miRTarBase - #MIRT258410 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WIPI2   
Synonyms ATG18B, Atg21, CGI-50, WIPI-2
Description WD repeat domain, phosphoinositide interacting 2
Transcript NM_001033518   
Other Transcripts NM_001033519 , NM_001033520 , NM_015610 , NM_016003   
Expression
Putative miRNA Targets on WIPI2
3'UTR of WIPI2
(miRNA target sites are highlighted)
>WIPI2|NM_001033518|3'UTR
   1 ACTTGACCTGTGACCTCTGACCCGGGGAGCAGAGAACACTGGCTTCACAGAGGACTTTGTGCATTGCTGCTATGAACTTT
  81 GACCTGAGTCGGGGGAGAGGATGGCAGAGACTTTATTAAAAAAAAAAAAAGATTGTAGTGGTAGTCTAACTCCATAACGC
 161 TGAGGAAATACATCATTTTCACTTCAGTGGCTTTTAAATCCTGCTTATGAATTTTAGCTTTTTGTTTGTTTGTTTTCTCT
 241 TTTTGCCAAAATTAACTGTTTGGTGAAGCCCGCAAAACCTCCTCGCTTTGCATGCATGAACGTGCCAAGCCAGCATAGGG
 321 GAGCTAGAAGCCACTTTCCAGCCACCTGCCGTTGGGTTTTTTCATATCTGTACATAATGCCGAGTGCGTAAGGAAACCGT
 401 GGCGTCGCGCACAGTGGGTCTGCTTGTCAAGGCCAGTTCTGCAGTGACAGGCCCAGGGGCTGCCCACCAGGTGTGCTGGG
 481 CAGACTTCAGCTGGGACAGAAGTCCGATCTCCCTAGGGCCCCACCTGGACCATTTTCCCTCCGTTTTATTTTGTTAATTA
 561 AATTCTTTCCAAATTGGATCGCTCTGGGATTTCTTCCATGGTGGACTTTTGTTTCTGATCTTGTTTTCCCTGTGGATATT
 641 GGAGGACAGCGAGGTTCTTTCTGATACTAAAAACCTTTCTTTCAGGCAGCAAATGAACTTGAAAGGTTGCCTGGACTCGC
 721 TGGAGCAAAGGAAAGCGATTTTGTTTGTATAATTAAATGATCTGTTCTTCTACTTCACTCTTCCTGTTGAAAAACTGTGT
 801 GATTTTTTTTTTTTTTTAAGTAAAGTTTGTAGCTCCTCCCATGCCCAGGAAAGCACAGAACTCAAGTGTGGTGGCCGTCT
 881 GAGCTGTCCTTTCGCTGGCCCCGCTGTCCGCAGGGGCTTCCTACCTGTGTGAGAGGTCGTAGCGGGAGACAGCAACAGAG
 961 AGTAGGCGGCTGGGCCACGTCCTTCACAGGGCGTCATGTGCCTTTCTATTTTCATCTTAGAAAATTTCCTCAGCAAACCG
1041 ATGAGAGATTGTGGTTGCAAGCTTCAGTATTTGCCTCGCTTCCCTTCCCTTTTCATATTTACAGAATTAAAACAACCTCA
1121 AGTACCTCAGACTCTGCATTCCAAACCAAGGCACCCAGCAGCCAAAGTGTCGAGGGCATTTAAGTGGCATTAATGGCAGG
1201 AGAGATGGTTTTAGAATCTATGGAGTGGTGGAAGTTACGGATAGAAGGGAAAAGGCAAAAACTATTTACCCTGCCTTTGC
1281 AGGCTGGGGTTTTTGAACCGAGGAAGGCTGGGACGCCTGTTTCCAGATGGTTGTCATGGTCACGCTGGGCGAAGAGCTGG
1361 AGGGGAGTTGTCCCCTCAGCTGAGCGGCTGCGGTGAAATGCCCCAGTGTTCCTGGGTTGGCTTTACGGCAAACTAAATGC
1441 AGGGGACGCTGGAGTCCGACTCACCTACACCGGCTTCCTCCCAGCCGCTGGTGTGCGGCACACACAACATCTGCATTAGG
1521 CAGAGGTGCAAGTGGGCTGATTGAACTTTTCCTTCAAAACCTGCTTGTCTGTCCTGGACCTTTGATGAAATGGGATCCCG
1601 GTCACGCAGGCTGAGACAGTGGGGACCGCCGAGGCCAGAGTGGGCTATGCTTGAGCAGGGATGAGAAGGGCCGCGGCAGC
1681 ACGCAGCCTTGACCCACGCCTGCGTCTTGTGGTGCAAGGCCAGAGGGCTCTCTCTAGAACCTGACCGTGCACTCCATCTC
1761 CTGGGAGCCACTTTTGGCAAGAGTGAGTGTGGGGGGAAAAAGTGTGCACAAGAGATACGGAACCCTGAGCTAGGGTTTCC
1841 TGTCACCAAAGAGTGAGCTGCATTTCCAGTTCTGCGTTAAAGTATCGTTTGTTCTGGTGCCTGCCTGTGGTGGTGATTTG
1921 GAGACTCAAATTTCCTTTGCCAGGTCTCTTTTGTCTTTCTTTGGGATTGGTAGTATAGAAGATGCTGGGAATTGTCTTCC
2001 TCGCTCAGCCTCGGCTTCCCGCACTGTAAGATGAGGCAGTTGCAGAGGAGGCCTCGGACGTCCTGTGACCCTCGGCCCAC
2081 ACTCCCCCTTGGGTGGCCCTGGCAGGGCTGGCTAGGTGCGTTCCCTGCAGACCACGGGAAGCCCTGTGCTTGCCTGGGTC
2161 AGGGCTAAGCTGTGCGCCCTAGAGGAGGGAGGAGGACTGCAGATTCTTGGTCGAGAAGAATGAAGAGGATTTCTGTGTTT
2241 GCTGAGCAGCCATTGTGGAGGGTTACCCGCCTCCACTTTCCCGTTGCCCATTTCACTGCCACCAGCTCCTCTTCCTCTGC
2321 TCGAACCTATGAGTCCCAGCCTCACTGGCGGCCTCAGACATGCTCAGGAGTGACGGGGACAGAGGGAGGCCGCTGAGTTG
2401 CCCGTTAGAACTCTTACTGCTGCGCCAGTGACCCAGGTGGAGAGGGACCCTGAACCAAACAGAACGTGTGCTAATTTTCC
2481 GAACTCCAAACTGTACACTCATATTCATTTTTAAATTGTATTTTTCCAAACTTCAAAAAGGACGATGAGCGTGGGGGATA
2561 GGAAACAAAACCTGTAAACGTTGTGAATGGGCTCAGTGGACTCTGGGACCAAACCTTCTGTAATCTCTAAAACAATGGGA
2641 CCAAGAGCTGGATGGAACCTGGAGTCAAAAAGAACTGCTTCAGTCCCCGCTGTACCGCCTGCCTAGCTGTGGGAGCAGGC
2721 AGGGCGCCTGGGAGCCTGCGTTTTCTGGACCGTTCCATGGGACTCATCCCTACCTCACAGGGCTGTTGTGAGGTGTTGTG
2801 TGACTGCGTGTCCTGCAAACGCCCAGCTCGGTGCCCAGCCAGCGGTGGGCACCCAATAAACGCTACAACATAAATGTGTC
