miRTarBase - #MIRT277504 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PPP2R5C   
Synonyms B56G, B56gamma, PR61G
Description protein phosphatase 2 regulatory subunit B'gamma
Transcript NM_001161725   
Other Transcripts NM_001161726 , NM_002719 , NM_178586 , NM_178587   
Expression
Putative miRNA Targets on PPP2R5C
3'UTR of PPP2R5C
(miRNA target sites are highlighted)
>PPP2R5C|NM_001161725|3'UTR
   1 CCTCCGGGGCGCCGCGTCGGGGCCGGGCCCGCCAGTTCTTTTCCGGATTCTGTAGAAAATACATACTTCCTGTGCCATAC
  81 CAATCAGTTACACTCAAAGCTTTCTTGGACCCCGTTCCGTAGGCAATAACGTGCGTCCGCCTCAGCGCGAGATTAGGAGT
 161 TCAAACAATGGTGACTTCCCAGAGCCCGCTGGCAGAGCCGCGGGTTGACGACGGTGTCCTCGCAGTGTCGCCGCCACCCC
 241 AGCGTAGTCCAAGTCAGACTATTTCACAAAGTCAGAGCGATAGGAAAGCACCCTGCCCTTCATCTTCATGTTCTCCCAAA
 321 TGGAACTTAGGATCTTTTAACATAGGTGGTTCTGTGATAACATCAGTGTTTTCCAAATCAAAGGAACGCTTTAAAAAATA
 401 GGACCTATTTTTTAAGACTTTACAGCCTTTGAAATGGTTTCCACGTGATTGTTACGCCAGCAGTTCTCGTTTTGTTTGTT
 481 TTTCAATCTCAGTGAAATGGCTCTTTGCTTTCGAGTTCTCACGCAACGTACTGGGCAAATGACAATCCTCAGCCGCTGGT
 561 ATTTTCTAAGGGGTCTCTTCACTTTGATGAGTGACATGAACACCGTGTCTCCTTCTCTTGTGTGTACCTAAAGCCATATT
 641 TCCAAGTCTGTGGTACTCCAGGATTCCAGGAGTAAGCCTGTAGAAGAGATTTATTTTAAAAGAGATTGCTCTGAAATTTA
 721 TCTTAAAAGAGCTTGCTCTGTCTACCTTGACAGAAATTGGAGTTTTAAAATTATGTGTTAATATTTTTATTTGCAGATTT
 801 CGTTTCCGTCAACTTAAACATTGTTGCCCTTCAACAAGGCTCTTGAATTAATAAAATTATAGTCTCTAAGAATTCCACAT
 881 TTTATGGAAAGTTAGAGCAAAATCATTTTGAGTTAAGCCAGTTCTTAGCCTAATGCAAACTGCAGCGCCTTTAAGCATAA
 961 AGTAACACAACAGCATTGCACGGGGCCGGCACTGCCGCTGCCTTCACTGAAGGCTGCAGTGCTGTTCTGAGAGCTTGGAG
1041 GAGGCACCAGCGAGGATGACGTTTAGTGGAGCTCTTTCTGTTGAAAAGAGCTCACGTTATCAACACCTTGTAAGGAAAAT
1121 ACAGTGTCTGAGTTTTCATCGGTCTTCACATGCTGCTATATATTCCACAGAGTTCCTTGCATGTACTGAGCTTTTGTTTT
1201 AGATGGAATAGCACAAGGAGAAAAATCTTTAAACTTAGTGCTTTGTCTATTCTTTATTTCTCTCAGGGTGGCCAGTATTT
1281 TGACTTATTTATCCTGCTTGAAAGCTACTTGAGATGTGTACTGCTATTCTAAACACGTGATCTAGTTTCTTTCATCTCTG
1361 GCATAAGATTATATAACTTAATGTTAAGTGTCTTGAGGCATAAAAGACAAAATGTGGCTTATTTTAGGATCTGTTTTTTC
1441 ATCGAGGTCTCGGGTATCCTTTCAAAGATAGTGAGAAGCAGACACTGCTCCTTGTGCAGCTCTGGTACCTCCTGCCCACT
1521 GCTGTCACTTCAAGCCACTGGCAATGCTTCTGTCCTCGTGTCTTGGAGGAAAATCACCTGGGGGGAGGGGACTTCTTGTG
1601 GTAAGAGCAAGTGCAGGTATGAAATGCGAAGATTGCCCCAGCTAAAAGTGGACAAGTCCGCTTTGTGAGATGAATACTTC
1681 CTGAGAAACTTGACAAGTATCTCTCCATTTTACCATTATGAAAACTATCATTAAAAAAAACAGTTTAGATGCCTTCTCCT
1761 TTTGAGGGAAAAAGGGTGCTTTTTATTGTATAAAGCAGCGTCTTATGTATTTTGATATACCATTGTTTGAACTTCCGTCT
1841 TTAGCTGATAGATTCTCAAATATCCTTGATTTTGGATGTTCAGTATGTTTGTGAGAGAGGTTTCTGGGAAGACTCTCTTT
1921 TTGCCCTCGGGAAAAAGCAAAATATCAATGTTTGGGTGACTGTGTAAAGCTCAGTGTGTAAGAACATCTTTTTGTCTAGG
2001 TTTTCTTTCTGCTCTTTATTGAAGACAAACACTCACCAAAAAGAAAAATAAAAGTTTTCAGAGAAACTAATTTTCTTTGG
