miRTarBase - #MIRT267527 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C1orf226   
Synonyms -
Description chromosome 1 open reading frame 226
Transcript NM_001085375   
Other Transcripts NM_001135240   
Putative miRNA Targets on C1orf226
3'UTR of C1orf226
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guguuUGGUAAUA----CACGACGAu 5'
               :|| ||:|     ||||||| 
23 - 48 147.00 -10.50
miRNA  3' guguuugguaaUAC-ACGACGAu 5'
                     ||| ||||||| 
Target 5' ctgctgcagggATGTTGCTGCTa 3'
2416 - 2438 147.00 -14.10
            ||  |:||     |  ||||||| 
2230 - 2255 142.00 -14.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30171808 81 COSMIC
COSN22604519 277 COSMIC
COSN6005527 577 COSMIC
COSN22388001 670 COSMIC
COSN31589664 726 COSMIC
COSN20095508 730 COSMIC
COSN31579649 738 COSMIC
COSN28753185 745 COSMIC
COSN31538176 819 COSMIC
COSN31597447 902 COSMIC
COSN5356183 942 COSMIC
COSN14550329 1008 COSMIC
COSN26645499 1224 COSMIC
COSN28702663 1331 COSMIC
COSN30543077 1341 COSMIC
COSN31548364 1367 COSMIC
COSN25500490 1453 COSMIC
COSN31482182 1454 COSMIC
COSN7181095 1594 COSMIC
COSN20706783 1675 COSMIC
COSN15147474 1795 COSMIC
COSN8646313 1812 COSMIC
COSN28162813 2506 COSMIC
COSN4744296 2522 COSMIC
COSN21553412 2886 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs200770870 2 dbSNP
rs370587346 3 dbSNP
rs536148325 5 dbSNP
rs1218029576 9 dbSNP
rs1347204775 10 dbSNP
rs368799518 12 dbSNP
rs1196800630 20 dbSNP
rs1331970400 22 dbSNP
rs748573065 23 dbSNP
rs1255171294 30 dbSNP
rs1224033726 31 dbSNP
rs1285887017 32 dbSNP
rs751729454 35 dbSNP
rs1295137012 40 dbSNP
rs1380257828 41 dbSNP
rs769982973 42 dbSNP
rs1257538767 44 dbSNP
rs778099497 46 dbSNP
rs1180643514 47 dbSNP
rs749504474 48 dbSNP
rs1342171477 56 dbSNP
rs1296185682 59 dbSNP
rs964913027 62 dbSNP
rs562005793 63 dbSNP
rs1373078555 64 dbSNP
rs544066155 69 dbSNP
rs956169144 76 dbSNP
rs989182003 77 dbSNP
rs1218944918 82 dbSNP
rs1167904866 83 dbSNP
rs1427070218 85 dbSNP
rs140889968 87 dbSNP
rs1292331884 88 dbSNP
rs930873016 91 dbSNP
rs1246415383 94 dbSNP
rs1345827725 104 dbSNP
rs1250926057 108 dbSNP
rs1225567156 109 dbSNP
rs1319706774 118 dbSNP
rs1278665972 119 dbSNP
rs1232595310 120 dbSNP
rs1353412472 121 dbSNP
rs985080064 126 dbSNP
rs1396055855 128 dbSNP
rs908127504 129 dbSNP
rs1296062533 134 dbSNP
rs946628815 135 dbSNP
rs1171916137 136 dbSNP
rs1475089926 140 dbSNP
rs1416258695 144 dbSNP
rs1190254072 148 dbSNP
rs979357076 148 dbSNP
rs926441019 153 dbSNP
rs937875284 155 dbSNP
rs1216508576 156 dbSNP
rs1261579804 168 dbSNP
rs1194281551 184 dbSNP
rs896537087 190 dbSNP
rs187915409 197 dbSNP
rs896199963 198 dbSNP
