158 631 dbSNP
rs919085973 632 dbSNP
rs561343921 640 dbSNP
rs1287933756 648 dbSNP
rs933171326 651 dbSNP
rs1374474464 660 dbSNP
rs1204688826 665 dbSNP
rs1242687797 669 dbSNP
rs1445202953 671 dbSNP
rs1051662613 673 dbSNP
rs115524146 682 dbSNP
rs547325434 687 dbSNP
rs1007196480 688 dbSNP
rs1327172807 705 dbSNP
rs748725943 718 dbSNP
rs886502867 719 dbSNP
rs114946955 720 dbSNP
rs1016233957 724 dbSNP
rs1388435197 728 dbSNP
rs575554182 729 dbSNP
rs996425158 735 dbSNP
rs1031865897 738 dbSNP
rs113399075 742 dbSNP
rs956871948 746 dbSNP
rs954886962 755 dbSNP
rs988913361 755 dbSNP
rs1218207779 762 dbSNP
rs1317811469 763 dbSNP
rs1323187496 764 dbSNP
rs1400661974 768 dbSNP
rs1014185180 769 dbSNP
rs1025192083 770 dbSNP
rs970048432 775 dbSNP
rs981030086 778 dbSNP
rs966450876 779 dbSNP
rs551023571 797 dbSNP
rs1366281820 803 dbSNP
rs1226856350 809 dbSNP
rs909212238 821 dbSNP
rs1291339849 828 dbSNP
rs963378573 831 dbSNP
rs972102015 833 dbSNP
rs777926042 840 dbSNP
rs1297231090 842 dbSNP
rs1417577463 853 dbSNP
rs1396713485 854 dbSNP
rs933138772 861 dbSNP
rs1052039342 867 dbSNP
rs1423138857 873 dbSNP
rs1188302101 877 dbSNP
rs116575289 879 dbSNP
rs943263953 881 dbSNP
rs536363388 882 dbSNP
rs183998145 885 dbSNP
rs1482214219 886 dbSNP
rs1043028600 899 dbSNP
rs137955354 900 dbSNP
rs904175694 901 dbSNP
rs1281572776 906 dbSNP
rs1488916281 911 dbSNP
rs1047557635 920 dbSNP
rs998541469 930 dbSNP
rs1211897529 936 dbSNP
rs188651450 936 dbSNP
rs1340619377 941 dbSNP
rs771276912 942 dbSNP
rs1397797148 944 dbSNP
rs1199389651 951 dbSNP
rs1377044031 951 dbSNP
rs886533261 951 dbSNP
rs1465373770 954 dbSNP
rs1256168594 960 dbSNP
rs1357295157 960 dbSNP
rs1443624148 961 dbSNP
rs1172487976 962 dbSNP
rs545353427 962 dbSNP
rs1423055067 964 dbSNP
rs557738635 966 dbSNP
rs1191770438 974 dbSNP
rs1258500040 974 dbSNP
rs1476340635 974 dbSNP
rs1200168456 976 dbSNP
rs1410728440 978 dbSNP
rs1253545648 981 dbSNP
rs774773837 982 dbSNP
rs1473151280 983 dbSNP
rs558421309 984 dbSNP
rs900525973 987 dbSNP
rs1312997990 994 dbSNP
rs115992007 996 dbSNP
rs1465930366 997 dbSNP
rs1299794254 998 dbSNP
rs1303923707 998 dbSNP
rs1399618901 1006 dbSNP
rs1168549537 1007 dbSNP
rs969565018 1010 dbSNP
rs760525981 1012 dbSNP
rs1002400133 1016 dbSNP
rs1463080121 1018 dbSNP
rs1369228188 1019 dbSNP
rs1404523417 1019 dbSNP
rs1187132253 1027 dbSNP
rs1408046452 1030 dbSNP
rs1307716559 1032 dbSNP
rs192602277 1035 dbSNP
rs1256733937 1036 dbSNP
rs1030558022 1043 dbSNP
rs1336351739 1045 dbSNP
rs1265618966 1050 dbSNP
rs147208480 1055 dbSNP
rs1308796500 1058 dbSNP
rs1308949604 1062 dbSNP
rs140627712 1082 dbSNP
rs1375969523 1083 dbSNP
rs1020485666 1084 dbSNP
rs768536614 1087 dbSNP
rs776393820 1090 dbSNP
rs1202381825 1092 dbSNP
rs1159569780 1101 dbSNP
rs1365899668 1101 dbSNP
rs954960487 1103 dbSNP
rs1483155231 1104 dbSNP
rs987611310 1107 dbSNP
rs1265783560 1119 dbSNP
rs1267494038 1123 dbSNP
rs1208853673 1143 dbSNP
rs1353745956 1144 dbSNP
rs755757044 1157 dbSNP
rs990462556 1163 dbSNP
rs1177477587 1173 dbSNP
rs917843515 1182 dbSNP
rs910367870 1186 dbSNP
rs377306142 1188 dbSNP
rs1236455668 1195 dbSNP
rs1331750152 1199 dbSNP
rs943211831 1201 dbSNP
rs184185760 1205 dbSNP
rs925873770 1208 dbSNP
rs1299068127 1209 dbSNP
rs1419432077 1210 dbSNP
rs934281085 1212 dbSNP
rs561490976 1217 dbSNP
rs895524265 1219 dbSNP
rs1478674236 1220 dbSNP
rs1291985865 1228 dbSNP
rs949833688 1231 dbSNP
rs1365304224 1233 dbSNP
rs73995447 1239 dbSNP
rs905353564 1250 dbSNP
rs1051679695 1263 dbSNP
rs1487821722 1265 dbSNP
rs1283701608 1269 dbSNP
rs528136366 1274 dbSNP
rs890446826 1277 dbSNP
rs1002344366 1278 dbSNP
rs1010484244 1279 dbSNP
rs1231112290 1283 dbSNP
rs540877569 1288 dbSNP
rs904718097 1292 dbSNP
rs1273198413 1299 dbSNP
rs1000743691 1309 dbSNP
rs1399675772 1323 dbSNP
rs1342241658 1328 dbSNP
rs1359027041 1347 dbSNP
rs1315104002 1349 dbSNP
rs1391955260 1350 dbSNP
rs1016439774 1354 dbSNP
rs1402067962 1355 dbSNP
rs147413678 1357 dbSNP
rs532891181 1360 dbSNP
rs1026730345 1361 dbSNP
rs1476742236 1363 dbSNP
rs1425198493 1368 dbSNP
rs959071574 1372 dbSNP
rs1477324145 1379 dbSNP
rs954766788 1381 dbSNP
rs1189282198 1385 dbSNP
rs1011928080 1386 dbSNP
rs987946644 1387 dbSNP
rs1277773799 1391 dbSNP
rs1024683513 1401 dbSNP
rs1258875983 1402 dbSNP