2081 CAAGAGTATTACTTAATATTTTGGCCTCCTAAAGTTTCCCTAGTTAGTACTCGGACTCCTGTGCTAATTGTCAGCTTACA
2161 TATCATTGTATAGAGACTGTTTATTCTGTACCAAACTGATTTCAAAAGTACTACATTGAAAATAAACCGGTGACTGTTTT
2241 TCTTCATAAAGTTCTGCGTTTGGCATCTTCACTCTTTCCAAAATGTATCTGTACATCAGAAATGTCACTATTCCAAGTGT
2321 CTTTTTAGTGTGGCTTTAGTATGGCTTCCTTTTAATATTGTACATACATTGTATCTTTGTTTTATGGTAATAAGTAATAA
2401 AAATGTAGACTTCATATTTTGTACAAAATGTCCTATGTACAGAATAAAAAAGTTCATAGAAACAGCAAATATAGGTAAGT
2481 GGCACAATTATTTTTCTTTAGAAAATATCTGTAACTTTATGCATTAGTGAAATGTTAAGTACCGACATATTTTTTAACAT
2561 TTTGTAATTCAAAACTTTTTGTTTTGACATTGTTTATGAAGAGAAACTTCATACACTTGCCATTTAATATGCTCTTTTAT
2641 CTAATTTTCAAAAACTCTAAAAAACGGTGTATCATATGGACTAAATAAAGAACATGTGAATTTTATTGCTCATCATGAAA
2721 AAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              :::| | |  ||||||| 
Target 5' catcGGTCTTCACATGCTGCTa 3'
1137 - 1158 146.00 -12.20
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||: | |   ||||||:| 
Target 5' ctgAAGGC-TGCAGTGCTGTTc 3'
1007 - 1027 130.00 -9.50
3
miRNA  3' gugUUUGGU--A----AUACACGACGAu 5'
             ||:|:|  |    |:||| ||||| 
Target 5' tgaAAGCTACTTGAGATGTGTACTGCTa 3'
1299 - 1326 127.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26990188 12 COSMIC
COSN26990187 16 COSMIC
COSN30192100 25 COSMIC
COSN30520920 30 COSMIC
COSN28885971 46 COSMIC
COSN30505620 76 COSMIC
COSN30503849 80 COSMIC
COSN30152587 96 COSMIC
COSN26562113 134 COSMIC
COSN31593198 148 COSMIC
COSN31490334 150 COSMIC
COSN1164381 162 COSMIC
COSN23068174 163 COSMIC
COSN31533138 216 COSMIC
COSN31485165 332 COSMIC
COSN24642850 360 COSMIC
COSN23816021 365 COSMIC
COSN26423903 451 COSMIC
COSN31564898 513 COSMIC
COSN31544539 564 COSMIC
COSN31486433 590 COSMIC
COSN30175907 599 COSMIC
COSN31597012 605 COSMIC
COSN29557133 668 COSMIC
COSN5380667 988 COSMIC
COSN31490804 1030 COSMIC
COSN8821949 1035 COSMIC
COSN26599367 1115 COSMIC
COSN26603577 1218 COSMIC
COSN31547272 1261 COSMIC
COSN15773655 1429 COSMIC
COSN32056630 1741 COSMIC
COSN16497806 1806 COSMIC
COSN29478306 1923 COSMIC
COSN29478858 1924 COSMIC
COSN25889932 1951 COSMIC
COSN21231701 1994 COSMIC
COSN28815888 2040 COSMIC
COSN31486442 2131 COSMIC
COSN31548020 2192 COSMIC
COSN31549306 2204 COSMIC
COSN20156440 2247 COSMIC
COSN31578533 2436 COSMIC
COSN31536136 2454 COSMIC
COSN28758657 2573 COSMIC
COSN22366323 2635 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1399310562 3 dbSNP
rs1431642035 4 dbSNP
rs750847624 8 dbSNP
rs756578334 9 dbSNP
rs1278822517 11 dbSNP
rs1327945731 17 dbSNP
rs372065291 20 dbSNP
rs1277151962 23 dbSNP
rs754321822 24 dbSNP
rs754466626 25 dbSNP
rs778287363 26 dbSNP
rs1334085442 27 dbSNP
rs1253436242 28 dbSNP
rs1481253826 28 dbSNP
rs747743962 30 dbSNP
rs1267346665 31 dbSNP
rs1484922591 32 dbSNP