2881 TTCTGCAATTAAACACGATTTTTATTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUAC---ACGACGAu 5'
             |:: | ||:||   ||||||| 
Target 5' cagAGGACTTTGTGCATTGCTGCTa 3'
48 - 72 155.00 -14.50
2
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             :|||: |||  ||||||  
Target 5' ttaGAACTCTTA-CTGCTGCgc 3'
2405 - 2425 138.00 -9.90
3
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ::|: |||  | ||||| 
Target 5' cagtGGCTTTTAAATCCTGCTt 3'
185 - 206 122.00 -7.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31540006 15 COSMIC
COSN30513043 24 COSMIC
COSN30113778 57 COSMIC
COSN30660172 96 COSMIC
COSN27386689 131 COSMIC
COSN28891515 174 COSMIC
COSN17037989 175 COSMIC
COSN31591300 399 COSMIC
COSN20091504 698 COSMIC
COSN20855143 760 COSMIC
COSN20103707 818 COSMIC
COSN21090324 882 COSMIC
COSN9992988 967 COSMIC
COSN15098315 994 COSMIC
COSN26559895 1001 COSMIC
COSN30161576 1007 COSMIC
COSN16602753 1079 COSMIC
COSN20103710 1088 COSMIC
COSN20091505 1093 COSMIC
COSN8303627 1269 COSMIC
COSN21818475 1584 COSMIC
COSN9992992 1704 COSMIC
COSN29144141 1725 COSMIC
COSN17075742 1798 COSMIC
COSN20103714 1802 COSMIC
COSN32056949 2121 COSMIC
COSN8303632 2359 COSMIC
COSN14546950 2519 COSMIC
COSN28819454 2544 COSMIC
COSN31542026 2551 COSMIC
COSN8303633 2552 COSMIC
COSN26553179 2592 COSMIC
COSN30271940 2600 COSMIC
COSN20613612 2634 COSMIC
COSN31486730 2646 COSMIC
COSN9992994 2690 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755801525 8 dbSNP
rs1179150192 10 dbSNP
rs1430628368 11 dbSNP
rs779801662 13 dbSNP
rs1248631548 14 dbSNP
rs1222639508 15 dbSNP
rs919904900 15 dbSNP
rs749138062 20 dbSNP
rs754865854 24 dbSNP
rs778991604 24 dbSNP
rs369362941 25 dbSNP
rs747012079 27 dbSNP
rs771074047 41 dbSNP
rs1329960116 47 dbSNP
rs1004662615 50 dbSNP
rs34072945 54 dbSNP
rs1293727383 56 dbSNP
rs151194377 59 dbSNP
rs916763613 63 dbSNP
rs1405369984 91 dbSNP
rs771322664 92 dbSNP
rs907030096 94 dbSNP
rs1421916573 95 dbSNP
rs79306089 96 dbSNP
rs764626694 99 dbSNP
rs982369830 104 dbSNP
rs1417366493 108 dbSNP
rs756953270 115 dbSNP
rs1191798899 118 dbSNP
rs1191981522 118 dbSNP
rs371468533 118 dbSNP
rs1011269413 119 dbSNP
rs1260037499 120 dbSNP
rs1020032318 128 dbSNP
rs76067611 130 dbSNP
rs77719560 131 dbSNP
rs1313421599 132 dbSNP
rs1336667949 134 dbSNP
rs967090073 141 dbSNP
rs1407401044 147 dbSNP
rs928284132 149 dbSNP
rs1296764306 154 dbSNP
rs1373029483 155 dbSNP
rs576511238 157 dbSNP
rs938377915 159 dbSNP
rs964568602 160 dbSNP
rs1224606450 161 dbSNP
rs1288774928 164 dbSNP
rs1452330392 175 dbSNP
rs1047398690 181 dbSNP
rs1360964046 187 dbSNP
rs975684207 188 dbSNP
rs1290428346 192 dbSNP
rs920211696 204 dbSNP
rs1321518845 205 dbSNP
rs1478010466 208 dbSNP
rs886165685 209 dbSNP
rs144008450 217 dbSNP
rs374852866 221 dbSNP
rs931296793 221 dbSNP
rs1047083078 224 dbSNP
rs941790054 225 dbSNP
rs1256527814 228 dbSNP
rs11552274 233 dbSNP
rs1202430233 233 dbSNP
rs908564651 250 dbSNP
rs1037903028 262 dbSNP
rs900365786 268 dbSNP
rs996492517 270 dbSNP
rs562008279 272 dbSNP
rs181396494 273 dbSNP
rs1177486651 275 dbSNP
rs1253457076 278 dbSNP
rs902198967 278 dbSNP
rs757867835 279 dbSNP
rs1469322446 283 dbSNP
rs1001811740 285 dbSNP
rs999505027 286 dbSNP
rs1031010979 290 dbSNP
rs1055695905 296 dbSNP
rs1175039847 297 dbSNP
rs893071391 302 dbSNP
rs547760933 303 dbSNP
rs935035337 307 dbSNP
rs1459608974 314 dbSNP
rs1430644185 315 dbSNP
rs1239408906 317 dbSNP
rs1019938697 319 dbSNP
rs1338420137 332 dbSNP
rs1416703981 335 dbSNP
rs1168944237 345 dbSNP
rs1225756077 348 dbSNP
rs1011026225 351 dbSNP
rs1024221625 352 dbSNP
rs1452481508 356 dbSNP
rs142445038 357 dbSNP
rs765795735 357 dbSNP