rs1332441623 203 dbSNP
rs866364866 213 dbSNP
rs1422260122 214 dbSNP
rs192969947 223 dbSNP
rs767669655 224 dbSNP
rs1047814138 234 dbSNP
rs164417 254 dbSNP
rs1461209839 255 dbSNP
rs1156781051 266 dbSNP
rs1389066734 274 dbSNP
rs144319750 275 dbSNP
rs1473444116 276 dbSNP
rs576017246 277 dbSNP
rs1363293416 279 dbSNP
rs1176779987 283 dbSNP
rs1441638506 285 dbSNP
rs1017892545 286 dbSNP
rs900657937 292 dbSNP
rs1312027275 293 dbSNP
rs1466946014 299 dbSNP
rs1291824246 300 dbSNP
rs1210349100 302 dbSNP
rs1349953743 308 dbSNP
rs892398775 320 dbSNP
rs1241615254 321 dbSNP
rs562529290 325 dbSNP
rs997662729 330 dbSNP
rs1376571573 334 dbSNP
rs531182310 336 dbSNP
rs756206369 338 dbSNP
rs956286376 345 dbSNP
rs988946361 346 dbSNP
rs1406320932 347 dbSNP
rs1029162110 350 dbSNP
rs1157406446 352 dbSNP
rs952150929 354 dbSNP
rs1315824011 364 dbSNP
rs35262101 364 dbSNP
rs984964256 377 dbSNP
rs1022042001 381 dbSNP
rs548282733 386 dbSNP
rs567778655 387 dbSNP
rs968714627 392 dbSNP
rs534130518 394 dbSNP
rs1356405322 403 dbSNP
rs1446231756 409 dbSNP
rs1260877785 416 dbSNP
rs1217868906 417 dbSNP
rs1255737687 421 dbSNP
rs778418976 428 dbSNP
rs940968432 432 dbSNP
rs926511556 435 dbSNP
rs937947152 436 dbSNP
rs1231617013 439 dbSNP
rs992361366 443 dbSNP
rs1346598126 445 dbSNP
rs1482437870 446 dbSNP
rs1275083117 450 dbSNP
rs547632855 451 dbSNP
rs147386900 452 dbSNP
rs948126252 456 dbSNP
rs1402450133 463 dbSNP
rs540161398 468 dbSNP
rs960124662 469 dbSNP
rs754399994 470 dbSNP
rs1427459509 478 dbSNP
rs1173402915 492 dbSNP
rs1052240896 494 dbSNP
rs1347280734 511 dbSNP
rs892366273 518 dbSNP
rs1488613237 519 dbSNP
rs1256718599 523 dbSNP
rs1207342895 532 dbSNP
rs1443661202 535 dbSNP
rs1278840523 537 dbSNP
rs1213667403 543 dbSNP
rs866446079 552 dbSNP
rs1008174932 556 dbSNP
rs1038739169 562 dbSNP
rs1221001390 571 dbSNP
rs900718467 574 dbSNP
rs1341606472 578 dbSNP
rs1357204109 580 dbSNP
rs556557904 583 dbSNP
rs576397947 588 dbSNP
rs899535744 592 dbSNP
rs996919013 593 dbSNP
rs1030910790 600 dbSNP
rs771593804 601 dbSNP
rs1409662594 608 dbSNP
rs35213453 610 dbSNP
rs892004315 611 dbSNP
rs535440887 616 dbSNP
rs1010718911 619 dbSNP
rs1478032388 634 dbSNP
rs1021694394 638 dbSNP
rs1180075923 642 dbSNP
rs1237598225 645 dbSNP
rs1203358923 652 dbSNP
rs1456221246 654 dbSNP
rs1443960999 671 dbSNP
rs1200852270 673 dbSNP
rs555900168 673 dbSNP
rs952453771 677 dbSNP
rs164418 678 dbSNP
rs1227149168 681 dbSNP
rs1379811458 687 dbSNP
rs1381406602 691 dbSNP
rs1001466080 697 dbSNP
rs1284919094 698 dbSNP
rs541526429 702 dbSNP
rs959247864 703 dbSNP
rs1278429231 717 dbSNP
rs41271971 724 dbSNP
rs576938460 726 dbSNP
rs950601506 727 dbSNP
rs67124370 728 dbSNP