rs1204835627 33 dbSNP
rs776562796 35 dbSNP
rs777704707 36 dbSNP
rs1223775106 37 dbSNP
rs746838961 39 dbSNP
rs770752812 42 dbSNP
rs1346799400 44 dbSNP
rs776584253 45 dbSNP
rs111800390 46 dbSNP
rs973639005 47 dbSNP
rs745823197 50 dbSNP
rs1450974942 51 dbSNP
rs768716123 53 dbSNP
rs1397192277 55 dbSNP
rs992335469 57 dbSNP
rs1324216231 65 dbSNP
rs917979207 70 dbSNP
rs1222630759 73 dbSNP
rs1464392608 89 dbSNP
rs1361994930 91 dbSNP
rs1428830874 92 dbSNP
rs948181815 93 dbSNP
rs931979732 97 dbSNP
rs1409776818 98 dbSNP
rs987965931 100 dbSNP
rs1420204157 106 dbSNP
rs1253337962 107 dbSNP
rs1199075612 109 dbSNP
rs1461113702 113 dbSNP
rs911949266 114 dbSNP
rs1203833706 115 dbSNP
rs111530226 119 dbSNP
rs935408360 122 dbSNP
rs1277248482 126 dbSNP
rs555865162 127 dbSNP
rs139746163 131 dbSNP
rs1484914314 136 dbSNP
rs947317933 150 dbSNP
rs538110830 153 dbSNP
rs1471071042 158 dbSNP
rs750026655 161 dbSNP
rs1158039716 164 dbSNP
rs892377684 167 dbSNP
rs1480416856 178 dbSNP
rs1174652193 179 dbSNP
rs879109096 186 dbSNP
rs1470583918 187 dbSNP
rs1414674498 189 dbSNP
rs933186611 191 dbSNP
rs1186001070 197 dbSNP
rs1444564570 201 dbSNP
rs1244064006 202 dbSNP
rs1051531481 204 dbSNP
rs780846569 213 dbSNP
rs888885758 214 dbSNP
rs1007282503 219 dbSNP
rs758049485 223 dbSNP
rs1016352127 231 dbSNP
rs1064430 234 dbSNP
rs898793099 235 dbSNP
rs1005021134 249 dbSNP
rs1382017887 249 dbSNP
rs765989510 254 dbSNP
rs1294804343 255 dbSNP
rs1454415880 256 dbSNP
rs1345995944 262 dbSNP
rs555254604 269 dbSNP
rs973670136 270 dbSNP
rs1029211300 272 dbSNP
rs1025936021 280 dbSNP
rs951595540 288 dbSNP
rs1387141365 293 dbSNP
rs1161545968 296 dbSNP
rs1424565193 299 dbSNP
rs1330941473 302 dbSNP
rs953512576 303 dbSNP
rs992350235 308 dbSNP
rs1283796048 309 dbSNP
rs1025122740 319 dbSNP
rs375185688 321 dbSNP
rs1447235211 322 dbSNP
rs1263205072 323 dbSNP
rs564502107 331 dbSNP
rs1223819405 341 dbSNP
rs969889490 343 dbSNP
rs980844189 344 dbSNP
rs1358607158 353 dbSNP
rs925276005 362 dbSNP
rs867934823 363 dbSNP
rs1337161370 366 dbSNP
rs1269385954 369 dbSNP
rs1431677971 375 dbSNP
rs1301362727 378 dbSNP
rs936722874 387 dbSNP
rs1404450377 388 dbSNP
rs116067941 389 dbSNP
rs1165967813 390 dbSNP
rs1254680444 392 dbSNP
rs1428415239 398 dbSNP
rs1419169403 403 dbSNP
rs1168913467 408 dbSNP
rs913084649 414 dbSNP
rs947182174 422 dbSNP
rs1269020517 424 dbSNP
rs1224548572 427 dbSNP
rs1436017888 428 dbSNP
rs1272003249 431 dbSNP
rs913847404 442 dbSNP
rs1215010370 449 dbSNP
rs377515379 450 dbSNP
rs11553289 452 dbSNP
rs1056823698 454 dbSNP
rs1398599898 456 dbSNP
rs888922280 457 dbSNP
rs1440631260 462 dbSNP
rs943116386 469 dbSNP
rs1329929362 470 dbSNP
rs1412046656 471 dbSNP
rs1404395044 478 dbSNP