rs200743223 363 dbSNP
rs201490858 364 dbSNP
rs1007947062 365 dbSNP
rs1166342727 368 dbSNP
rs1019817904 369 dbSNP
rs928189142 370 dbSNP
rs1385580888 374 dbSNP
rs369535287 375 dbSNP
rs964243980 377 dbSNP
rs527369065 380 dbSNP
rs976010810 382 dbSNP
rs1027227723 383 dbSNP
rs983039992 387 dbSNP
rs551946469 388 dbSNP
rs879069539 389 dbSNP
rs759000904 392 dbSNP
rs751325860 399 dbSNP
rs1037494752 400 dbSNP
rs570630430 404 dbSNP
rs908514157 405 dbSNP
rs931775010 407 dbSNP
rs545989670 408 dbSNP
rs73676547 409 dbSNP
rs999453997 410 dbSNP
rs550117973 414 dbSNP
rs893847623 417 dbSNP
rs1011391575 418 dbSNP
rs1198216541 419 dbSNP
rs1388682916 419 dbSNP
rs1365967458 420 dbSNP
rs1302386694 427 dbSNP
rs1269028854 431 dbSNP
rs1382148117 433 dbSNP
rs868114453 433 dbSNP
rs1159042438 435 dbSNP
rs186657400 437 dbSNP
rs535882363 444 dbSNP
rs902844857 448 dbSNP
rs1007937224 449 dbSNP
rs1480600389 453 dbSNP
rs1267721397 454 dbSNP
rs1019343177 461 dbSNP
rs969888076 468 dbSNP
rs1286995696 474 dbSNP
rs564116586 482 dbSNP
rs1350063951 484 dbSNP
rs1410907037 489 dbSNP
rs1035151244 491 dbSNP
rs1235508892 495 dbSNP
rs1346451908 506 dbSNP
rs1027546161 507 dbSNP
rs951598194 508 dbSNP
rs983028699 514 dbSNP
rs1424307229 515 dbSNP
rs907529338 516 dbSNP
rs1318913528 517 dbSNP
rs963099587 521 dbSNP
rs1135000 524 dbSNP
rs373679264 525 dbSNP
rs1332966963 527 dbSNP
rs1173884137 531 dbSNP
rs973492841 539 dbSNP
rs921678424 540 dbSNP
rs1469850170 541 dbSNP
rs139325045 543 dbSNP
rs1268351640 544 dbSNP
rs752499278 544 dbSNP
rs1194523583 556 dbSNP
rs1244139751 556 dbSNP
rs911765148 577 dbSNP
rs1282753009 581 dbSNP
rs565893160 582 dbSNP
rs935234961 583 dbSNP
rs1205703585 585 dbSNP
rs982548643 597 dbSNP
rs1052388235 599 dbSNP
rs1299617151 600 dbSNP
rs893784785 606 dbSNP
rs1342153059 607 dbSNP
rs756009658 610 dbSNP
rs539923906 617 dbSNP
rs777704153 623 dbSNP
rs938070892 633 dbSNP
rs1045488779 639 dbSNP
rs989582196 640 dbSNP
rs1469899442 642 dbSNP
rs905235102 650 dbSNP
rs757968642 651 dbSNP
rs1466802541 652 dbSNP
rs1290070706 658 dbSNP
rs557941224 659 dbSNP
rs1169935984 660 dbSNP
rs1475278227 661 dbSNP
rs1452837264 667 dbSNP
rs1035143015 670 dbSNP
rs947237538 675 dbSNP
rs1242547212 680 dbSNP
rs1242066804 694 dbSNP
rs887315273 694 dbSNP
rs532516327 699 dbSNP
rs1041655186 701 dbSNP
rs1017158993 704 dbSNP
rs943706517 705 dbSNP
rs1213821409 707 dbSNP
rs1337162772 711 dbSNP
rs1317108302 712 dbSNP
rs1453214284 713 dbSNP
rs1381412039 719 dbSNP
rs963309841 720 dbSNP
rs1383849273 727 dbSNP
rs1354801495 732 dbSNP
rs1444386070 736 dbSNP
rs550640944 737 dbSNP
rs112373377 738 dbSNP
rs11715 744 dbSNP
rs1399061023 755 dbSNP
rs1041083058 757 dbSNP
rs899517976 759 dbSNP
rs1317671111 765 dbSNP
rs1345842008 768 dbSNP
rs1435781973 771 dbSNP
rs996964795 773 dbSNP
rs1435881912 779 dbSNP
rs35277011 783 dbSNP
rs760314036 783 dbSNP
rs1048164609 787 dbSNP
rs1246433521 796 dbSNP
rs1312802543 800 dbSNP
rs1358716493 800 dbSNP
rs1373374900 802 dbSNP
rs568947507 802 dbSNP
rs1278612851 803 dbSNP
rs1305405650 803 dbSNP
rs3839712 803 dbSNP
rs397841510 803 dbSNP
rs953103287 803 dbSNP
rs3801046 804 dbSNP
rs1365556012 813 dbSNP
rs1162183940 817 dbSNP
rs1408740224 818 dbSNP
rs987260555 818 dbSNP
rs1244883279 819 dbSNP
rs1284454448 820 dbSNP
rs1357961814 821 dbSNP
rs1221693735 822 dbSNP
rs911711320 829 dbSNP
rs935182471 830 dbSNP
rs1464953043 837 dbSNP
rs1289541633 845 dbSNP
rs1217798203 846 dbSNP
rs1316998765 847 dbSNP
rs970924984 849 dbSNP
rs555667876 850 dbSNP
rs1221565172 852 dbSNP
rs988391784 853 dbSNP
rs1211186237 856 dbSNP
rs1003817184 860 dbSNP
rs915137470 862 dbSNP