rs1255482066 1406 dbSNP
rs1218102095 1414 dbSNP
rs1338616045 1436 dbSNP
rs772713172 1443 dbSNP
rs1448134379 1446 dbSNP
rs1368592924 1448 dbSNP
rs1449143407 1450 dbSNP
rs970381280 1452 dbSNP
rs762516086 1459 dbSNP
rs1411723876 1460 dbSNP
rs1401826492 1461 dbSNP
rs1162992298 1464 dbSNP
rs1349493373 1465 dbSNP
rs1457236969 1466 dbSNP
rs1420973943 1469 dbSNP
rs1293854379 1470 dbSNP
rs1396600702 1471 dbSNP
rs1472993024 1472 dbSNP
rs983412455 1475 dbSNP
rs1185329654 1477 dbSNP
rs1432884816 1478 dbSNP
rs907772593 1479 dbSNP
rs376184254 1480 dbSNP
rs1296779202 1483 dbSNP
rs561857716 1493 dbSNP
rs1316164511 1496 dbSNP
rs1017725774 1498 dbSNP
rs1356084777 1499 dbSNP
rs1282852809 1524 dbSNP
rs550960113 1525 dbSNP
rs932101652 1527 dbSNP
rs1051795709 1532 dbSNP
rs978599647 1533 dbSNP
rs1397565192 1534 dbSNP
rs569183303 1535 dbSNP
rs187417991 1538 dbSNP
rs548404700 1539 dbSNP
rs566996905 1540 dbSNP
rs916889965 1543 dbSNP
rs1441342640 1546 dbSNP
rs529080942 1553 dbSNP
rs116347089 1554 dbSNP
rs1456473056 1555 dbSNP
rs551986021 1556 dbSNP
rs1242720828 1557 dbSNP
rs558432216 1557 dbSNP
rs938145076 1557 dbSNP
rs115713302 1558 dbSNP
rs899378317 1559 dbSNP
rs994147330 1560 dbSNP
rs1348894367 1563 dbSNP
rs1436593938 1563 dbSNP
rs556077384 1564 dbSNP
rs1321197123 1565 dbSNP
rs1421261637 1566 dbSNP
rs1180140961 1568 dbSNP
rs1380722532 1569 dbSNP
rs1157966870 1573 dbSNP
rs1413384667 1587 dbSNP
rs970412310 1610 dbSNP
rs1026595641 1611 dbSNP
rs1191774103 1623 dbSNP
rs890434225 1627 dbSNP
rs1477758260 1632 dbSNP
rs1014844351 1640 dbSNP
rs767951974 1643 dbSNP
rs1219135579 1645 dbSNP
rs1008917588 1647 dbSNP
rs1285843258 1651 dbSNP
rs1017668467 1658 dbSNP
rs529197154 1659 dbSNP
rs574359111 1674 dbSNP
rs978881173 1675 dbSNP
rs1032840183 1680 dbSNP
rs1366346087 1695 dbSNP
rs1280935105 1710 dbSNP
rs1165394728 1721 dbSNP
rs1360911773 1724 dbSNP
rs955929468 1725 dbSNP
rs10132 1732 dbSNP
rs917194069 1735 dbSNP
rs953196421 1736 dbSNP
rs971439990 1740 dbSNP
rs1423205185 1751 dbSNP
rs1319864662 1766 dbSNP
rs553582023 1779 dbSNP
rs878897668 1782 dbSNP
rs1478306367 1783 dbSNP
rs572135458 1791 dbSNP
rs1389226151 1793 dbSNP
rs911948026 1798 dbSNP
rs1484453472 1803 dbSNP
rs1300503098 1806 dbSNP
rs1378012307 1808 dbSNP
rs946088235 1815 dbSNP
rs1260768440 1816 dbSNP
rs756653951 1823 dbSNP
rs1294737451 1824 dbSNP
rs1340676834 1827 dbSNP
rs941110197 1831 dbSNP
rs1380263678 1836 dbSNP
rs540814500 1841 dbSNP
rs1303329861 1843 dbSNP
rs920749014 1849 dbSNP
rs926234106 1849 dbSNP
rs929514605 1852 dbSNP
rs1048421329 1855 dbSNP
rs1423117475 1860 dbSNP
rs1327569265 1862 dbSNP
rs1228139506 1867 dbSNP
rs569141703 1870 dbSNP
rs565495562 1880 dbSNP
rs1257378516 1884 dbSNP
rs562553123 1887 dbSNP
rs1181776614 1895 dbSNP
rs936285676 1898 dbSNP
rs1056050387 1910 dbSNP
rs142895436 1912 dbSNP
rs1009274843 1913 dbSNP
rs1257004881 1915 dbSNP
rs1483617693 1920 dbSNP
rs114632326 1924 dbSNP
rs900538699 1932 dbSNP
rs1323283060 1933 dbSNP
rs539751637 1937 dbSNP
rs749368438 1949 dbSNP
rs1380412173 1950 dbSNP
rs1004558868 1959 dbSNP
rs562863002 1959 dbSNP
rs1015036124 1960 dbSNP
rs1402319560 1962 dbSNP
rs1459702851 1974 dbSNP
rs1369276431 1976 dbSNP
rs1010086838 1980 dbSNP
rs1443190087 1981 dbSNP
rs1358135618 1993 dbSNP
rs530034978 2003 dbSNP
rs1179861437 2004 dbSNP
rs1414828247 2007 dbSNP
rs1024607473 2013 dbSNP
rs1028852017 2015 dbSNP
rs1348185002 2030 dbSNP
rs953225698 2035 dbSNP
rs1265673057 2037 dbSNP
rs1321716693 2062 dbSNP
rs909825297 2063 dbSNP
rs971339711 2066 dbSNP
rs987242886 2068 dbSNP
rs1289302305 2069 dbSNP
rs1353485113 2071 dbSNP
rs12950704 2074 dbSNP
rs967833003 2078 dbSNP
rs1376250643 2085 dbSNP
rs59108636 2086 dbSNP
rs72066925 2086 dbSNP
rs1312898235 2094 dbSNP
rs1388608319 2098 dbSNP
rs560366588 2100 dbSNP
rs925987961 2102 dbSNP
rs1293192569 2103 dbSNP
rs1213053585 2108 dbSNP
rs936000653 2111 dbSNP
rs1249930931 2113 dbSNP
rs926952003 2114 dbSNP
rs991770354 2114 dbSNP
rs1159766992 2116 dbSNP
rs527793523 2118 dbSNP
rs962381249 2120 dbSNP
rs151063233 2121 dbSNP
rs114077673 2131 dbSNP
rs929435123 2142 dbSNP
rs191658941 2148 dbSNP
rs1434416858 2156 dbSNP
rs746125161 2157 dbSNP
rs1267557792 2164 dbSNP
rs1221348405 2167 dbSNP
rs1489795702 2178 dbSNP
rs1047893677 2179 dbSNP