rs531371699 479 dbSNP
rs1037496338 487 dbSNP
rs1479911010 492 dbSNP
rs533768016 502 dbSNP
rs1166214539 504 dbSNP
rs898902424 509 dbSNP
rs547895549 510 dbSNP
rs533134686 512 dbSNP
rs1204926220 513 dbSNP
rs1741143 514 dbSNP
rs1301180136 517 dbSNP
rs1014659526 524 dbSNP
rs1025967090 526 dbSNP
rs1324551602 527 dbSNP
rs568180613 527 dbSNP
rs887373998 528 dbSNP
rs1222177896 531 dbSNP
rs781743700 532 dbSNP
rs576997097 533 dbSNP
rs1445033720 536 dbSNP
rs1404287090 544 dbSNP
rs1336505416 547 dbSNP
rs527379161 554 dbSNP
rs969543410 556 dbSNP
rs1406443249 560 dbSNP
rs1177563622 561 dbSNP
rs1398497119 564 dbSNP
rs547120950 573 dbSNP
rs878885523 578 dbSNP
rs3134676 582 dbSNP
rs1182829310 586 dbSNP
rs1461919383 589 dbSNP
rs1265288496 590 dbSNP
rs1358816564 595 dbSNP
rs1220405670 597 dbSNP
rs1277370169 598 dbSNP
rs1381301625 612 dbSNP
rs958347248 612 dbSNP
rs1314785733 616 dbSNP
rs1018957929 619 dbSNP
rs1383037665 620 dbSNP
rs1304168451 621 dbSNP
rs1204183154 623 dbSNP
rs956895302 629 dbSNP
rs988186505 637 dbSNP
rs1231542157 644 dbSNP
rs988122624 651 dbSNP
rs1162673510 655 dbSNP
rs1444967950 658 dbSNP
rs915290618 659 dbSNP
rs1184936964 660 dbSNP
rs913877104 666 dbSNP
rs1485675360 680 dbSNP
rs968096039 683 dbSNP
rs570415736 685 dbSNP
rs1333645751 686 dbSNP
rs1291749287 696 dbSNP
rs1401074089 708 dbSNP
rs1361985460 709 dbSNP
rs1293885355 711 dbSNP
rs188031658 726 dbSNP
rs778306865 727 dbSNP
rs749651936 729 dbSNP
rs1385518973 737 dbSNP
rs1443454551 739 dbSNP
rs550468085 747 dbSNP
rs1372283023 748 dbSNP
rs1363194463 757 dbSNP
rs570280459 758 dbSNP
rs1302428188 773 dbSNP
rs1425231812 797 dbSNP
rs1369924475 798 dbSNP
rs910458885 808 dbSNP
rs943251760 811 dbSNP
rs536018360 813 dbSNP
rs1327878171 816 dbSNP
rs937303279 817 dbSNP
rs1352534139 821 dbSNP
rs10131687 823 dbSNP
rs1315960723 824 dbSNP
rs929016003 826 dbSNP
rs192572996 828 dbSNP
rs940300507 835 dbSNP
rs1489761178 838 dbSNP
rs565710908 838 dbSNP
rs1299956052 840 dbSNP
rs1227241583 842 dbSNP
rs1340604551 858 dbSNP
rs1214481508 859 dbSNP
rs74693721 860 dbSNP
rs1306538377 862 dbSNP
rs1036123090 898 dbSNP
rs535108872 908 dbSNP
rs1204765663 912 dbSNP
rs1343022793 916 dbSNP
rs898951053 930 dbSNP
rs745898990 935 dbSNP
rs895448042 943 dbSNP
rs1405473119 944 dbSNP
rs1296203890 953 dbSNP
rs994588643 953 dbSNP
rs1050641788 957 dbSNP
rs1354915115 963 dbSNP
rs889252073 972 dbSNP
rs1243317500 979 dbSNP
rs1460618649 980 dbSNP
rs1013847074 983 dbSNP
rs1009168436 987 dbSNP
rs557897684 987 dbSNP
rs956712056 989 dbSNP
rs1249097386 992 dbSNP
rs1374313729 997 dbSNP
rs1481142472 1008 dbSNP
rs1475490798 1025 dbSNP
rs1260403885 1036 dbSNP
rs1200079082 1048 dbSNP
rs1321047537 1054 dbSNP
rs1167260464 1062 dbSNP