rs959409280 869 dbSNP
rs946626693 877 dbSNP
rs915368941 878 dbSNP
rs1045036898 884 dbSNP
rs778930607 890 dbSNP
rs905235842 893 dbSNP
rs1158549710 894 dbSNP
rs939435050 895 dbSNP
rs1056496215 896 dbSNP
rs1468844255 897 dbSNP
rs1479999724 901 dbSNP
rs746140691 902 dbSNP
rs530052739 903 dbSNP
rs1408896499 904 dbSNP
rs775868036 907 dbSNP
rs1213090023 910 dbSNP
rs548262729 911 dbSNP
rs997544328 912 dbSNP
rs1028657581 914 dbSNP
rs953049492 917 dbSNP
rs1451672324 934 dbSNP
rs1334625924 935 dbSNP
rs987208050 936 dbSNP
rs560104125 940 dbSNP
rs1288768089 943 dbSNP
rs1433026741 944 dbSNP
rs956460021 945 dbSNP
rs1177434815 946 dbSNP
rs1469420461 947 dbSNP
rs1048112790 952 dbSNP
rs1428868365 953 dbSNP
rs1260997347 954 dbSNP
rs1184662107 958 dbSNP
rs888223993 959 dbSNP
rs1202480281 961 dbSNP
rs987950351 964 dbSNP
rs1003930543 968 dbSNP
rs1230127510 969 dbSNP
rs1308406801 971 dbSNP
rs1329251203 979 dbSNP
rs769057872 980 dbSNP
rs1385089499 987 dbSNP
rs1229629082 988 dbSNP
rs1451986005 992 dbSNP
rs1400390933 993 dbSNP
rs1037137542 994 dbSNP
rs1372235283 997 dbSNP
rs777253656 1004 dbSNP
rs1323392851 1007 dbSNP
rs906704013 1009 dbSNP
rs1004169724 1015 dbSNP
rs567161678 1023 dbSNP
rs959634607 1028 dbSNP
rs1258754054 1032 dbSNP
rs981135448 1033 dbSNP
rs1436431597 1040 dbSNP
rs926606409 1050 dbSNP
rs527239791 1054 dbSNP
rs1251042707 1055 dbSNP
rs1181436487 1060 dbSNP
rs1252723258 1064 dbSNP
rs748262830 1065 dbSNP
rs1473629400 1066 dbSNP
rs1022376250 1068 dbSNP
rs1338729436 1074 dbSNP
rs1309443596 1076 dbSNP
rs200703884 1076 dbSNP
rs201154014 1078 dbSNP
rs10596549 1079 dbSNP
rs1396039325 1079 dbSNP
rs72155545 1079 dbSNP
rs773637036 1079 dbSNP
rs143381602 1081 dbSNP
rs76139401 1084 dbSNP
rs867901584 1093 dbSNP
rs1162810204 1100 dbSNP
rs1404155118 1109 dbSNP
rs1471535641 1114 dbSNP
rs1389401488 1117 dbSNP
rs965272819 1118 dbSNP
rs1327314139 1120 dbSNP
rs1249141329 1127 dbSNP
rs1203507042 1133 dbSNP
rs1490933346 1135 dbSNP
rs765961343 1136 dbSNP
rs940108957 1148 dbSNP
rs751064070 1168 dbSNP
rs1262639489 1169 dbSNP
rs977069878 1172 dbSNP
rs1406580239 1174 dbSNP
rs1350685398 1178 dbSNP
rs898701106 1201 dbSNP
rs116669559 1203 dbSNP
rs1302484666 1213 dbSNP
rs1452398282 1219 dbSNP
rs932295308 1219 dbSNP
rs1409359518 1220 dbSNP
rs59771917 1221 dbSNP
rs1481632629 1222 dbSNP
rs891399019 1227 dbSNP
rs1344290736 1229 dbSNP
rs191048788 1239 dbSNP
rs1018623113 1240 dbSNP
rs1337855874 1245 dbSNP
rs1264451299 1246 dbSNP
rs1205836308 1247 dbSNP
rs1195548142 1250 dbSNP
rs1328529161 1260 dbSNP
rs1266496745 1263 dbSNP
rs939733902 1271 dbSNP
rs1324000468 1272 dbSNP
rs1036748544 1278 dbSNP
rs906686506 1280 dbSNP
rs1484186277 1284 dbSNP
rs1197496493 1286 dbSNP
rs1328176673 1286 dbSNP
rs767212671 1291 dbSNP
rs1268352685 1292 dbSNP
rs568413369 1294 dbSNP
rs939575020 1300 dbSNP
rs1055767659 1301 dbSNP
rs1379230443 1308 dbSNP
rs1460304254 1309 dbSNP
rs956446284 1315 dbSNP
rs1009762650 1316 dbSNP
rs1022126463 1318 dbSNP
rs1011177674 1323 dbSNP
rs1371019374 1324 dbSNP
rs1022283041 1329 dbSNP
rs141600086 1344 dbSNP
rs547664520 1345 dbSNP
rs1278156870 1346 dbSNP
rs926511526 1351 dbSNP
rs960616572 1352 dbSNP
rs1270716921 1357 dbSNP
rs1019066080 1360 dbSNP
rs965566633 1361 dbSNP
rs1304085361 1363 dbSNP
rs566867960 1368 dbSNP
rs908584233 1369 dbSNP
rs1452704877 1371 dbSNP
rs1331744921 1372 dbSNP
rs1404951875 1372 dbSNP
rs1413146446 1378 dbSNP
rs566084769 1386 dbSNP
rs539413305 1387 dbSNP
rs953962780 1391 dbSNP
rs920094960 1392 dbSNP
rs909517916 1393 dbSNP
rs1185551691 1394 dbSNP
rs1445278081 1398 dbSNP
rs1237146638 1400 dbSNP
rs1344750386 1403 dbSNP