rs1217073006 2180 dbSNP
rs1352823802 2181 dbSNP
rs1471039366 2188 dbSNP
rs768287572 2191 dbSNP
rs535056486 2194 dbSNP
rs940473329 2208 dbSNP
rs1300820383 2210 dbSNP
rs1403397676 2217 dbSNP
rs1342766273 2220 dbSNP
rs1299112112 2223 dbSNP
rs140912915 2224 dbSNP
rs143604898 2225 dbSNP
rs776499717 2227 dbSNP
rs374838480 2230 dbSNP
rs900487837 2233 dbSNP
rs994484766 2238 dbSNP
rs146869240 2239 dbSNP
rs553765887 2253 dbSNP
rs551504322 2254 dbSNP
rs769764017 2257 dbSNP
rs1282029837 2261 dbSNP
rs1345791180 2263 dbSNP
rs1010443942 2265 dbSNP
rs1342542732 2266 dbSNP
rs553174932 2267 dbSNP
rs971670571 2285 dbSNP
rs1001392536 2291 dbSNP
rs1034252321 2294 dbSNP
rs1467796574 2295 dbSNP
rs916170863 2298 dbSNP
rs1236596627 2299 dbSNP
rs950311260 2300 dbSNP
rs1189528814 2301 dbSNP
rs1242470177 2305 dbSNP
rs1341536068 2305 dbSNP
rs962329333 2309 dbSNP
rs762424564 2317 dbSNP
rs559150637 2319 dbSNP
rs1320130780 2324 dbSNP
rs577524685 2326 dbSNP
rs973722714 2327 dbSNP
rs1337854488 2339 dbSNP
rs1286255451 2340 dbSNP
rs1246005975 2347 dbSNP
rs1439389970 2370 dbSNP
rs1025776539 2374 dbSNP
rs1335357743 2388 dbSNP
rs1246082237 2391 dbSNP
rs940189891 2392 dbSNP
rs143434794 2393 dbSNP
rs758710951 2393 dbSNP
rs920333932 2401 dbSNP
rs1194968900 2402 dbSNP
rs1416952407 2403 dbSNP
rs1164718663 2410 dbSNP
rs1473015087 2411 dbSNP
rs930315811 2412 dbSNP
rs1181716707 2420 dbSNP
rs1459126061 2426 dbSNP
rs1238944777 2441 dbSNP
rs1203923386 2444 dbSNP
rs1387844941 2446 dbSNP
rs765911252 2447 dbSNP
rs1448344461 2451 dbSNP
rs951161345 2460 dbSNP
rs368186140 2463 dbSNP
rs140733610 2464 dbSNP
rs912052121 2467 dbSNP
rs563038712 2468 dbSNP
rs575109871 2469 dbSNP
rs1440855977 2470 dbSNP
rs749774573 2488 dbSNP
rs974969454 2492 dbSNP
rs1403986384 2493 dbSNP
rs1405705433 2495 dbSNP
rs1323231864 2500 dbSNP
rs1395877496 2502 dbSNP
rs922194406 2505 dbSNP
rs1296045397 2506 dbSNP
rs773949346 2516 dbSNP
rs1161578577 2519 dbSNP
rs145782652 2520 dbSNP
rs560554077 2521 dbSNP
rs1228213456 2522 dbSNP
rs1380862647 2525 dbSNP
rs1176646237 2526 dbSNP
rs1272164089 2528 dbSNP
rs1054461089 2537 dbSNP
rs1248642900 2542 dbSNP
rs527730548 2544 dbSNP
rs891828076 2545 dbSNP
rs1490285087 2551 dbSNP
rs1033531979 2557 dbSNP
rs946142299 2560 dbSNP
rs767710780 2562 dbSNP
rs1219252847 2565 dbSNP
rs1354976225 2576 dbSNP
rs1354458439 2579 dbSNP
rs957441190 2589 dbSNP
rs1207844737 2590 dbSNP
rs1012995750 2591 dbSNP
rs771544168 2601 dbSNP
rs1023009433 2603 dbSNP
rs971368331 2610 dbSNP
rs1421314412 2619 dbSNP
rs1361047692 2622 dbSNP
rs1158348028 2623 dbSNP
rs1261834171 2626 dbSNP
rs981718313 2637 dbSNP
rs1191991369 2649 dbSNP
rs1480193657 2656 dbSNP
rs1267054511 2659 dbSNP
rs1196235321 2664 dbSNP
rs1488839021 2666 dbSNP
rs1242010366 2675 dbSNP
rs1214336799 2677 dbSNP
rs879671427 2678 dbSNP
rs1280205787 2679 dbSNP
rs1223610314 2684 dbSNP
rs753105334 2689 dbSNP
rs1001340612 2692 dbSNP
rs1246092302 2695 dbSNP
rs552261824 2702 dbSNP
rs1362460069 2717 dbSNP
rs898425902 2722 dbSNP
rs1193227533 2725 dbSNP
rs564280982 2726 dbSNP
rs995422371 2730 dbSNP
rs1177170606 2744 dbSNP
rs1469373110 2749 dbSNP
rs1427408790 2756 dbSNP
rs1025301636 2774 dbSNP
rs1471574100 2778 dbSNP
rs1173139281 2780 dbSNP
rs1261537933 2781 dbSNP
rs1185279492 2793 dbSNP
rs35103032 2794 dbSNP
rs535624130 2797 dbSNP
rs1162272630 2804 dbSNP
rs573249372 2811 dbSNP
rs986549853 2818 dbSNP
rs1019803023 2822 dbSNP
rs974228633 2826 dbSNP
rs1220153581 2846 dbSNP
rs920347800 2851 dbSNP
rs966173513 2853 dbSNP
rs1212601259 2861 dbSNP
rs1381192734 2864 dbSNP
rs1337342964 2868 dbSNP
rs1451965242 2870 dbSNP
rs1388481216 2881 dbSNP
rs1050131858 2883 dbSNP
rs1462744196 2887 dbSNP
rs1372721309 2893 dbSNP
rs1168721414 2894 dbSNP
rs1425963164 2896 dbSNP
rs1415123330 2902 dbSNP
rs974918417 2906 dbSNP
rs1443467760 2911 dbSNP
rs375620719 2915 dbSNP
rs531398151 2916 dbSNP
rs1320292597 2918 dbSNP
rs1480721230 2919 dbSNP
rs922137199 2920 dbSNP
rs936233701 2925 dbSNP
rs1244409753 2934 dbSNP
rs760934667 2938 dbSNP
rs990839447 2938 dbSNP
rs1315615270 2939 dbSNP
rs184882799 2944 dbSNP
rs1380668227 2946 dbSNP
rs1311466425 2956 dbSNP
rs944365144 2978 dbSNP
rs568250610 2981 dbSNP
rs1296712280 2991 dbSNP
rs1459752811 2995 dbSNP
rs1366644388 2998 dbSNP