rs1233394711 1075 dbSNP
rs1417346600 1085 dbSNP
rs1009557117 1087 dbSNP
rs1470822054 1092 dbSNP
rs1373700435 1094 dbSNP
rs541715799 1097 dbSNP
rs1468417909 1102 dbSNP
rs1405712460 1107 dbSNP
rs1177204808 1111 dbSNP
rs1467605726 1113 dbSNP
rs905433883 1128 dbSNP
rs1405573140 1141 dbSNP
rs968126896 1143 dbSNP
rs1002402851 1145 dbSNP
rs1420220969 1149 dbSNP
rs1032903189 1151 dbSNP
rs577944698 1157 dbSNP
rs927162855 1157 dbSNP
rs958164208 1159 dbSNP
rs1459678857 1166 dbSNP
rs1200694753 1175 dbSNP
rs1262168285 1175 dbSNP
rs958761466 1183 dbSNP
rs772143870 1184 dbSNP
rs1327095236 1188 dbSNP
rs1430151952 1192 dbSNP
rs1238168457 1202 dbSNP
rs1354394342 1204 dbSNP
rs1311178558 1205 dbSNP
rs1020914929 1207 dbSNP
rs545798610 1209 dbSNP
rs1381798862 1210 dbSNP
rs954749194 1218 dbSNP
rs562407010 1219 dbSNP
rs987426083 1228 dbSNP
rs1337591785 1242 dbSNP
rs910499338 1250 dbSNP
rs1224457629 1252 dbSNP
rs1382810224 1253 dbSNP
rs1262910012 1259 dbSNP
rs746944018 1267 dbSNP
rs1158129366 1268 dbSNP
rs1322329683 1290 dbSNP
rs1201376269 1297 dbSNP
rs964968326 1299 dbSNP
rs11553290 1303 dbSNP
rs973278217 1305 dbSNP
rs920393280 1306 dbSNP
rs575837516 1309 dbSNP
rs1382747378 1314 dbSNP
rs1036070863 1336 dbSNP
rs45458393 1337 dbSNP
rs1244161808 1338 dbSNP
rs1447049823 1341 dbSNP
rs755967624 1346 dbSNP
rs930390719 1357 dbSNP
rs1259038687 1359 dbSNP
rs561538377 1364 dbSNP
rs772624641 1378 dbSNP
rs1481395575 1381 dbSNP
rs1176804332 1384 dbSNP
rs1488558378 1386 dbSNP
rs1288137009 1398 dbSNP
rs1243724435 1399 dbSNP
rs149329037 1409 dbSNP
rs768605500 1409 dbSNP
rs889291936 1413 dbSNP
rs761759610 1419 dbSNP
rs1247246021 1420 dbSNP
rs769770723 1426 dbSNP
rs773030686 1429 dbSNP
rs1009444741 1430 dbSNP
rs1468096946 1434 dbSNP
rs949731252 1439 dbSNP
rs1040538822 1447 dbSNP
rs1044437643 1451 dbSNP
rs1362558788 1452 dbSNP
rs905464398 1453 dbSNP
rs1009756658 1470 dbSNP
rs527432556 1470 dbSNP
rs1386188094 1472 dbSNP
rs1022281607 1474 dbSNP
rs1741144 1476 dbSNP
rs563948198 1479 dbSNP
rs1371023548 1480 dbSNP
rs1191817421 1486 dbSNP
rs1381667137 1489 dbSNP
rs56028013 1491 dbSNP
rs1220087511 1495 dbSNP
rs1034142204 1500 dbSNP
rs962593707 1508 dbSNP
rs1211461905 1511 dbSNP
rs1058327 1512 dbSNP
rs993105972 1529 dbSNP
rs1283277832 1530 dbSNP
rs1021030723 1536 dbSNP
rs1342371268 1540 dbSNP
rs1281468889 1542 dbSNP
rs1344024150 1559 dbSNP
rs1325908057 1561 dbSNP
rs570314800 1585 dbSNP
rs890528002 1586 dbSNP
rs1396257116 1591 dbSNP
rs1024143912 1596 dbSNP
rs1425131334 1599 dbSNP
rs759023299 1602 dbSNP
rs536151918 1603 dbSNP
rs1480050317 1605 dbSNP
rs971964081 1606 dbSNP
rs1200937123 1610 dbSNP
rs1435820994 1620 dbSNP
rs1194745690 1629 dbSNP
rs1008877036 1634 dbSNP