rs67978860 728 dbSNP
rs192333168 732 dbSNP
rs1457468106 740 dbSNP
rs148423327 752 dbSNP
rs908931756 753 dbSNP
rs1458472898 755 dbSNP
rs142535429 758 dbSNP
rs1219992853 760 dbSNP
rs1323955087 763 dbSNP
rs941764931 770 dbSNP
rs531349060 772 dbSNP
rs1440307410 802 dbSNP
rs768210101 807 dbSNP
rs1239452193 808 dbSNP
rs372918849 809 dbSNP
rs201706750 813 dbSNP
rs1311697648 819 dbSNP
rs150928560 820 dbSNP
rs140887351 824 dbSNP
rs1434716473 829 dbSNP
rs1459253140 836 dbSNP
rs527425494 841 dbSNP
rs624579 846 dbSNP
rs1399151775 855 dbSNP
rs547075669 858 dbSNP
rs1417277703 873 dbSNP
rs1052046667 893 dbSNP
rs1463705411 901 dbSNP
rs913769919 909 dbSNP
rs1158854906 914 dbSNP
rs1332869362 915 dbSNP
rs414244 921 dbSNP
rs1453486853 922 dbSNP
rs1400374643 925 dbSNP
rs1435052650 929 dbSNP
rs1189779344 930 dbSNP
rs891947528 943 dbSNP
rs746603103 950 dbSNP
rs1010375718 951 dbSNP
rs149733300 952 dbSNP
rs1351569107 957 dbSNP
rs1288320119 961 dbSNP
rs1302379718 962 dbSNP
rs1317595438 992 dbSNP
rs182458465 994 dbSNP
rs1260177787 998 dbSNP
rs12408509 1008 dbSNP
rs1388246802 1012 dbSNP
rs899754357 1013 dbSNP
rs1220872794 1016 dbSNP
rs866042819 1021 dbSNP
rs1398127204 1024 dbSNP
rs1361885693 1032 dbSNP
rs16861569 1034 dbSNP
rs960104769 1042 dbSNP
rs1375517828 1048 dbSNP
rs164419 1053 dbSNP
rs1435244545 1078 dbSNP
rs1426372067 1079 dbSNP
rs888175997 1080 dbSNP
rs1265980443 1081 dbSNP
rs1015090748 1085 dbSNP
rs962274406 1088 dbSNP
rs1024919241 1090 dbSNP
rs1172389547 1093 dbSNP
rs1235751665 1131 dbSNP
rs1423844832 1131 dbSNP
rs950704475 1138 dbSNP
rs1312535816 1139 dbSNP
rs1277395164 1148 dbSNP
rs1216722602 1152 dbSNP
rs1342227145 1162 dbSNP
rs1298752333 1166 dbSNP
rs1014180296 1168 dbSNP
rs752951784 1174 dbSNP
rs536142743 1175 dbSNP
rs1407292320 1180 dbSNP
rs1439219286 1190 dbSNP
rs769258229 1191 dbSNP
rs1426350171 1192 dbSNP
rs1195074573 1200 dbSNP
rs963118475 1202 dbSNP
rs970064308 1203 dbSNP
rs1254229429 1206 dbSNP
rs1202383873 1240 dbSNP
rs974532391 1241 dbSNP
rs1340315027 1242 dbSNP
rs773070080 1246 dbSNP
rs1483742297 1253 dbSNP
rs1217117844 1256 dbSNP
rs921579836 1262 dbSNP
rs763883899 1267 dbSNP
rs1319769299 1277 dbSNP
rs980722942 1280 dbSNP
rs1244033678 1281 dbSNP
rs1338176005 1282 dbSNP
rs1318808621 1299 dbSNP
rs374733407 1301 dbSNP
rs1399022884 1308 dbSNP
rs958107668 1309 dbSNP
rs1287772647 1318 dbSNP
rs1402960087 1323 dbSNP
rs555836552 1330 dbSNP
rs3738393 1331 dbSNP
rs1366796547 1347 dbSNP
rs943850872 1352 dbSNP
rs1487188398 1355 dbSNP
rs946293362 1357 dbSNP
rs1043171992 1359 dbSNP
rs770670359 1375 dbSNP
rs1237751099 1389 dbSNP
rs535149658 1394 dbSNP
rs1195515784 1395 dbSNP
rs1258527726 1407 dbSNP