rs1163501321 3005 dbSNP
rs527716477 3006 dbSNP
rs1266196433 3009 dbSNP
rs903078753 3012 dbSNP
rs1443253229 3032 dbSNP
rs999099854 3035 dbSNP
rs529204493 3044 dbSNP
rs1419182730 3047 dbSNP
rs1485466195 3057 dbSNP
rs547049662 3062 dbSNP
rs907309380 3065 dbSNP
rs1263299226 3080 dbSNP
rs937141990 3086 dbSNP
rs1221466067 3088 dbSNP
rs1357114917 3089 dbSNP
rs892969608 3092 dbSNP
rs1023040466 3098 dbSNP
rs1305121692 3105 dbSNP
rs1440194065 3106 dbSNP
rs1388812934 3108 dbSNP
rs1346395849 3113 dbSNP
rs971399724 3114 dbSNP
rs1302865632 3118 dbSNP
rs1186454448 3119 dbSNP
rs9900038 3124 dbSNP
rs189383147 3127 dbSNP
rs1157341436 3128 dbSNP
rs1453825574 3135 dbSNP
rs1411876229 3137 dbSNP
rs1454707185 3141 dbSNP
rs752086307 3143 dbSNP
rs1160782928 3144 dbSNP
rs1481174102 3144 dbSNP
rs1400241058 3149 dbSNP
rs974722796 3152 dbSNP
rs920147275 3154 dbSNP
rs954193474 3158 dbSNP
rs995423582 3163 dbSNP
rs1357565730 3164 dbSNP
rs985873264 3167 dbSNP
rs754438737 3168 dbSNP
rs944397233 3169 dbSNP
rs1324479960 3172 dbSNP
rs1286166097 3173 dbSNP
rs757373739 3174 dbSNP
rs779156931 3178 dbSNP
rs1319540672 3179 dbSNP
rs1239768413 3182 dbSNP
rs1019328419 3186 dbSNP
rs1382220262 3187 dbSNP
rs934632509 3198 dbSNP
rs1054759684 3203 dbSNP
rs1470681341 3204 dbSNP
rs1429520305 3211 dbSNP
rs963793887 3212 dbSNP
rs893001786 3213 dbSNP
rs1479328539 3222 dbSNP
rs1374652821 3227 dbSNP
rs1193640074 3228 dbSNP
rs948505115 3232 dbSNP
rs1259603149 3235 dbSNP
rs1262393361 3236 dbSNP
rs1205595848 3244 dbSNP
rs1342329485 3246 dbSNP
rs371817047 3248 dbSNP
rs1209462555 3249 dbSNP
rs180730081 3252 dbSNP
rs4793928 3253 dbSNP
rs1271063566 3254 dbSNP
rs1227166101 3255 dbSNP
rs867029369 3266 dbSNP
rs907246705 3267 dbSNP
rs1325144660 3273 dbSNP
rs1336766960 3273 dbSNP
rs1454100377 3277 dbSNP
rs1406252255 3278 dbSNP
rs1335672891 3279 dbSNP
rs1467843499 3280 dbSNP
rs1486408481 3283 dbSNP
rs1398201592 3293 dbSNP
rs990396981 3297 dbSNP
rs1003293342 3298 dbSNP
rs1251620846 3305 dbSNP
rs1420043447 3306 dbSNP
rs1184650180 3307 dbSNP
rs569815249 3310 dbSNP
rs913491483 3312 dbSNP
rs1371234686 3315 dbSNP
rs1015629811 3325 dbSNP
rs577896415 3328 dbSNP
rs967374819 3331 dbSNP
rs538034652 3332 dbSNP
rs1027637734 3336 dbSNP
rs1439714916 3341 dbSNP
rs1273999937 3343 dbSNP
rs1174269405 3346 dbSNP
rs1195548285 3363 dbSNP
rs1337916992 3369 dbSNP
rs981856630 3375 dbSNP
rs928684320 3377 dbSNP
rs937418722 3388 dbSNP
rs954226550 3392 dbSNP
rs1055835995 3393 dbSNP
rs1329172302 3401 dbSNP
rs1409131633 3403 dbSNP
rs556729961 3410 dbSNP
rs1394139868 3413 dbSNP
rs1428128150 3414 dbSNP
rs1307654570 3422 dbSNP
rs184564896 3427 dbSNP
rs1017313066 3428 dbSNP
rs1384544220 3435 dbSNP
rs1372404594 3437 dbSNP
rs1181775290 3438 dbSNP
rs1391742135 3446 dbSNP
rs542508954 3449 dbSNP
rs1309093243 3450 dbSNP
rs1233648094 3454 dbSNP
rs758649732 3468 dbSNP
rs553706512 3470 dbSNP
rs536561984 3476 dbSNP
rs1436431459 3477 dbSNP
rs887035008 3478 dbSNP
rs1294322710 3482 dbSNP
rs1223706636 3484 dbSNP
rs1359289328 3489 dbSNP
rs976232754 3491 dbSNP
rs924322409 3492 dbSNP
rs1374941762 3493 dbSNP
rs1007857284 3494 dbSNP
rs934306261 3495 dbSNP
rs780207937 3496 dbSNP
rs1304665682 3499 dbSNP
rs1405350273 3501 dbSNP
rs1364839216 3505 dbSNP
rs990095593 3507 dbSNP
rs899531415 3509 dbSNP
rs1408896410 3513 dbSNP
rs948537171 3516 dbSNP
rs996583059 3517 dbSNP
rs1265890358 3519 dbSNP
rs1425067013 3520 dbSNP
rs907027575 3521 dbSNP
rs1271348316 3522 dbSNP
rs746614213 3522 dbSNP
rs138296164 3523 dbSNP
rs938818783 3524 dbSNP
rs747959570 3528 dbSNP
rs1267356992 3536 dbSNP
rs769524270 3537 dbSNP
rs1318193377 3543 dbSNP
rs1284270000 3544 dbSNP
rs564218710 3546 dbSNP
rs957536156 3550 dbSNP
rs1284836999 3554 dbSNP
rs35034188 3569 dbSNP
rs73995448 3573 dbSNP
rs200849813 3574 dbSNP
rs1194793128 3577 dbSNP
rs1397041986 3587 dbSNP
rs1027213730 3588 dbSNP
rs889999716 3590 dbSNP
rs150924309 3594 dbSNP
rs190199397 3595 dbSNP
rs1431679678 3599 dbSNP
rs968037460 3602 dbSNP
rs561941139 3608 dbSNP
rs975883566 3617 dbSNP
rs1462331122 3622 dbSNP
rs981751402 3625 dbSNP
rs1486446550 3629 dbSNP
rs1242065262 3648 dbSNP
rs1388501819 3651 dbSNP
rs928627106 3652 dbSNP
rs1264591832 3653 dbSNP
rs749252671 3659 dbSNP
rs529130516 3660 dbSNP
rs1440151721 3661 dbSNP