rs187887022 1638 dbSNP
rs549637931 1646 dbSNP
rs920273959 1655 dbSNP
rs1017998726 1657 dbSNP
rs1350975919 1660 dbSNP
rs930254827 1661 dbSNP
rs1281533098 1675 dbSNP
rs1490713839 1686 dbSNP
rs1200056034 1694 dbSNP
rs1268141986 1695 dbSNP
rs1440654088 1695 dbSNP
rs773167102 1699 dbSNP
rs139573269 1700 dbSNP
rs1402069090 1706 dbSNP
rs1173601509 1712 dbSNP
rs534832524 1717 dbSNP
rs377459318 1719 dbSNP
rs1413355347 1726 dbSNP
rs558202306 1729 dbSNP
rs1192787018 1730 dbSNP
rs1232081748 1733 dbSNP
rs910325453 1733 dbSNP
rs944468598 1734 dbSNP
rs1459235393 1735 dbSNP
rs1241587313 1736 dbSNP
rs1040965827 1740 dbSNP
rs1203300322 1743 dbSNP
rs1367520018 1744 dbSNP
rs892628180 1749 dbSNP
rs1280842998 1751 dbSNP
rs1222550170 1754 dbSNP
rs1425460061 1756 dbSNP
rs973693003 1760 dbSNP
rs571564684 1767 dbSNP
rs1449526036 1769 dbSNP
rs1027490401 1795 dbSNP
rs950568331 1799 dbSNP
rs1303045968 1800 dbSNP
rs532443759 1801 dbSNP
rs537006672 1813 dbSNP
rs1359182278 1815 dbSNP
rs1393451951 1818 dbSNP
rs1177683819 1819 dbSNP
rs1043916584 1823 dbSNP
rs1308202525 1833 dbSNP
rs1335912464 1835 dbSNP
rs149679553 1837 dbSNP
rs917029901 1838 dbSNP
rs1383188227 1840 dbSNP
rs918398893 1850 dbSNP
rs1181441517 1853 dbSNP
rs552257584 1860 dbSNP
rs1360938212 1862 dbSNP
rs1287303132 1868 dbSNP
rs541708124 1877 dbSNP
rs896584647 1882 dbSNP
rs979807944 1891 dbSNP
rs1357650815 1892 dbSNP
rs1222647600 1906 dbSNP
rs537773530 1913 dbSNP
rs1314815911 1916 dbSNP
rs926919917 1922 dbSNP
rs1227374643 1929 dbSNP
rs938280499 1932 dbSNP
rs1379532010 1933 dbSNP
rs1304050717 1937 dbSNP
rs1489847483 1939 dbSNP
rs753210282 1949 dbSNP
rs192566952 1953 dbSNP
rs1298691200 1954 dbSNP
rs1421447921 1961 dbSNP
rs1013667123 1969 dbSNP
rs1163892570 1971 dbSNP
rs1197256686 1973 dbSNP
rs1250985705 1992 dbSNP
rs1418347612 1993 dbSNP
rs2623 1999 dbSNP
rs894053773 2002 dbSNP
rs569314020 2012 dbSNP
rs772900798 2013 dbSNP
rs1042515767 2019 dbSNP
rs1477512286 2030 dbSNP
rs1387362215 2032 dbSNP
rs961837415 2033 dbSNP
rs890558955 2039 dbSNP
rs971995167 2060 dbSNP
rs1009368117 2070 dbSNP
rs1291503570 2071 dbSNP
rs1027545578 2076 dbSNP
rs1017611062 2084 dbSNP
rs1314373990 2091 dbSNP
rs1212474835 2093 dbSNP
rs531924786 2097 dbSNP
rs1364212217 2110 dbSNP
rs778488403 2110 dbSNP
rs1463983044 2127 dbSNP
rs1363680539 2128 dbSNP
rs951984932 2134 dbSNP
rs900461573 2135 dbSNP
rs540784803 2144 dbSNP
rs1396217628 2148 dbSNP
rs910217954 2151 dbSNP
rs994843562 2159 dbSNP
rs1328842052 2162 dbSNP
rs1384571638 2168 dbSNP
rs1424415550 2168 dbSNP
rs1479726857 2169 dbSNP
rs1267329848 2174 dbSNP
rs1192310113 2184 dbSNP
rs1246017549 2192 dbSNP
rs1489649270 2193 dbSNP
rs77411489 2209 dbSNP
rs757571056 2212 dbSNP