rs150821649 1404 dbSNP
rs1439354969 1405 dbSNP
rs1273534994 1406 dbSNP
rs1340032910 1414 dbSNP
rs939723980 1414 dbSNP
rs755991022 1415 dbSNP
rs534026457 1420 dbSNP
rs891343475 1421 dbSNP
rs555485804 1422 dbSNP
rs1377749258 1426 dbSNP
rs777422819 1427 dbSNP
rs570029341 1428 dbSNP
rs139258149 1429 dbSNP
rs753850466 1430 dbSNP
rs1330037330 1431 dbSNP
rs972454110 1432 dbSNP
rs1429487457 1442 dbSNP
rs371037715 1448 dbSNP
rs149997871 1449 dbSNP
rs1269403660 1453 dbSNP
rs895324581 1455 dbSNP
rs1022491473 1458 dbSNP
rs757121817 1459 dbSNP
rs1181242089 1460 dbSNP
rs182333143 1466 dbSNP
rs902510261 1469 dbSNP
rs999548828 1470 dbSNP
rs1019432498 1473 dbSNP
rs571203380 1477 dbSNP
rs1373668440 1481 dbSNP
rs1033483206 1483 dbSNP
rs1457986475 1487 dbSNP
rs185127351 1488 dbSNP
rs572023575 1492 dbSNP
rs545469779 1497 dbSNP
rs571032819 1498 dbSNP
rs1402494921 1500 dbSNP
rs983995467 1501 dbSNP
rs1158644608 1503 dbSNP
rs1471495774 1504 dbSNP
rs908533926 1506 dbSNP
rs1199878414 1512 dbSNP
rs961707482 1520 dbSNP
rs774969979 1522 dbSNP
rs1314669883 1529 dbSNP
rs146098862 1532 dbSNP
rs1267121860 1541 dbSNP
rs1247233697 1542 dbSNP
rs1327531458 1547 dbSNP
rs972455005 1564 dbSNP
rs1285652486 1565 dbSNP
rs1367570877 1566 dbSNP
rs537972275 1566 dbSNP
rs1259082419 1568 dbSNP
rs556308179 1569 dbSNP
rs1433006968 1575 dbSNP
rs990981543 1576 dbSNP
rs1208096675 1581 dbSNP
rs1320148850 1583 dbSNP
rs1455909357 1596 dbSNP
rs12472 1600 dbSNP
rs1176950835 1601 dbSNP
rs541812545 1604 dbSNP
rs946903916 1606 dbSNP
rs1043980287 1607 dbSNP
rs912766763 1612 dbSNP
rs1246802610 1616 dbSNP
rs944267311 1617 dbSNP
rs1412768015 1619 dbSNP
rs1206276180 1620 dbSNP
rs1462417349 1623 dbSNP
rs1053388624 1626 dbSNP
rs1259159019 1627 dbSNP
rs561865504 1629 dbSNP
rs529068638 1631 dbSNP
rs547682252 1632 dbSNP
rs901842873 1638 dbSNP
rs1432960396 1641 dbSNP
rs1408624305 1642 dbSNP
rs559368626 1643 dbSNP
rs1043416250 1647 dbSNP
rs769133083 1649 dbSNP
rs1050978594 1653 dbSNP
rs753115285 1661 dbSNP
rs1361618835 1663 dbSNP
rs889613613 1673 dbSNP
rs1456194358 1674 dbSNP
rs533390918 1675 dbSNP
rs377737191 1676 dbSNP
rs1391421443 1678 dbSNP
rs1005365107 1682 dbSNP
rs1033471781 1683 dbSNP
rs1199470234 1684 dbSNP
rs1016794772 1685 dbSNP
rs961250105 1688 dbSNP
rs10242373 1689 dbSNP
rs1226315081 1690 dbSNP
rs569854802 1695 dbSNP
rs537157352 1698 dbSNP
rs549020029 1699 dbSNP
rs1395598689 1703 dbSNP
rs961338632 1704 dbSNP
rs770383658 1705 dbSNP
rs1380312502 1707 dbSNP
rs1299725180 1709 dbSNP
rs1430133459 1709 dbSNP
rs1369910749 1710 dbSNP
rs1166588422 1715 dbSNP
rs974440025 1722 dbSNP
rs1186224479 1728 dbSNP
rs990570194 1728 dbSNP
rs567543144 1730 dbSNP
rs1316430930 1731 dbSNP
rs139901842 1734 dbSNP
rs1179358076 1737 dbSNP
rs1483562005 1739 dbSNP
rs916376634 1741 dbSNP
rs1026993682 1746 dbSNP
rs979563736 1747 dbSNP
rs1331197332 1748 dbSNP
rs1309374458 1752 dbSNP
rs1201651068 1757 dbSNP
rs954100463 1758 dbSNP
rs924110840 1761 dbSNP
rs935547074 1762 dbSNP
rs10245417 1769 dbSNP
rs923284171 1771 dbSNP
rs912716045 1778 dbSNP
rs1391352741 1781 dbSNP
rs1483445761 1785 dbSNP
rs1183250486 1790 dbSNP
rs931999701 1790 dbSNP
rs1159374936 1791 dbSNP
rs578172853 1791 dbSNP
rs887896476 1791 dbSNP
rs988991372 1792 dbSNP
rs1251461566 1793 dbSNP
rs35935303 1797 dbSNP
rs761109413 1797 dbSNP
rs913450427 1797 dbSNP
rs1209354211 1798 dbSNP
rs897010630 1799 dbSNP
rs947672203 1801 dbSNP
rs1262729361 1802 dbSNP
rs994068458 1802 dbSNP
rs1043777757 1803 dbSNP
rs539469703 1804 dbSNP
rs1413504811 1805 dbSNP
rs903557914 1807 dbSNP
rs1468740037 1810 dbSNP
rs759058839 1810 dbSNP
rs937744317 1814 dbSNP