rs991510649 3662 dbSNP
rs1298850871 3663 dbSNP
rs36038214 3664 dbSNP
rs1216136760 3667 dbSNP
rs1362524354 3669 dbSNP
rs1372589047 3669 dbSNP
rs79204031 3672 dbSNP
rs1432964627 3673 dbSNP
rs566022091 3676 dbSNP
rs1337627979 3679 dbSNP
rs1469422785 3680 dbSNP
rs1047342357 3687 dbSNP
rs1429510338 3690 dbSNP
rs1419384761 3699 dbSNP
rs1185333554 3701 dbSNP
rs908413546 3702 dbSNP
rs943943252 3705 dbSNP
rs1203773897 3713 dbSNP
rs1207082421 3716 dbSNP
rs1460566385 3717 dbSNP
rs1253913622 3722 dbSNP
rs1264114726 3723 dbSNP
rs532956159 3723 dbSNP
rs181947137 3724 dbSNP
rs1272189013 3725 dbSNP
rs899478769 3727 dbSNP
rs1214908764 3734 dbSNP
rs938502291 3737 dbSNP
rs569731300 3758 dbSNP
rs1315748471 3766 dbSNP
rs1452034806 3767 dbSNP
rs996530770 3768 dbSNP
rs1377195263 3775 dbSNP
rs1463620717 3776 dbSNP
rs1185967547 3784 dbSNP
rs779747472 3790 dbSNP
rs570158876 3797 dbSNP
rs1167106909 3799 dbSNP
rs1427046452 3801 dbSNP
rs918645355 3814 dbSNP
rs931335070 3815 dbSNP
rs143473775 3818 dbSNP
rs1183631998 3828 dbSNP
rs1443524606 3829 dbSNP
rs556431146 3842 dbSNP
rs770761537 3842 dbSNP
rs893555716 3852 dbSNP
rs770374152 3870 dbSNP
rs901353287 3873 dbSNP
rs1011706706 3879 dbSNP
rs568645485 3884 dbSNP
rs759038128 3885 dbSNP
rs1309403337 3887 dbSNP
rs903379968 3891 dbSNP
rs1460698314 3895 dbSNP
rs1326551665 3898 dbSNP
rs1396534193 3900 dbSNP
rs1407179655 3913 dbSNP
rs1031421172 3916 dbSNP
rs771746481 3917 dbSNP
rs1163568377 3922 dbSNP
rs1456959710 3926 dbSNP
rs955947302 3936 dbSNP
rs1419239020 3938 dbSNP
rs535710712 3938 dbSNP
rs1362025946 3945 dbSNP
rs1179692692 3947 dbSNP
rs1216032128 3948 dbSNP
rs9902118 3956 dbSNP
rs1269485738 3957 dbSNP
rs1334669569 3958 dbSNP
rs1035921271 3959 dbSNP
rs969695140 3961 dbSNP
rs1234235246 3976 dbSNP
rs958668701 3989 dbSNP
rs1275637797 3992 dbSNP
rs1316517204 3995 dbSNP
rs557920724 3996 dbSNP
rs1225715640 4008 dbSNP
rs1346607370 4012 dbSNP
rs1303078286 4013 dbSNP
rs928508987 4015 dbSNP
rs572433212 4022 dbSNP
rs1453889191 4026 dbSNP
rs1410729900 4031 dbSNP
rs1156564137 4033 dbSNP
rs761073106 4037 dbSNP
rs972940428 4044 dbSNP
rs545776389 4049 dbSNP
rs1197924092 4052 dbSNP
rs952902179 4055 dbSNP
rs982923724 4066 dbSNP
rs1205757771 4069 dbSNP
rs908360946 4081 dbSNP
rs943911475 4088 dbSNP
rs1464543233 4090 dbSNP
rs1257047510 4092 dbSNP
rs1474770540 4096 dbSNP
rs976643438 4098 dbSNP
rs921196891 4109 dbSNP
rs1328664252 4111 dbSNP
rs369379559 4131 dbSNP
rs1296965504 4132 dbSNP
rs1158285909 4136 dbSNP
rs148010323 4137 dbSNP
rs1053452038 4138 dbSNP
rs911248796 4138 dbSNP
rs893512059 4141 dbSNP
rs942674134 4142 dbSNP
rs945107278 4143 dbSNP
rs1476942466 4144 dbSNP
rs1300734555 4145 dbSNP
rs576431715 4148 dbSNP
rs1193889748 4163 dbSNP
rs1448938049 4167 dbSNP
rs1415782852 4171 dbSNP
rs754349217 4181 dbSNP
rs1295442713 4185 dbSNP
rs1003008967 4197 dbSNP
rs867682049 4205 dbSNP
rs1246199111 4206 dbSNP
rs186053447 4208 dbSNP
rs1461902055 4217 dbSNP
rs1035867901 4219 dbSNP
rs1223784022 4220 dbSNP
rs866277489 4222 dbSNP
rs901381640 4225 dbSNP
rs999705814 4227 dbSNP
rs1208051503 4228 dbSNP
rs762423421 4229 dbSNP
rs1279918425 4237 dbSNP
rs1486083198 4261 dbSNP
rs1227423682 4263 dbSNP
rs1053066323 4266 dbSNP
rs561692480 4268 dbSNP
rs1454148063 4270 dbSNP
rs1383029481 4274 dbSNP
rs1333153231 4276 dbSNP
rs1412536592 4280 dbSNP
rs894731037 4286 dbSNP
rs893972098 4288 dbSNP
rs1428967984 4295 dbSNP
rs1011354864 4301 dbSNP
rs1237092110 4304 dbSNP
rs1259432419 4304 dbSNP
rs1445355259 4304 dbSNP
rs1013159509 4311 dbSNP
rs1185760166 4327 dbSNP
rs2333091 4329 dbSNP
rs1251606284 4335 dbSNP
rs1204907562 4354 dbSNP
rs1176597492 4355 dbSNP
rs952773828 4356 dbSNP
rs1294639208 4358 dbSNP
rs983256051 4362 dbSNP
rs1015698433 4364 dbSNP
rs1283235337 4365 dbSNP
rs1445276920 4365 dbSNP
rs1337180133 4368 dbSNP
rs1329245306 4382 dbSNP
rs747967973 4383 dbSNP
rs1171121330 4384 dbSNP
rs190826936 4394 dbSNP
rs1425360468 4395 dbSNP
rs976590968 4397 dbSNP
rs1435016074 4400 dbSNP
rs1314329740 4401 dbSNP
rs1161536711 4402 dbSNP
rs1471247210 4403 dbSNP
rs181189555 4405 dbSNP
rs1334399484 4406 dbSNP
rs1181875256 4410 dbSNP
rs1035616880 4412 dbSNP
rs960196041 4412 dbSNP
rs559665991 4417 dbSNP
rs921144345 4419 dbSNP
rs71372825 4421 dbSNP
rs750511298 4422 dbSNP