rs1209159305 1410 dbSNP
rs1354084926 1411 dbSNP
rs904733485 1417 dbSNP
rs572744056 1418 dbSNP
rs576985349 1419 dbSNP
rs1306591908 1421 dbSNP
rs1448598656 1422 dbSNP
rs1161021433 1432 dbSNP
rs1379560177 1433 dbSNP
rs1330053727 1434 dbSNP
rs1415317792 1449 dbSNP
rs1055827735 1450 dbSNP
rs867783661 1453 dbSNP
rs924832 1454 dbSNP
rs539956274 1456 dbSNP
rs774710757 1466 dbSNP
rs186713921 1467 dbSNP
rs1250711960 1469 dbSNP
rs541712292 1471 dbSNP
rs1197828879 1472 dbSNP
rs561381793 1476 dbSNP
rs1016104874 1480 dbSNP
rs905441954 1485 dbSNP
rs1210400651 1498 dbSNP
rs1327285536 1499 dbSNP
rs1352305534 1507 dbSNP
rs1283334924 1509 dbSNP
rs1241867742 1511 dbSNP
rs963232068 1519 dbSNP
rs370720991 1525 dbSNP
rs1028714680 1528 dbSNP
rs1381446754 1533 dbSNP
rs954635001 1534 dbSNP
rs1326079537 1540 dbSNP
rs1032304824 1544 dbSNP
rs1359972394 1545 dbSNP
rs957993137 1549 dbSNP
rs192340503 1556 dbSNP
rs1285250353 1558 dbSNP
rs912896340 1559 dbSNP
rs1218573202 1562 dbSNP
rs767765463 1570 dbSNP
rs946311824 1571 dbSNP
rs965862370 1576 dbSNP
rs563797076 1595 dbSNP
rs976592190 1600 dbSNP
rs921125418 1616 dbSNP
rs1441549515 1618 dbSNP
rs979021814 1622 dbSNP
rs1343293329 1633 dbSNP
rs1184984249 1638 dbSNP
rs1238783398 1641 dbSNP
rs926103531 1643 dbSNP
rs937537937 1648 dbSNP
rs1472861396 1650 dbSNP
rs556360434 1667 dbSNP
rs775638505 1668 dbSNP
rs984076581 1672 dbSNP
rs1413040576 1675 dbSNP
rs909801731 1680 dbSNP
rs939639245 1683 dbSNP
rs1477382308 1689 dbSNP
rs895876019 1690 dbSNP
rs3820488 1692 dbSNP
rs570221733 1699 dbSNP
rs1475471211 1710 dbSNP
rs760739257 1712 dbSNP
rs764284608 1714 dbSNP
rs1207595334 1719 dbSNP
rs887148853 1724 dbSNP
rs113765339 1725 dbSNP
rs1263362854 1726 dbSNP
rs1204768315 1728 dbSNP
rs371168828 1734 dbSNP
rs1160891301 1741 dbSNP
rs1386113781 1747 dbSNP
rs1004786820 1748 dbSNP
rs895548905 1753 dbSNP
rs1016218284 1757 dbSNP
rs1220948226 1759 dbSNP
rs1332443105 1767 dbSNP
rs74346410 1770 dbSNP
rs184729564 1773 dbSNP
rs1029246887 1774 dbSNP
rs145435418 1777 dbSNP
rs1342545176 1782 dbSNP
rs987659160 1795 dbSNP
rs189515412 1796 dbSNP
rs967039787 1801 dbSNP
rs1032523768 1802 dbSNP
rs894073229 1804 dbSNP
rs1242212783 1806 dbSNP
rs3795644 1809 dbSNP
rs1344043014 1810 dbSNP
rs926177898 1812 dbSNP
rs765886249 1815 dbSNP
rs1021394635 1817 dbSNP
rs937611573 1820 dbSNP
rs192890833 1825 dbSNP
rs917441157 1826 dbSNP
rs556125440 1830 dbSNP
rs1197499755 1841 dbSNP
rs1207248842 1849 dbSNP
rs1289773816 1863 dbSNP
rs1235821731 1866 dbSNP
rs1438447281 1869 dbSNP
rs1316027080 1881 dbSNP
rs1181064850 1882 dbSNP
rs1333200604 1887 dbSNP
rs1442650273 1895 dbSNP
rs1349277800 1897 dbSNP
rs1162562109 1903 dbSNP