rs1319790606 2213 dbSNP
rs1229498064 2225 dbSNP
rs1219987903 2226 dbSNP
rs1251889988 2229 dbSNP
rs1300451920 2230 dbSNP
rs766534501 2235 dbSNP
rs1387280663 2243 dbSNP
rs1369385343 2246 dbSNP
rs983305463 2252 dbSNP
rs866960806 2255 dbSNP
rs914074906 2258 dbSNP
rs779123958 2259 dbSNP
rs1024117784 2266 dbSNP
rs1193910836 2286 dbSNP
rs1401357126 2288 dbSNP
rs1172885777 2289 dbSNP
rs1468254869 2298 dbSNP
rs1043968357 2303 dbSNP
rs1802865 2310 dbSNP
rs971147157 2311 dbSNP
rs35946432 2313 dbSNP
rs980221470 2329 dbSNP
rs1435439837 2331 dbSNP
rs1248854871 2340 dbSNP
rs927062488 2344 dbSNP
rs1245149120 2345 dbSNP
rs1457021884 2362 dbSNP
rs1238355431 2365 dbSNP
rs1461963035 2372 dbSNP
rs532793814 2385 dbSNP
rs1200172537 2391 dbSNP
rs1342174496 2417 dbSNP
rs904141814 2421 dbSNP
rs1182993210 2422 dbSNP
rs1313951584 2423 dbSNP
rs1304566190 2429 dbSNP
rs1383476880 2431 dbSNP
rs935701124 2439 dbSNP
rs1430437654 2447 dbSNP
rs989820753 2448 dbSNP
rs1450732130 2453 dbSNP
rs543488879 2461 dbSNP
rs1401514724 2473 dbSNP
rs915518135 2488 dbSNP
rs1468000108 2498 dbSNP
rs1373057922 2500 dbSNP
rs1158595540 2508 dbSNP
rs938257401 2510 dbSNP
rs1382555442 2512 dbSNP
rs1055572923 2519 dbSNP
rs1407753311 2524 dbSNP
rs945608593 2533 dbSNP
rs145522788 2544 dbSNP
rs1014091961 2545 dbSNP
rs776795896 2547 dbSNP
rs372550610 2549 dbSNP
rs1283740202 2550 dbSNP
rs1491070146 2550 dbSNP
rs1354069284 2560 dbSNP
rs897677317 2565 dbSNP
rs34469985 2571 dbSNP
rs993360592 2589 dbSNP
rs765909810 2602 dbSNP
rs1027471954 2612 dbSNP
rs1306874285 2613 dbSNP
rs1397807783 2615 dbSNP
rs890590018 2616 dbSNP
rs1298050547 2622 dbSNP
rs1173010182 2625 dbSNP
rs1264776739 2628 dbSNP
rs746107042 2633 dbSNP
rs772088967 2642 dbSNP
rs1471590183 2656 dbSNP
rs1203258127 2657 dbSNP
rs1007469008 2659 dbSNP
rs944810797 2660 dbSNP
rs1017696646 2661 dbSNP
rs1425004050 2662 dbSNP
rs1260415757 2663 dbSNP
rs965701495 2666 dbSNP
rs185058668 2667 dbSNP
rs549674234 2674 dbSNP
rs1261592928 2677 dbSNP
rs975821484 2685 dbSNP
rs780083453 2690 dbSNP
rs147411271 2694 dbSNP
rs1430405205 2695 dbSNP
rs1469668215 2699 dbSNP
rs1247264081 2705 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                :| | |  ||||||| 
Target 5' ------UCUUCACAUGCUGCUa 3'
1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ::| | |  ||||||| 
Target 5' -----GUCUUCACAUGCUGCUa 3'
1 - 17
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000422945.2 | 3UTR | UCUUCACAUGCUGCUAUAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000422945.2 | 3UTR | GUCUUCACAUGCUGCUAUAUAUUCCACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.702 2.8e-4 0.820 4.8e-6 20 Click to see details
GSE21032 Prostate cancer 0.364 3.6e-4 0.320 1.6e-3 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.453 1.1e-2 0.436 1.5e-2 25 Click to see details
GSE38226 Liver fibrosis -0.46 1.8e-2 -0.429 2.6e-2 21 Click to see details
GSE21849 B cell lymphoma 0.332 3.9e-2 0.409 1.4e-2 29 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.311 6.5e-2 -0.068 3.7e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.323 6.6e-2 -0.283 9.5e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.429 7.2e-2 -0.335 1.3e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.211 1.2e-1 0.176 1.7e-1 32 Click to see details
GSE27834 Pluripotent stem cells -0.239 1.9e-1 -0.132 3.1e-1 16 Click to see details
GSE28544 Breast cancer -0.182 2.0e-1 -0.526 4.1e-3 24 Click to see details
GSE19350 CNS germ cell tumors 0.257 2.1e-1 0.517 4.3e-2 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.129 2.7e-1 0.185 1.9e-1 24 Click to see details
GSE19783 ER- ER- breast cancer -0.045 3.5e-1 -0.017 4.4e-1 79 Click to see details
GSE19783 ER+ ER+ breast cancer 0.082 3.7e-1 0.036 4.4e-1 20 Click to see details
GSE17306 Multiple myeloma -0.044 3.8e-1 -0.044 3.8e-1 49 Click to see details
GSE21687 Ependynoma primary tumors 0.035 3.9e-1 0.122 1.7e-1 64 Click to see details
GSE17498 Multiple myeloma -0.021 4.5e-1 -0.119 2.3e-1 40 Click to see details
GSE19536 Breast cancer 0.01 4.6e-1 0.040 3.5e-1 100 Click to see details
GSE14794 Lymphoblastoid cells -0.005 4.8e-1 -0.057 3.0e-1 90 Click to see details
GSE14794 Lymphoblastoid cells -0.005 4.8e-1 -0.057 3.0e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.77 0 -0.794 0 18 Click to see details
STAD -0.568 0 -0.602 0 32 Click to see details
PAAD 0.945 0.03 0.400 0.3 4 Click to see details
UCEC 0.418 0.04 0.453 0.03 19 Click to see details
PCPG -0.984 0.06 -1.000 0.5 3 Click to see details
BRCA 0.154 0.08 0.096 0.19 84 Click to see details
CHOL -0.493 0.09 -0.533 0.07 9 Click to see details
LUAD -0.387 0.11 -0.385 0.11 12 Click to see details
THCA 0.159 0.11 0.152 0.13 59 Click to see details
COAD -0.433 0.14 -0.571 0.07 8 Click to see details
PRAD -0.144 0.16 -0.025 0.43 50 Click to see details
LIHC 0.1 0.25 0.139 0.17 49 Click to see details
CESC 0.435 0.36 0.500 0.33 3 Click to see details
LUSC -0.06 0.36 -0.045 0.39 38 Click to see details
KIRC 0.043 0.36 0.002 0.49 68 Click to see details
KIRP -0.047 0.4 -0.042 0.41 32 Click to see details
ESCA 0.082 0.41 0.236 0.24 11 Click to see details
KICH -0.037 0.43 0.119 0.29 25 Click to see details
HNSC 0.007 0.48 -0.051 0.37 42 Click to see details
HNSC 0.007 0.48 -0.051 0.37 42 Click to see details
HNSC 0.007 0.48 -0.051 0.37 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*