rs1288459766 4423 dbSNP
rs1226143254 4424 dbSNP
rs1280671021 4425 dbSNP
rs1352338276 4428 dbSNP
rs1376117923 4428 dbSNP
rs1288629206 4430 dbSNP
rs1227527013 4441 dbSNP
rs879407214 4442 dbSNP
rs533301676 4449 dbSNP
rs1302844667 4457 dbSNP
rs1304874505 4466 dbSNP
rs1405410846 4471 dbSNP
rs989431252 4473 dbSNP
rs914872967 4479 dbSNP
rs1402566834 4483 dbSNP
rs1385919416 4487 dbSNP
rs868806087 4488 dbSNP
rs1042501369 4489 dbSNP
rs1213338570 4491 dbSNP
rs1379912153 4494 dbSNP
rs1200622658 4503 dbSNP
rs544383302 4504 dbSNP
rs1218698116 4511 dbSNP
rs1272723798 4514 dbSNP
rs1448273683 4518 dbSNP
rs1268351179 4521 dbSNP
rs56055539 4522 dbSNP
rs1207791306 4523 dbSNP
rs984180613 4526 dbSNP
rs1284896526 4530 dbSNP
rs1219606887 4532 dbSNP
rs1366783493 4533 dbSNP
rs758464368 4536 dbSNP
rs1203504522 4547 dbSNP
rs551365476 4558 dbSNP
rs111751674 4559 dbSNP
rs1432961785 4561 dbSNP
rs1389559111 4562 dbSNP
rs186497038 4569 dbSNP
rs976686602 4569 dbSNP
rs1408604658 4571 dbSNP
rs922619453 4573 dbSNP
rs1057225331 4574 dbSNP
rs1471085103 4575 dbSNP
rs3834567 4578 dbSNP
rs746812244 4578 dbSNP
rs1188855514 4587 dbSNP
rs780298804 4604 dbSNP
rs1248029901 4606 dbSNP
rs1187403507 4608 dbSNP
rs1013106169 4610 dbSNP
rs1048666302 4612 dbSNP
rs535688999 4612 dbSNP
rs796883913 4612 dbSNP
rs888424335 4614 dbSNP
rs1004231378 4616 dbSNP
rs147146295 4622 dbSNP
rs1276412650 4623 dbSNP
rs1042847171 4631 dbSNP
rs1409784347 4631 dbSNP
rs1329884756 4639 dbSNP
rs965456824 4640 dbSNP
rs755895447 4644 dbSNP
rs998310927 4651 dbSNP
rs1028152826 4653 dbSNP
rs1385227415 4655 dbSNP
rs1303690120 4657 dbSNP
rs1447742859 4658 dbSNP
rs1357850986 4675 dbSNP
rs953883680 4684 dbSNP
rs1172989949 4694 dbSNP
rs371002341 4695 dbSNP
rs567295422 4696 dbSNP
rs1390125495 4697 dbSNP
rs777562368 4700 dbSNP
rs138911003 4701 dbSNP
rs1035800297 4702 dbSNP
rs977787174 4705 dbSNP
rs142935353 4712 dbSNP
rs770854328 4713 dbSNP
rs1229298687 4715 dbSNP
rs374579841 4715 dbSNP
rs775429190 4715 dbSNP
rs566791736 4716 dbSNP
rs1273884210 4727 dbSNP
rs1054827875 4729 dbSNP
rs565999845 4743 dbSNP
rs745364105 4745 dbSNP
rs948909640 4751 dbSNP
rs1313695371 4756 dbSNP
rs1395598671 4758 dbSNP
rs1049095243 4766 dbSNP
rs1018321144 4769 dbSNP
rs964129656 4772 dbSNP
rs1370450467 4773 dbSNP
rs1306785483 4782 dbSNP
rs1427257027 4798 dbSNP
rs1211788267 4803 dbSNP
rs1252275119 4805 dbSNP
rs1369624182 4806 dbSNP
rs1164882441 4809 dbSNP
rs1422832542 4810 dbSNP
rs1468557783 4813 dbSNP
rs1178699201 4816 dbSNP
rs775747970 4817 dbSNP
rs976860371 4818 dbSNP
rs922617983 4827 dbSNP
rs1490820886 4828 dbSNP
rs935333855 4832 dbSNP
rs1244184470 4843 dbSNP
rs1320098867 4845 dbSNP
rs1309472058 4850 dbSNP
rs539767320 4852 dbSNP
rs1350326813 4854 dbSNP
rs1286855074 4859 dbSNP
rs1474843946 4873 dbSNP
rs1407234184 4879 dbSNP
rs915473822 4882 dbSNP
rs763128675 4886 dbSNP
rs1168131360 4901 dbSNP
rs946871193 4902 dbSNP
rs771525303 4904 dbSNP
rs1037033437 4911 dbSNP
rs905354449 4913 dbSNP
rs147242815 4916 dbSNP
rs1460180282 4918 dbSNP
rs1434785553 4923 dbSNP
rs1268006198 4925 dbSNP
rs60068103 4926 dbSNP
rs760269108 4927 dbSNP
rs537093196 4932 dbSNP
rs191485958 4933 dbSNP
rs1325913342 4936 dbSNP
rs1286795690 4949 dbSNP
rs546993219 4951 dbSNP
rs1225771550 4957 dbSNP
rs1025984125 4959 dbSNP
rs76819182 4963 dbSNP
rs1010746960 4964 dbSNP
rs1005415884 4971 dbSNP
rs1364955443 4975 dbSNP
rs541214666 4977 dbSNP
rs1018102445 4982 dbSNP
rs1231175898 4989 dbSNP
rs1387479034 4992 dbSNP
rs182466174 5011 dbSNP
rs1467426318 5014 dbSNP
rs998705618 5018 dbSNP
rs1198146579 5024 dbSNP
rs1431374739 5030 dbSNP
rs1335323070 5031 dbSNP
rs1029718719 5033 dbSNP
rs777140720 5044 dbSNP
rs1259126621 5048 dbSNP
rs1205949502 5055 dbSNP
rs1255913901 5055 dbSNP
rs5821210 5055 dbSNP
rs66520917 5055 dbSNP
rs77856514 5055 dbSNP
rs202136663 5058 dbSNP
rs3085972 5069 dbSNP
rs1231621749 5070 dbSNP
rs915506303 5072 dbSNP
rs1193513984 5079 dbSNP
rs577962863 5081 dbSNP
rs768082030 5083 dbSNP
rs978446939 5084 dbSNP
rs926814666 5094 dbSNP
rs939504346 5096 dbSNP
rs1397547081 5097 dbSNP
rs1419221410 5113 dbSNP
rs187889246 5114 dbSNP
rs1179365064 5118 dbSNP
rs960383092 5119 dbSNP
rs1391986238 5120 dbSNP
rs1250488945 5123 dbSNP
rs1463525378 5125 dbSNP
rs1448995274 5128 dbSNP