rs557460240 1815 dbSNP
rs576068734 1818 dbSNP
rs191215673 1819 dbSNP
rs143363128 1820 dbSNP
rs1409294310 1822 dbSNP
rs573913148 1828 dbSNP
rs1015431733 1833 dbSNP
rs1350065025 1841 dbSNP
rs1157464653 1845 dbSNP
rs1479190354 1846 dbSNP
rs1410638160 1849 dbSNP
rs897028269 1852 dbSNP
rs1290332593 1856 dbSNP
rs34932489 1863 dbSNP
rs146734842 1873 dbSNP
rs757880332 1875 dbSNP
rs1250058312 1876 dbSNP
rs967753178 1877 dbSNP
rs1464656475 1879 dbSNP
rs995469579 1881 dbSNP
rs1027395763 1885 dbSNP
rs1217474308 1887 dbSNP
rs1266442457 1887 dbSNP
rs1220767139 1888 dbSNP
rs1345390470 1898 dbSNP
rs1323712745 1900 dbSNP
rs1277749967 1902 dbSNP
rs954048264 1913 dbSNP
rs1297765385 1914 dbSNP
rs1433682232 1917 dbSNP
rs1386046649 1920 dbSNP
rs1338242369 1925 dbSNP
rs1416532905 1926 dbSNP
rs1031147885 1927 dbSNP
rs957121872 1928 dbSNP
rs985529202 1930 dbSNP
rs1189344885 1932 dbSNP
rs1448900566 1949 dbSNP
rs923558772 1949 dbSNP
rs1019680949 1951 dbSNP
rs1442790734 1952 dbSNP
rs1182421871 1956 dbSNP
rs965470089 1957 dbSNP
rs1344290630 1958 dbSNP
rs559645274 1961 dbSNP
rs909218915 1964 dbSNP
rs989344249 1970 dbSNP
rs1479166558 1971 dbSNP
rs779578473 1976 dbSNP
rs1448386873 1981 dbSNP
rs942094743 1985 dbSNP
rs1036417369 1992 dbSNP
rs1413094473 1995 dbSNP
rs533066716 2003 dbSNP
rs896978086 2004 dbSNP
rs929820574 2005 dbSNP
rs759137207 2010 dbSNP
rs551610538 2011 dbSNP
rs571534084 2013 dbSNP
rs1370319541 2014 dbSNP
rs530786898 2021 dbSNP
rs183334709 2022 dbSNP
rs763996225 2023 dbSNP
rs1339970471 2025 dbSNP
rs937652483 2025 dbSNP
rs1363798451 2027 dbSNP
rs1228376099 2036 dbSNP
rs1023283807 2040 dbSNP
rs1282026963 2041 dbSNP
rs374531601 2044 dbSNP
rs567406622 2045 dbSNP
rs753529926 2053 dbSNP
rs1309175876 2054 dbSNP
rs949145060 2056 dbSNP
rs535250319 2057 dbSNP
rs897022972 2060 dbSNP
rs56335325 2061 dbSNP
rs1048334867 2064 dbSNP
rs889720654 2074 dbSNP
rs1006870863 2075 dbSNP
rs1252356312 2076 dbSNP
rs571950089 2079 dbSNP
rs1181172850 2083 dbSNP
rs538975564 2085 dbSNP
rs1030507005 2087 dbSNP
rs1276247235 2089 dbSNP
rs557656955 2093 dbSNP
rs1450492178 2096 dbSNP
rs10274416 2097 dbSNP
rs965445550 2107 dbSNP
rs1010360820 2116 dbSNP
rs1020853459 2117 dbSNP
rs968942892 2120 dbSNP
rs537026473 2121 dbSNP
rs35919409 2123 dbSNP
rs919372867 2124 dbSNP
rs188510003 2125 dbSNP
rs1371860128 2129 dbSNP
rs927528339 2132 dbSNP
rs573775967 2133 dbSNP
rs1185278225 2134 dbSNP
rs1390021719 2136 dbSNP
rs958951952 2138 dbSNP
rs1450409908 2141 dbSNP
rs1170732416 2143 dbSNP
rs1383569067 2146 dbSNP
rs1404872266 2148 dbSNP
rs1324328407 2150 dbSNP
rs1459075243 2150 dbSNP
rs750519206 2153 dbSNP
rs1158204300 2158 dbSNP
rs1471467220 2160 dbSNP
rs917615218 2175 dbSNP
rs369043594 2178 dbSNP
rs1477409527 2185 dbSNP
rs1244540007 2187 dbSNP
rs1210037683 2193 dbSNP
rs1465105254 2195 dbSNP
rs541260842 2198 dbSNP
rs559291516 2206 dbSNP
rs1208530916 2211 dbSNP
rs116269892 2213 dbSNP
rs544997464 2214 dbSNP
rs747297630 2221 dbSNP
rs1364196203 2226 dbSNP
rs1228790205 2229 dbSNP
rs1437330118 2230 dbSNP
rs553481987 2240 dbSNP
rs6948459 2242 dbSNP
rs1227349184 2243 dbSNP
rs1451378974 2245 dbSNP
rs530847436 2251 dbSNP
rs781642879 2269 dbSNP
rs1422943936 2270 dbSNP
rs1207396791 2271 dbSNP
rs1449500430 2275 dbSNP
rs1247054238 2277 dbSNP
rs1247890668 2277 dbSNP
rs1484027328 2278 dbSNP
rs1041065251 2281 dbSNP
rs542590582 2283 dbSNP
rs1211235563 2290 dbSNP
rs748393748 2291 dbSNP
rs1312164217 2304 dbSNP
rs561096181 2305 dbSNP
rs1230737322 2307 dbSNP
rs1365952531 2309 dbSNP
rs1297151557 2311 dbSNP
rs528571053 2321 dbSNP
rs1381595861 2323 dbSNP
rs547031788 2324 dbSNP