rs1364812653 1923 dbSNP
rs758752123 1927 dbSNP
rs1385260717 1932 dbSNP
rs1157688875 1935 dbSNP
rs780895441 1939 dbSNP
rs1477922993 1944 dbSNP
rs941314616 1956 dbSNP
rs576170012 1957 dbSNP
rs899043829 1963 dbSNP
rs1481150517 1965 dbSNP
rs1470423869 1969 dbSNP
rs541751087 1972 dbSNP
rs953819064 1983 dbSNP
rs1398221236 1988 dbSNP
rs555214866 1989 dbSNP
rs1351857038 2003 dbSNP
rs164176 2017 dbSNP
rs75890859 2018 dbSNP
rs1366597260 2022 dbSNP
rs777292667 2023 dbSNP
rs1330403267 2026 dbSNP
rs1038875774 2029 dbSNP
rs1008629531 2030 dbSNP
rs564105663 2032 dbSNP
rs371987924 2033 dbSNP
rs1438449712 2036 dbSNP
rs901574905 2052 dbSNP
rs1020480229 2053 dbSNP
rs967111658 2055 dbSNP
rs999792677 2061 dbSNP
rs1032641453 2063 dbSNP
rs1381830738 2072 dbSNP
rs1230852713 2074 dbSNP
rs3795642 2076 dbSNP
rs1420080627 2077 dbSNP
rs185436495 2086 dbSNP
rs917407283 2103 dbSNP
rs1217616987 2114 dbSNP
rs1270221409 2122 dbSNP
rs1216050997 2125 dbSNP
rs1487333030 2128 dbSNP
rs1255696671 2133 dbSNP
rs927054963 2137 dbSNP
rs1311404710 2150 dbSNP
rs563755517 2152 dbSNP
rs770829892 2154 dbSNP
rs982984133 2159 dbSNP
rs894041953 2160 dbSNP
rs774212058 2164 dbSNP
rs759692390 2165 dbSNP
rs941429432 2170 dbSNP
rs1289106813 2171 dbSNP
rs1197280123 2195 dbSNP
rs148848410 2196 dbSNP
rs56845749 2196 dbSNP
rs1174475488 2201 dbSNP
rs529480607 2202 dbSNP
rs1430664066 2217 dbSNP
rs1193526392 2220 dbSNP
rs1170239416 2221 dbSNP
rs1324137197 2226 dbSNP
rs1028376904 2234 dbSNP
rs745670001 2235 dbSNP
rs921298416 2236 dbSNP
rs1483085239 2237 dbSNP
rs1254468926 2238 dbSNP
rs1421699610 2240 dbSNP
rs1205381189 2242 dbSNP
rs1323947741 2243 dbSNP
rs1257378782 2251 dbSNP
rs1005372307 2261 dbSNP
rs931882837 2265 dbSNP
rs1016806798 2271 dbSNP
rs758897755 2277 dbSNP
rs1394938367 2280 dbSNP
rs1376583189 2290 dbSNP
rs961310757 2308 dbSNP
rs1471179598 2313 dbSNP
rs1407240453 2322 dbSNP
rs1168542090 2324 dbSNP
rs973103293 2329 dbSNP
rs569556331 2331 dbSNP
rs1325350175 2338 dbSNP
rs1345928569 2341 dbSNP
rs566338243 2350 dbSNP
rs971438464 2355 dbSNP
rs367671455 2359 dbSNP
rs1254380777 2366 dbSNP
rs1185608381 2371 dbSNP
rs1275947982 2376 dbSNP
rs927020980 2379 dbSNP
rs532469820 2380 dbSNP
rs1319499323 2385 dbSNP
rs189448849 2410 dbSNP
rs6690715 2411 dbSNP
rs902899894 2415 dbSNP
rs571609475 2425 dbSNP
rs999908829 2426 dbSNP
rs775723378 2439 dbSNP
rs1452839320 2442 dbSNP
rs1042993788 2443 dbSNP
rs1032638483 2444 dbSNP
rs901432033 2450 dbSNP
rs998571458 2454 dbSNP
rs201120828 2456 dbSNP
rs1457494550 2458 dbSNP
rs1193330749 2461 dbSNP
rs1383406712 2464 dbSNP
rs889862374 2465 dbSNP
rs1013157647 2467 dbSNP
rs1430494676 2469 dbSNP
rs1171310215 2472 dbSNP
rs1016777355 2474 dbSNP
rs1024952623 2477 dbSNP
rs1439310302 2483 dbSNP
rs1251200772 2486 dbSNP
rs971691669 2489 dbSNP
rs760830084 2491 dbSNP
rs557405470 2498 dbSNP
rs971356200 2501 dbSNP
rs1352602915 2514 dbSNP
rs569775027 2518 dbSNP
rs908720142 2527 dbSNP
rs1306601446 2532 dbSNP
rs1237382973 2543 dbSNP
rs1337861562 2549 dbSNP
rs1366071407 2552 dbSNP
rs979718452 2580 dbSNP
rs1034003546 2586 dbSNP
rs1418891494 2589 dbSNP
rs1425359220 2596 dbSNP
rs957108280 2602 dbSNP
rs989896798 2604 dbSNP
rs912982601 2609 dbSNP
rs945501469 2616 dbSNP
rs1342060659 2620 dbSNP
rs1198084069 2632 dbSNP
rs535239159 2637 dbSNP
rs373694778 2643 dbSNP
rs962778559 2646 dbSNP
rs1382422322 2654 dbSNP
rs1311495013 2665 dbSNP
rs164177 2668 dbSNP
rs572053874 2677 dbSNP
rs1206474166 2684 dbSNP
rs932672617 2695 dbSNP
rs986830233 2700 dbSNP
rs534595793 2702 dbSNP
rs557502837 2710 dbSNP
rs1344229130 2712 dbSNP
rs1285718168 2714 dbSNP
rs1405663687 2719 dbSNP
rs1294610165 2745 dbSNP
rs1316516331 2747 dbSNP
rs1402601908 2757 dbSNP
rs1385940663 2758 dbSNP
rs1171844543 2770 dbSNP
rs1468016892 2779 dbSNP
rs577541492 2788 dbSNP
rs944642028 2789 dbSNP
rs7536499 2801 dbSNP
rs148076761 2816 dbSNP
rs1239801280 2820 dbSNP
rs1194883938 2825 dbSNP
rs1447284663 2827 dbSNP
rs574292713 2828 dbSNP
rs1200284585 2836 dbSNP
rs1054162620 2841 dbSNP
rs543198073 2843 dbSNP
rs189406 2852 dbSNP
rs1224602221 2853 dbSNP
rs1023978589 2854 dbSNP
rs1268559747 2860 dbSNP
rs1432961827 2867 dbSNP
rs1327296772 2885 dbSNP
rs1333716752 2887 dbSNP
rs1450219122 2894 dbSNP
rs766670997 2895 dbSNP
rs528838762 2901 dbSNP
rs1464973264 2903 dbSNP
rs1417288992 2906 dbSNP
rs1169199945 2910 dbSNP
rs1004504773 2912 dbSNP
rs1236570162 2913 dbSNP
rs1181323480 2918 dbSNP
rs1047798 2920 dbSNP
rs565163643 2922 dbSNP
rs375479821 2926 dbSNP
rs1216442492 2930 dbSNP
rs1340104945 2951 dbSNP
rs1399547971 2955 dbSNP
rs1397315673 2956 dbSNP
rs1450647666 2962 dbSNP
rs1315095023 2977 dbSNP
rs974139814 2985 dbSNP
rs1384273822 2986 dbSNP
rs755728158 2987 dbSNP
rs1352736358 2991 dbSNP
rs994385248 2995 dbSNP
rs1307638935 2996 dbSNP
rs1330767130 2997 dbSNP
rs3738395 2998 dbSNP
rs1216905439 2999 dbSNP
rs1161292516 3007 dbSNP
rs907100170 3008 dbSNP
rs1385459441 3012 dbSNP
rs1184648797 3014 dbSNP
rs1480492533 3014 dbSNP
rs1047802 3015 dbSNP
rs1482386990 3025 dbSNP
rs1205694992 3030 dbSNP
rs1291042265 3039 dbSNP
rs1033973990 3041 dbSNP
rs567704472 3062 dbSNP
rs989781951 3064 dbSNP
rs1223035064 3069 dbSNP
rs1176704946 3070 dbSNP
rs536342628 3072 dbSNP
rs1020424745 3074 dbSNP
rs1281230829 3079 dbSNP
rs1442757674 3080 dbSNP
rs537351953 3093 dbSNP
rs548804878 3094 dbSNP
rs1300809684 3117 dbSNP
rs1425983515 3124 dbSNP
rs1365853409 3125 dbSNP
rs1157631928 3130 dbSNP
rs944611503 3130 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guguuugguaauacacGACGau 5'
Target 5' ----cuuucuccuccaCUGCgc 3'
1 - 18
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000458626.2 | 3UTR | CUUUCUCCUCCACUGCGCACACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer 0.315 2.3e-3 0.314 2.4e-3 79 Click to see details
GSE21687 Ependynoma primary tumors 0.297 8.6e-3 0.301 7.8e-3 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.428 1.6e-2 0.455 1.1e-2 25 Click to see details
GSE19536 Breast cancer 0.181 3.6e-2 0.189 3.0e-2 100 Click to see details
GSE19350 CNS germ cell tumors 0.524 4.0e-2 0.671 8.5e-3 12 Click to see details
GSE21032 Prostate cancer -0.174 5.8e-2 -0.105 1.7e-1 83 Click to see details
GSE14794 Lymphoblastoid cells -0.153 7.5e-2 -0.194 3.3e-2 90 Click to see details
GSE38226 Liver fibrosis 0.292 1.0e-1 0.289 1.0e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.173 1.7e-1 -0.054 3.8e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer -0.148 2.7e-1 0.059 4.0e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.082 3.7e-1 -0.062 4.0e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.063 3.8e-1 0.136 2.6e-1 25 Click to see details
GSE17306 Multiple myeloma 0.025 4.3e-1 0.090 2.7e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.013 4.8e-1 0.003 4.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.013 4.8e-1 0.003 4.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.315 0 -0.301 0 84 Click to see details
KIRP -0.353 0.02 -0.261 0.07 32 Click to see details
KIRC -0.219 0.04 -0.184 0.07 68 Click to see details
PCPG -0.984 0.06 -1.000 0.5 3 Click to see details
COAD 0.514 0.1 0.643 0.04 8 Click to see details
LUSC 0.198 0.12 0.178 0.14 38 Click to see details
HNSC -0.171 0.14 -0.169 0.14 42 Click to see details
PRAD 0.133 0.18 0.168 0.12 50 Click to see details
THCA -0.103 0.22 -0.098 0.23 59 Click to see details
BLCA 0.188 0.23 -0.003 0.5 18 Click to see details
CESC -0.731 0.24 -0.500 0.33 3 Click to see details
KICH -0.121 0.28 -0.162 0.22 25 Click to see details
ESCA -0.177 0.3 -0.082 0.41 11 Click to see details
PAAD -0.38 0.31 0.200 0.4 4 Click to see details
LUAD -0.146 0.33 -0.147 0.32 12 Click to see details
STAD 0.067 0.36 0.092 0.31 32 Click to see details
CHOL -0.109 0.39 0.033 0.47 9 Click to see details
UCEC -0.068 0.39 0.002 0.5 19 Click to see details
LIHC -0.012 0.47 0.088 0.27 49 Click to see details
LIHC -0.012 0.47 0.088 0.27 49 Click to see details
LIHC -0.012 0.47 0.088 0.27 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
Your e-Mail*