rs1246412842 5129 dbSNP
rs1157339069 5140 dbSNP
rs1189964319 5145 dbSNP
rs1384404922 5148 dbSNP
rs1443216520 5148 dbSNP
rs531323046 5149 dbSNP
rs1344884180 5155 dbSNP
rs563472620 5160 dbSNP
rs1353755434 5165 dbSNP
rs990509531 5167 dbSNP
rs762333600 5173 dbSNP
rs916346162 5189 dbSNP
rs1246462446 5193 dbSNP
rs948867838 5196 dbSNP
rs557080739 5200 dbSNP
rs1394117544 5205 dbSNP
rs1372308904 5210 dbSNP
rs4541134 5219 dbSNP
rs530523199 5220 dbSNP
rs1037718835 5221 dbSNP
rs901150238 5229 dbSNP
rs1349358404 5230 dbSNP
rs1005464873 5236 dbSNP
rs933992695 5247 dbSNP
rs1253150031 5250 dbSNP
rs1484268113 5250 dbSNP
rs1049806804 5266 dbSNP
rs750939088 5272 dbSNP
rs1484451220 5277 dbSNP
rs1211145308 5291 dbSNP
rs773917106 5293 dbSNP
rs149932785 5294 dbSNP
rs997989816 5304 dbSNP
rs1352180370 5306 dbSNP
rs902371513 5313 dbSNP
rs1258732555 5316 dbSNP
rs1059743 5321 dbSNP
rs1030177886 5325 dbSNP
rs1476375195 5327 dbSNP
rs760229130 5335 dbSNP
rs999429110 5338 dbSNP
rs1410556502 5341 dbSNP
rs1010051386 5348 dbSNP
rs1390258178 5352 dbSNP
rs1022326968 5364 dbSNP
rs190740345 5365 dbSNP
rs765849065 5368 dbSNP
rs868386911 5369 dbSNP
rs981051708 5392 dbSNP
rs528188575 5393 dbSNP
rs377763760 5396 dbSNP
rs540380642 5397 dbSNP
rs961181451 5401 dbSNP
rs1023303748 5407 dbSNP
rs547558050 5418 dbSNP
rs1211368569 5419 dbSNP
rs1330782950 5420 dbSNP
rs753507748 5422 dbSNP
rs183432285 5428 dbSNP
rs984982820 5441 dbSNP
rs1276593991 5454 dbSNP
rs1437263996 5457 dbSNP
rs766396958 5461 dbSNP
rs1434399401 5469 dbSNP
rs910039167 5472 dbSNP
rs539703929 5483 dbSNP
rs1458974529 5486 dbSNP
rs144266881 5489 dbSNP
rs1389701068 5491 dbSNP
rs1158852559 5494 dbSNP
rs1046797038 5496 dbSNP
rs1427854554 5496 dbSNP
rs116608797 5499 dbSNP
rs922856703 5500 dbSNP
rs1375890067 5504 dbSNP
rs148749035 5505 dbSNP
rs1397509476 5511 dbSNP
rs933938965 5512 dbSNP
rs1039599059 5519 dbSNP
rs899724143 5520 dbSNP
rs1248299754 5525 dbSNP
rs1335026319 5534 dbSNP
rs1239152013 5551 dbSNP
rs1310884157 5562 dbSNP
rs1049754251 5564 dbSNP
rs1209764382 5565 dbSNP
rs187288384 5573 dbSNP
rs1484457467 5580 dbSNP
rs1301287938 5581 dbSNP
rs1437422160 5586 dbSNP
rs764873188 5603 dbSNP
rs1194399243 5604 dbSNP
rs1250441996 5608 dbSNP
rs933830579 5612 dbSNP
rs1050970593 5613 dbSNP
rs1361199672 5616 dbSNP
rs1177270336 5617 dbSNP
rs1414347949 5631 dbSNP
rs1423718928 5634 dbSNP
rs946807875 5639 dbSNP
rs1171162268 5643 dbSNP
rs1450843710 5649 dbSNP
rs374974057 5654 dbSNP
rs1187610839 5655 dbSNP
rs535125048 5658 dbSNP
rs867103788 5659 dbSNP
rs1393421108 5664 dbSNP
rs1453845985 5669 dbSNP
rs999780867 5681 dbSNP
rs1034868911 5682 dbSNP
rs879766972 5685 dbSNP
rs1278167560 5688 dbSNP
rs1174522173 5690 dbSNP
rs1230684194 5692 dbSNP
rs1129053 5702 dbSNP
rs1129054 5706 dbSNP
rs777474347 5722 dbSNP
rs1296976496 5724 dbSNP
rs1002183521 5729 dbSNP
rs545086602 5736 dbSNP
rs1033946671 5750 dbSNP
rs961018344 5755 dbSNP
rs150201551 5764 dbSNP
rs376021431 5764 dbSNP
rs1012159256 5765 dbSNP
rs75699889 5766 dbSNP
rs1310448253 5774 dbSNP
rs992803253 5775 dbSNP
rs75447124 5784 dbSNP
rs1390183436 5787 dbSNP
rs540060154 5792 dbSNP
rs1426316144 5796 dbSNP
rs1333246291 5800 dbSNP
rs1415561802 5805 dbSNP
rs553161206 5809 dbSNP
rs1472378136 5814 dbSNP
rs757097547 5819 dbSNP
rs1303736787 5820 dbSNP
rs1273954961 5824 dbSNP
rs909596473 5824 dbSNP
rs941049545 5827 dbSNP
rs1225716594 5829 dbSNP
rs951831392 5831 dbSNP
rs758246132 5837 dbSNP
rs984539764 5839 dbSNP
rs1228091199 5850 dbSNP
rs920915329 5875 dbSNP
rs1410915413 5879 dbSNP
rs933945892 5888 dbSNP
rs77516787 5898 dbSNP
rs868086857 5911 dbSNP
rs961534025 5922 dbSNP
rs1437186818 5928 dbSNP
rs892331045 5943 dbSNP
rs945155611 5947 dbSNP
rs1460597434 5951 dbSNP
rs972898514 5952 dbSNP
rs922804231 5957 dbSNP
rs1251046558 5963 dbSNP
rs1043854389 5969 dbSNP
rs545267745 5972 dbSNP
rs1266259975 5978 dbSNP
rs1221024983 5982 dbSNP
rs1468116049 5984 dbSNP
rs555551266 5991 dbSNP
rs1002278200 5993 dbSNP
rs985737156 5999 dbSNP
rs565069279 6000 dbSNP
rs911205262 6003 dbSNP
rs946723830 6014 dbSNP
rs1427541688 6020 dbSNP
rs1389169901 6021 dbSNP
rs573505311 6024 dbSNP
rs1293618057 6027 dbSNP
rs761992351 6039 dbSNP
rs200789736 6040 dbSNP
rs575483612 6046 dbSNP
rs1161071950 6047 dbSNP
rs1013872653 6048 dbSNP