rs544689290 2328 dbSNP
rs1373591300 2330 dbSNP
rs571752827 2331 dbSNP
rs1010723884 2336 dbSNP
rs1429842600 2341 dbSNP
rs1020340097 2342 dbSNP
rs953583958 2346 dbSNP
rs6949942 2350 dbSNP
rs1156871810 2351 dbSNP
rs1387749993 2361 dbSNP
rs551328678 2363 dbSNP
rs1435578137 2367 dbSNP
rs1322340353 2370 dbSNP
rs569546830 2371 dbSNP
rs1034489567 2372 dbSNP
rs963343164 2375 dbSNP
rs958937466 2376 dbSNP
rs771744946 2379 dbSNP
rs993077118 2388 dbSNP
rs919269287 2392 dbSNP
rs1284358714 2393 dbSNP
rs537088062 2394 dbSNP
rs970446339 2404 dbSNP
rs555392155 2405 dbSNP
rs1165694709 2415 dbSNP
rs1458959529 2416 dbSNP
rs774838347 2418 dbSNP
rs918318020 2420 dbSNP
rs567212972 2421 dbSNP
rs193063134 2424 dbSNP
rs371690970 2425 dbSNP
rs760400583 2434 dbSNP
rs983921340 2440 dbSNP
rs553004039 2445 dbSNP
rs925224462 2450 dbSNP
rs1483693956 2457 dbSNP
rs1442202580 2461 dbSNP
rs577778834 2466 dbSNP
rs942575758 2467 dbSNP
rs1194178450 2468 dbSNP
rs936580135 2474 dbSNP
rs1188511452 2475 dbSNP
rs1266274406 2479 dbSNP
rs763616552 2481 dbSNP
rs545174494 2482 dbSNP
rs1468684819 2485 dbSNP
rs1228746312 2488 dbSNP
rs1349830119 2489 dbSNP
rs1326716353 2495 dbSNP
rs1388027490 2496 dbSNP
rs1134995 2497 dbSNP
rs1292433478 2498 dbSNP
rs946047264 2505 dbSNP
rs761542746 2507 dbSNP
rs1166919614 2508 dbSNP
rs575180285 2509 dbSNP
rs1390351499 2528 dbSNP
rs1161874620 2534 dbSNP
rs1051549923 2537 dbSNP
rs889263366 2541 dbSNP
rs1161282777 2542 dbSNP
rs7904 2544 dbSNP
rs1413642984 2545 dbSNP
rs1016460979 2546 dbSNP
rs560957921 2547 dbSNP
rs1434986425 2550 dbSNP
rs528442708 2551 dbSNP
rs200684659 2552 dbSNP
rs1034476246 2555 dbSNP
rs1407582525 2558 dbSNP
rs770972183 2563 dbSNP
rs963561310 2567 dbSNP
rs993731053 2568 dbSNP
rs1026705989 2575 dbSNP
rs1235422220 2580 dbSNP
rs566746852 2580 dbSNP
rs1331600668 2581 dbSNP
rs993304403 2583 dbSNP
rs1230842647 2588 dbSNP
rs916037456 2592 dbSNP
rs1014444485 2595 dbSNP
rs1254703125 2600 dbSNP
rs1390419484 2602 dbSNP
rs1320749296 2604 dbSNP
rs528014646 2607 dbSNP
rs1458106683 2608 dbSNP
rs1384616451 2610 dbSNP
rs1344764710 2615 dbSNP
rs1157187499 2616 dbSNP
rs1024481910 2621 dbSNP
rs1468081420 2623 dbSNP
rs962626465 2626 dbSNP
rs1193122259 2634 dbSNP
rs980566911 2636 dbSNP
rs1250151463 2637 dbSNP
rs972386844 2646 dbSNP
rs1025739069 2647 dbSNP
rs1281966160 2648 dbSNP
rs1201937290 2651 dbSNP
rs1482217432 2655 dbSNP
rs925109927 2672 dbSNP
rs1231464634 2675 dbSNP
rs936549351 2677 dbSNP
rs148902391 2686 dbSNP
rs983895462 2688 dbSNP
rs565362645 2689 dbSNP
rs376765091 2690 dbSNP
rs942482945 2691 dbSNP
rs983507652 2694 dbSNP
rs888897200 2696 dbSNP
rs1477593500 2697 dbSNP
rs114937162 2698 dbSNP
rs922506631 2699 dbSNP
rs1189394476 2700 dbSNP
rs1442737193 2704 dbSNP
rs1256731392 2708 dbSNP
rs945963566 2725 dbSNP
rs1041713372 2726 dbSNP
rs73328775 2727 dbSNP
rs1337077154 2739 dbSNP
rs369325559 2740 dbSNP
rs183313276 2741 dbSNP
rs548852201 2747 dbSNP
rs188315573 2752 dbSNP
rs534578423 2753 dbSNP
rs1234560668 2755 dbSNP
rs1014351300 2763 dbSNP
rs1277019757 2764 dbSNP
rs1340457049 2773 dbSNP
rs1227954147 2786 dbSNP
rs1024429667 2788 dbSNP
rs898042756 2790 dbSNP
rs1473005414 2794 dbSNP
rs552827604 2794 dbSNP
rs994189314 2797 dbSNP
rs1025291697 2799 dbSNP
rs1014291408 2807 dbSNP
rs571298950 2808 dbSNP
rs1199474589 2809 dbSNP
rs970091458 2814 dbSNP
rs1333693045 2816 dbSNP
rs1293115929 2817 dbSNP
rs1032147648 2819 dbSNP
rs1352894093 2821 dbSNP
rs1280594142 2827 dbSNP
rs1167586233 2830 dbSNP
rs112818248 2831 dbSNP
rs866143693 2835 dbSNP
rs556731282 2838 dbSNP
rs1325600982 2840 dbSNP
rs1406230667 2843 dbSNP
rs1393992169 2844 dbSNP
rs575058266 2845 dbSNP
rs150921096 2846 dbSNP
rs1473422846 2852 dbSNP
rs554822423 2855 dbSNP
rs1463095414 2857 dbSNP
rs976550043 2861 dbSNP
rs922463722 2862 dbSNP
rs932971382 2863 dbSNP
rs1389355267 2865 dbSNP
rs191505270 2873 dbSNP
rs778122833 2877 dbSNP
rs977763593 2884 dbSNP
rs13244634 2887 dbSNP
rs538463100 2889 dbSNP
rs766672075 2889 dbSNP
rs1308342604 2891 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase, repB PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUAC---ACGACGAu 5'
             |:: | ||:||   ||||||| 
Target 5' cagAGGACUUUGUGCAUUGCUGCUa 3'
5 - 29
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000288828.4 | 3UTR | UUCACAGAGGACUUUGUGCAUUGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000288828.4 | 3UTR | UCACAGAGGACUUUGUGCAUUGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.74 2.7e-5 -0.631 6.2e-4 23 Click to see details
GSE38226 Liver fibrosis 0.564 3.9e-3 0.522 7.6e-3 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.421 1.8e-2 0.264 1.0e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.358 4.3e-2 -0.339 5.3e-2 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.374 5.2e-2 -0.409 3.7e-2 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.305 6.9e-2 -0.408 2.1e-2 25 Click to see details
GSE28260 Renal cortex and medulla -0.429 7.2e-2 -0.495 4.3e-2 13 Click to see details
GSE21687 Ependynoma primary tumors -0.176 8.2e-2 -0.244 2.6e-2 64 Click to see details
GSE17306 Multiple myeloma 0.2 8.4e-2 0.220 6.4e-2 49 Click to see details
GSE17498 Multiple myeloma 0.202 1.1e-1 0.336 1.7e-2 40 Click to see details
GSE19783 ER- ER- breast cancer -0.115 1.6e-1 -0.056 3.1e-1 79 Click to see details
GSE19536 Breast cancer -0.082 2.1e-1 -0.068 2.5e-1 100 Click to see details
GSE21849 B cell lymphoma 0.128 2.5e-1 0.233 1.1e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.171 2.6e-1 -0.062 4.1e-1 16 Click to see details
GSE28544 Breast cancer -0.117 2.9e-1 -0.362 4.1e-2 24 Click to see details
GSE14794 Lymphoblastoid cells -0.045 3.4e-1 -0.052 3.1e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.048 4.0e-1 -0.105 2.8e-1 32 Click to see details
GSE21032 Prostate cancer -0.026 4.1e-1 -0.043 3.5e-1 83 Click to see details
GSE19350 CNS germ cell tumors 0.019 4.8e-1 -0.063 4.2e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.006 4.9e-1 -0.047 4.2e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.006 4.9e-1 -0.047 4.2e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.252 0.03 -0.057 0.33 59 Click to see details
COAD 0.647 0.04 0.381 0.18 8 Click to see details
KIRP 0.28 0.06 0.121 0.25 32 Click to see details
LUSC -0.246 0.07 -0.251 0.06 38 Click to see details
UCEC -0.329 0.08 -0.342 0.08 19 Click to see details
CESC -0.959 0.09 -1.000 0.5 3 Click to see details
PAAD -0.809 0.1 -0.800 0.1 4 Click to see details
CHOL 0.381 0.16 0.633 0.03 9 Click to see details
BLCA -0.208 0.2 -0.247 0.16 18 Click to see details
ESCA -0.262 0.22 -0.464 0.08 11 Click to see details
KIRC -0.091 0.23 -0.155 0.1 68 Click to see details
STAD -0.122 0.25 -0.098 0.3 32 Click to see details
BRCA -0.041 0.36 -0.017 0.44 84 Click to see details
KICH 0.074 0.36 0.047 0.41 25 Click to see details
PRAD 0.049 0.37 0.116 0.21 50 Click to see details
HNSC 0.032 0.42 0.079 0.31 42 Click to see details
LIHC 0.025 0.43 -0.022 0.44 49 Click to see details
LUAD -0.047 0.44 -0.084 0.4 12 Click to see details
PCPG 1 0.5 1.000 0.5 3 Click to see details
PCPG 1 0.5 1.000 0.5 3 Click to see details
PCPG 1 0.5 1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B