rs1170000357 6049 dbSNP
rs1363147153 6054 dbSNP
rs924031667 6062 dbSNP
rs1156921860 6065 dbSNP
rs542574142 6066 dbSNP
rs192230286 6067 dbSNP
rs1462288593 6080 dbSNP
rs1268077735 6084 dbSNP
rs950916091 6096 dbSNP
rs1172763793 6098 dbSNP
rs528130475 6101 dbSNP
rs1467279779 6106 dbSNP
rs1250187407 6113 dbSNP
rs1392153229 6115 dbSNP
rs1259337686 6124 dbSNP
rs185334770 6124 dbSNP
rs1235991881 6139 dbSNP
rs1325927153 6143 dbSNP
rs116403332 6149 dbSNP
rs1439568170 6149 dbSNP
rs187860271 6150 dbSNP
rs962463466 6152 dbSNP
rs1435542426 6157 dbSNP
rs1294370252 6159 dbSNP
rs527803838 6166 dbSNP
rs1467478328 6167 dbSNP
rs1378166141 6168 dbSNP
rs367630553 6169 dbSNP
rs1173052374 6177 dbSNP
rs1452722438 6186 dbSNP
rs746606244 6189 dbSNP
rs1392250223 6193 dbSNP
rs1271830339 6194 dbSNP
rs887427142 6198 dbSNP
rs1202581606 6201 dbSNP
rs1483844907 6211 dbSNP
rs1334702740 6216 dbSNP
rs1006308350 6230 dbSNP
rs1255978833 6231 dbSNP
rs1232915514 6247 dbSNP
rs1345205098 6251 dbSNP
rs768419496 6252 dbSNP
rs1014636184 6255 dbSNP
rs370107285 6262 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUAC-----ACGACGAu 5'
                | ||||||      |||||| 
Target 5' ------CAAUUAUGAAUAAAGCUGCUa 3'
1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000579991.2 | 3UTR | CAAUUAUGAAUAAAGCUGCUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000579991.2 | 3UTR | CAAUUAUGAAUAAAGCUGCUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000579991.2 | 3UTR | CAAUUAUGAAUAAAGCUGCUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.721 5.2e-5 0.550 3.3e-3 23 Click to see details
GSE21032 Prostate cancer -0.372 2.7e-4 -0.213 2.7e-2 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.635 1.3e-3 -0.556 5.5e-3 20 Click to see details
GSE19536 Breast cancer -0.276 2.7e-3 -0.200 2.3e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.3 3.6e-3 -0.179 5.7e-2 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.478 7.8e-3 0.423 1.8e-2 25 Click to see details
GSE21687 Ependynoma primary tumors -0.183 7.4e-2 -0.001 5.0e-1 64 Click to see details
GSE38226 Liver fibrosis 0.326 7.5e-2 0.480 1.4e-2 21 Click to see details
GSE28260 Renal cortex and medulla 0.36 1.1e-1 0.258 2.0e-1 13 Click to see details
GSE19350 CNS germ cell tumors -0.363 1.2e-1 -0.245 2.2e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.219 1.8e-1 -0.238 1.6e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.159 1.9e-1 0.279 6.1e-2 32 Click to see details
GSE14794 Lymphoblastoid cells 0.089 2.0e-1 0.084 2.2e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.215 2.1e-1 -0.229 2.0e-1 16 Click to see details
GSE28544 Breast cancer -0.15 2.4e-1 -0.355 4.4e-2 24 Click to see details
GSE21849 B cell lymphoma 0.135 2.4e-1 0.156 2.1e-1 29 Click to see details
GSE17306 Multiple myeloma -0.038 4.0e-1 0.136 1.8e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells 0.05 4.1e-1 0.075 3.6e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.04 4.2e-1 0.227 1.4e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.04 4.2e-1 0.227 1.4e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.517 0 -0.482 0 32 Click to see details
LIHC -0.33 0.01 -0.262 0.03 49 Click to see details
COAD 0.72 0.02 0.762 0.01 8 Click to see details
BLCA -0.462 0.03 -0.470 0.02 18 Click to see details
THCA -0.231 0.04 -0.328 0.01 59 Click to see details
KIRP -0.303 0.05 -0.420 0.01 32 Click to see details
CHOL -0.587 0.05 -0.367 0.17 9 Click to see details
HNSC -0.177 0.13 -0.206 0.1 42 Click to see details
LUSC -0.139 0.2 -0.047 0.39 38 Click to see details
BRCA 0.071 0.26 0.046 0.34 84 Click to see details
PCPG -0.638 0.28 -0.500 0.33 3 Click to see details
KICH -0.112 0.3 0.022 0.46 25 Click to see details
LUAD 0.163 0.31 0.189 0.28 12 Click to see details
KIRC -0.05 0.34 0.010 0.47 68 Click to see details
PAAD -0.258 0.37 -0.400 0.3 4 Click to see details
UCEC -0.05 0.42 -0.093 0.35 19 Click to see details
CESC 0.159 0.45 0.500 0.33 3 Click to see details
ESCA 0.035 0.46 0.127 0.35 11 Click to see details
PRAD -0.013 0.46 -0.107 0.23 50 Click to see details
PRAD -0.013 0.46 -0.107 0.23 50 Click to see details
PRAD -0.013 0.46 -0.107 0.23 50 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase