miRTarBase - #MIRT297778 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GABPA   
Synonyms E4TF1-60, E4TF1A, NFT2, NRF2, NRF2A, RCH04A07
Description GA binding protein transcription factor alpha subunit
Transcript NM_002040   
Expression
Putative miRNA Targets on GABPA
3'UTR of GABPA
(miRNA target sites are highlighted)
>GABPA|NM_002040|3'UTR
   1 GCCCCAGGACATTCTGAGACTCCAAAGTCTTTCTTAAAATGTTTAGAGCAAGTATAGCTCTTACCTTTATTACTGAATTT
  81 GAATCTTCTTTTATTTCTAGGCTGTACAGTCTGATGCATGATTTTTTTATAAATATTTCATACTCTTGTGAATTTGGATC
 161 TTTTTACTTTGAGCATATATTTTAGAATATGTGTATGTTAAAGGATCTCCACAATGTCTGCAGTGTGAAGGCAGGTTCAT
 241 TGTGGAATAGTTTAACAGTCAGGAAGGCTAAACTGGTCAGTATTAATGTGTAGCCCTACCAAAAATAGCCAGTAGTATCT
 321 GAAAATGAAAAATAAATGAAGTATCTCTAGGAAACAGTCTGGCTTAACTATTTTTGAAAATATAACTGTTTCCCCTCTCT
 401 GCTGCTTTAGATGTTGCTTTACATAGAACCAGAAAATGGAATTTCTCAGCTAAAGCATGTGTGCCTGTTTCATCTAATCA
 481 AGCAGAGCTAAAATGTTCATACCGAATAAATTTATATTAATAAATTACTAAACTAAGAGTATCAGGTTATTTATATATTT
 561 GCAAGCAAAGGACAGTAAGAAGTTGACTGGCAAAAGAGCAGTGCTGAAGGAGGAGATCCAGGTTTAAATCTGGCTTATTA
 641 ACTCAAGCCAATTTTAAGGATTTTCTGTATAGATTACTCATGTCAGACCAAGAATTTAAATTATTTTGAGAGAGGCATTT
 721 AATTCTAATAAACCAGCTGTTATAAAAATTATAAAATGATCTCTGTTTTTCCTGTCAGAGATTTAAAAAACTGAAAAGGT
 801 ATACCTCAACCCAAAAATAAAGGTTTGTTTTGGTTTGTTATGGCTTCCTTTTTTAAAAAATTACCCTGTAGTGCCAGTTT
 881 ATTATGCAAAGCAGCTTATATTCCTTTGTTTCTGATAAAATGAAGACTTTAAATCAGTCAGTAGTACTTTACCTTTCAAG
 961 GCATTAGTAAATTACTTGCAAATAGTTTTAAAAGGAAAATACGACCTTTGTTATAGGCAGTCTTCTCTTTAAGACAATAC
1041 TTTTCCACTTGTTTTCCTTTTCCATATTATATATGTGTATTCATATAGCTGTATACATATTCAGTTGATCATTTTATAAA
1121 CATATGAAGGCATAAAGATATACAGAAGAAAAATTATTAAACAACTCATTTTAAGATTCAAATTAACTAATTCCTGCATA
1201 TATGACATTCCTTACATAAGCGAACACTAAACAAAAATGGCTAGAAATGTCTTTTTCTTTCTTTTCTCTCTTTGTTGTTT
1281 AAGGTATTAAGCACGAATTATTACATGAGACTGGCAGATAGCTATTAATCCTCTTACAGATTTGAGAAAGTTGATTCTCA
1361 AATATTTATGCACCTTCTCCTTCATTGTTTTCTTTAAATCTGTCCTCTTAAAAAGCTTCTTAAGAGCTCAGTTAATGCTT
1441 TTGACTTAACTAGGAGAAAAAGGCATGATAATACAGGCAAGATGGCATTGTTAGCAATTCTGGTAGTGGTTTGGAATGAA
1521 TCCTAAGAGGCAGGGATCTTAAGGACAAGGAAGAGAAGAGAGAGAGGGAGGGATCTTTGATCTCTTTCTCTGGTAATCTT
1601 AATGCATAATTTTACTAAAACATGTTCTCAATTCATTCATATTATTAAGCTCTTCCTGCAGTTGATATCTGAGCAGAGTA
1681 AGATTTGTATTTCCATTTTTACTTTTTTGAAAGAGAATATATGGACAGATTATTAGTACAATTTGGGCACTGTGGTTTTA
1761 AGAATATCTGAGTAAAATAACAATATGAAATAATAAACAGAAGCTCTAACGTCAGGTAACAAATAGACAGCAAGAAAGGT
1841 TTTGCACCATCCTCTTACGGCCTAGAGAGTTGACAAGTTGCTTGTAGTTTTAAAAAAATAATAAAGTATACCCTTCTGGT
1921 ATATCATCAAGAGCTTAAGAATCTTGGCTTTCATATTTAAAATGCTTTTGGGGAGACATATATTAAAATTTTAGCCAAGA
2001 TGATAGACATGTCTCAATTATATATGTGTGTGTATGTTTTTAAAGCTAAAAACATTACTTTTAGATCCCTAGAATGAAAA
2081 TTTTTTTCTCATCTATGCAATTCCCATATGGTTTTTTTTTAAATCATATTTTATTCATTTTCTCCCTTTAGCAATTTTCA
2161 TTTTATTTCTCATAATTTGAACAGAGACAGTTCTCATACATGATCAGATGCTTTTTTTTTCTTCTTACCATCATTTATGC
2241 ATGACATAGGTAATGTGACTAATTTCTCCAGTTGATTCAAGAAACTCATTACTTTGCCTCAAATTATATGTAAAATATTT
2321 GTTTTACTTAGGTTACAGTTATCAGAAAGGTAGTTTTTTTCTTCTATTAAAATATAACATTGTGAAAGAAAATAAAATTT
2401 ATGCTATTCTTTGCTTTGTTTTTATAAATGAATTTTTCATAGAATTTACAGTATATTCAAAGGAAGAAAGATAAAATTAT
2481 TGGTCATCATTTGTACCTTAGAAGTACAAGAATTTAAGTAAAAGAAATGTTCATTTTTGTTTTAAAATTTGTTTTCCATG
2561 TGAAGTTTTTATTGAGCCAACTTTCATACATATCTTGCTAGCCTAAAGTCTAAATATTTGTGTTGGCATCAGAAAAACAA
2641 ATGAGGCAGAATTGCTATGTGTGGTTGATCTTCAGATAAATTGACTGATCACAGTTATTTTTGTATCAGTCTATGTTATT
2721 AGGAAAAATTGTTTAGTTGTTTTCTCCCCTGATTAATGGTGATATTCAAGTATGATACAAAAAGAATTGTACCACCAAAT
2801 ATTTTTGTGAGGTCTGCTGTTTTCCATATTCATTTTATGCTACTGCCTTTAAGAAAGAACTAGTGTATCCTTGAAATAGC
2881 ACAAAAATGTTTTAAAATTCATAATTGCAAAACAAATCTGTGACTAACTTAATGTCTTCAGATCTAAAGGGTGTAAAAAT
2961 ATTGATACTTCAATATTTCACTTGCTGCCAGGAAAAACAAAATTCTCAATCTTTTGTAAATGGGAGGAGGACTTTTGCAT
3041 ACATTTTTACTCTTTAAATAACGACAACGACACTTATACTGTCATAATAACAATTATGTATTTCTTTGTGGTTTTAATTT
3121 TTTTTGTAATTTTACATAAAACAGTTATTTTCTATTTTTACGCAGATAAATATTTGTGCATAAAATGTAAAAATAGTAAA
3201 ATGAGAAAAATAAAACTATTATACAGTAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ||  | | ||||||| 
Target 5' ctgtttCCCCTCTCTGCTGCTt 3'
386 - 407 148.00 -9.80
2
miRNA  3' guGUU--UGGUAAUAC-----ACGACGAu 5'
            |||  |:: ||:||     |||||:| 
Target 5' acCAAATATTTTTGTGAGGTCTGCTGTTt 3'
2794 - 2822 138.00 -12.00
3
miRNA  3' guGU-UUGGUAAUACACGACGAu 5'
            || | :|||| | |||| || 
Target 5' tcCATATTCATTTTATGCTACTg 3'
2823 - 2845 132.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26976972 15 COSMIC
COSN31555254 16 COSMIC
COSN30720421 31 COSMIC
COSN30179390 49 COSMIC
COSN30184807 57 COSMIC
COSN31586568 89 COSMIC
COSN31554144 117 COSMIC
COSN31529446 128 COSMIC
COSN31567551 137 COSMIC
COSN26569000 267 COSMIC
COSN26638594 268 COSMIC
COSN20093849 341 COSMIC
COSN30164405 433 COSMIC
COSN15662741 451 COSMIC
COSN31541606 466 COSMIC
COSN31546572 513 COSMIC
COSN20093850 557 COSMIC
COSN31518889 780 COSMIC
COSN31482330 782 COSMIC
COSN20093851 932 COSMIC
COSN8006136 1006 COSMIC
COSN26837370 1372 COSMIC
COSN513291 1455 COSMIC
COSN21560204 1651 COSMIC
COSN16054918 1929 COSMIC
COSN20116776 2121 COSMIC
COSN16903016 2233 COSMIC
COSN20325999 2429 COSMIC
COSN20661102 2732 COSMIC
COSN21582698 2785 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1221954959 2 dbSNP
rs1283016911 3 dbSNP
rs202051040 5 dbSNP
rs765861848 9 dbSNP
rs777367312 13 dbSNP
rs368818775 15 dbSNP
rs1446941313 26 dbSNP
rs774215105 33 dbSNP
rs753478724 42 dbSNP
rs761106999 49 dbSNP
rs752676500 50 dbSNP
rs762411711 52 dbSNP
rs1216182009 56 dbSNP
rs547258710 65 dbSNP
rs1468238553 68 dbSNP
rs1437685933 71 dbSNP
rs45602531 77 dbSNP
rs376856537 99 dbSNP
rs1322216804 104 dbSNP
rs1412116652 107 dbSNP
rs1385518864 113 dbSNP
rs1401585945 115 dbSNP
rs1170064170 116 dbSNP
rs926001759 121 dbSNP
rs1423758613 122 dbSNP
rs936073269 129 dbSNP
rs533072604 131 dbSNP
rs1477614158 132 dbSNP
rs550003161 147 dbSNP
rs866718874 161 dbSNP
rs1438334257 162 dbSNP
rs1053223275 165 dbSNP
rs1391930189 168 dbSNP
rs369063682 169 dbSNP
rs1329570956 179 dbSNP
rs1325037666 189 dbSNP
rs934150371 192 dbSNP
rs1218269471 193 dbSNP
rs2694 196 dbSNP
rs1367411700 208 dbSNP
rs1335226332 209 dbSNP
rs371743228 215 dbSNP
rs1051313781 251 dbSNP
rs1378330255 251 dbSNP
rs1331206046 253 dbSNP
rs890034199 257 dbSNP
rs1007181083 261 dbSNP
rs11542051 267 dbSNP
rs1414135808 276 dbSNP
rs535406808 300 dbSNP
rs898858495 307 dbSNP
rs1160121224 309 dbSNP
rs549121617 329 dbSNP
rs1342037219 333 dbSNP
rs1062461 334 dbSNP
rs1196906537 347 dbSNP
rs1166246795 348 dbSNP
rs1237549341 364 dbSNP
rs1176662957 369 dbSNP
rs994965245 371 dbSNP
rs1026037310 374 dbSNP
rs1310076935 384 dbSNP
rs950513224 393 dbSNP
rs1014048463 395 dbSNP
rs1354838494 402 dbSNP
rs1435532908 411 dbSNP
rs1024135035 418 dbSNP
rs970363513 430 dbSNP
rs34459326 433 dbSNP
rs925919205 437 dbSNP
rs1443641567 450 dbSNP
rs775564910 468 dbSNP
rs1374610669 470 dbSNP
rs1320512908 472 dbSNP
rs957413380 480 dbSNP
rs1462352169 496 dbSNP
rs1395806219 504 dbSNP
rs988855870 505 dbSNP
rs577186166 517 dbSNP
rs1394332848 519 dbSNP
rs1180807081 531 dbSNP
rs1481961824 536 dbSNP
rs1408265453 540 dbSNP
rs565760914 544 dbSNP
rs934097980 547 dbSNP
rs756950890 556 dbSNP
rs544864257 557 dbSNP
rs188275683 560 dbSNP
rs1328541006 563 dbSNP
rs1313997703 574 dbSNP
rs1227858410 583 dbSNP
rs1228660153 587 dbSNP
rs1251237481 589 dbSNP
rs1338076692 592 dbSNP
rs535269411 599 dbSNP
rs911417749 605 dbSNP
rs1263259668 606 dbSNP
rs942933407 608 dbSNP
rs1038628607 613 dbSNP
rs1263461521 632 dbSNP
rs765119181 641 dbSNP
rs1421586625 645 dbSNP
rs1421010090 649 dbSNP
rs763155971 651 dbSNP
rs1193682236 657 dbSNP
rs139934166 672 dbSNP
rs898801059 676 dbSNP
rs1214933427 677 dbSNP
rs796152022 678 dbSNP
rs1489656541 680 dbSNP
rs1266584053 693 dbSNP
rs994513819 694 dbSNP
rs1320061462 699 dbSNP
rs1047433892 701 dbSNP
rs1371211567 704 dbSNP
rs1340165486 705 dbSNP
rs886188643 708 dbSNP
rs1013984765 716 dbSNP
rs1368003466 717 dbSNP
rs1292926785 733 dbSNP
rs1456341768 735 dbSNP
rs1178628159 736 dbSNP
rs752581392 744 dbSNP
rs1406951925 760 dbSNP
rs578087195 761 dbSNP
rs867579738 762 dbSNP
rs1469397709 763 dbSNP
rs1421081067 769 dbSNP
rs1334929951 781 dbSNP
rs1387499567 783 dbSNP
rs1190920440 785 dbSNP
rs1268483546 785 dbSNP
rs1024081271 786 dbSNP
rs1260510388 791 dbSNP
rs1199376032 792 dbSNP
rs1317352632 800 dbSNP
rs1256444757 802 dbSNP
rs969931054 808 dbSNP
rs1001835982 819 dbSNP
rs1235692109 820 dbSNP
rs1032931727 822 dbSNP
rs957566994 832 dbSNP
rs1384823859 842 dbSNP
rs1379048912 845 dbSNP
rs1211415426 848 dbSNP
rs1445449349 849 dbSNP
rs866431811 855 dbSNP
rs1249368841 856 dbSNP
rs1225916639 863 dbSNP
rs191917080 865 dbSNP
rs955423614 867 dbSNP
rs1322177427 869 dbSNP
rs1175837395 885 dbSNP
rs1201306951 886 dbSNP
rs184207125 888 dbSNP
rs1262111746 898 dbSNP
rs757797838 900 dbSNP
rs1485999404 901 dbSNP
rs986911221 904 dbSNP
rs370006698 905 dbSNP
rs1236448858 914 dbSNP
rs1202181506 923 dbSNP
rs573716626 936 dbSNP
rs1346014023 939 dbSNP
rs911350079 944 dbSNP
rs942899905 945 dbSNP
rs1309968883 947 dbSNP
rs974689893 956 dbSNP
rs1374500926 959 dbSNP
rs1335631649 961 dbSNP
rs1481349097 982 dbSNP
rs1396070885 991 dbSNP
rs1401085837 997 dbSNP
rs920196308 998 dbSNP
rs866604524 1003 dbSNP
rs1047370221 1004 dbSNP
rs886137702 1016 dbSNP
rs1439628395 1018 dbSNP
rs779595729 1036 dbSNP
rs1045476535 1038 dbSNP
rs1333333589 1045 dbSNP
rs1255783162 1058 dbSNP
rs1198938738 1064 dbSNP
rs748731396 1071 dbSNP
rs143469868 1077 dbSNP
rs151233050 1091 dbSNP
rs905654727 1098 dbSNP
rs1285834275 1101 dbSNP
rs1244948306 1105 dbSNP
rs1001385055 1123 dbSNP
rs1310221735 1125 dbSNP
rs1428562113 1126 dbSNP
rs757912749 1134 dbSNP
rs61156591 1140 dbSNP
rs770410395 1142 dbSNP
rs1365693079 1149 dbSNP
rs1419427149 1150 dbSNP
rs893051091 1159 dbSNP
rs1165472519 1160 dbSNP
rs1473203514 1163 dbSNP
rs747451009 1184 dbSNP
rs1359002931 1199 dbSNP
rs1407190625 1203 dbSNP
rs1020283743 1222 dbSNP
rs773723159 1223 dbSNP
rs188492582 1228 dbSNP
rs182061978 1238 dbSNP
rs1291991381 1241 dbSNP
rs964523992 1249 dbSNP
rs974258056 1251 dbSNP
rs1263184166 1252 dbSNP
rs1340766905 1252 dbSNP
rs533110091 1252 dbSNP
rs1277154164 1254 dbSNP
rs1399822093 1262 dbSNP
rs200795121 1265 dbSNP
rs1326177280 1269 dbSNP
rs930217889 1271 dbSNP
rs1490769844 1272 dbSNP
rs1162922564 1285 dbSNP
rs1467207612 1286 dbSNP
rs549823577 1292 dbSNP
rs185031969 1295 dbSNP
rs563546778 1296 dbSNP
rs112093941 1306 dbSNP
rs1450997236 1314 dbSNP
rs949725031 1315 dbSNP
rs1045860326 1318 dbSNP
rs1189476607 1319 dbSNP
rs905605413 1325 dbSNP
rs1216394289 1331 dbSNP
rs1276974088 1336 dbSNP
rs937126627 1347 dbSNP
rs1410293586 1358 dbSNP
rs1054277527 1362 dbSNP
rs1419802229 1363 dbSNP
rs1401121204 1367 dbSNP
rs796965774 1372 dbSNP
rs1378774679 1373 dbSNP
rs1035051888 1380 dbSNP
rs1427448836 1386 dbSNP
rs115790549 1388 dbSNP
rs1164624106 1391 dbSNP
rs1393235585 1399 dbSNP
rs1020229867 1402 dbSNP
rs1365430133 1407 dbSNP
rs891091143 1419 dbSNP
rs1434988103 1429 dbSNP
rs1443821135 1430 dbSNP
rs1299338622 1454 dbSNP
rs1278836764 1455 dbSNP
rs1220229188 1457 dbSNP
rs1373400734 1464 dbSNP
rs1301972245 1466 dbSNP
rs373887995 1467 dbSNP
rs1390355296 1468 dbSNP
rs1378226630 1476 dbSNP
rs1008238269 1480 dbSNP
rs1361228244 1484 dbSNP
rs1018723314 1488 dbSNP
rs1335064693 1489 dbSNP
rs1246361496 1494 dbSNP
rs1290759607 1495 dbSNP
rs548986804 1502 dbSNP
rs1160172774 1503 dbSNP
rs1206514007 1504 dbSNP
rs974593494 1514 dbSNP
rs542433986 1521 dbSNP
rs774385643 1523 dbSNP
rs1027128001 1541 dbSNP
rs1473483247 1547 dbSNP
rs1233432190 1550 dbSNP
rs1491586712 1556 dbSNP
rs1485583550 1557 dbSNP
rs951568805 1557 dbSNP
rs1278654760 1563 dbSNP
rs1176751205 1565 dbSNP
rs982958356 1576 dbSNP
rs1309142299 1587 dbSNP
rs1222177835 1600 dbSNP
rs759777474 1604 dbSNP
rs529512419 1606 dbSNP
rs1447589093 1607 dbSNP
rs2154472 1620 dbSNP
rs988732990 1624 dbSNP
rs1404000470 1630 dbSNP
rs970988874 1632 dbSNP
rs1359882295 1636 dbSNP
rs11910323 1639 dbSNP
rs1173124847 1640 dbSNP
rs1413872303 1640 dbSNP
rs1180713709 1646 dbSNP
rs1264832888 1655 dbSNP
rs1474025304 1655 dbSNP
rs926975677 1661 dbSNP
rs1488803058 1665 dbSNP
rs1355695556 1667 dbSNP
rs760667971 1669 dbSNP
rs1461031237 1673 dbSNP
rs1328700086 1686 dbSNP
rs190765412 1704 dbSNP
rs914384422 1712 dbSNP
rs1227769656 1727 dbSNP
rs1353819051 1727 dbSNP
rs1280317136 1730 dbSNP
rs1452950147 1732 dbSNP
rs11910413 1737 dbSNP
rs1287107242 1738 dbSNP
rs560715082 1739 dbSNP
rs71651662 1740 dbSNP
rs1350331784 1742 dbSNP
rs1163500396 1749 dbSNP
rs1459371363 1760 dbSNP
rs1425377071 1763 dbSNP
rs764964666 1774 dbSNP
rs1478386504 1779 dbSNP
rs528140682 1781 dbSNP
rs557394764 1784 dbSNP
rs1489770180 1786 dbSNP
rs1247749247 1787 dbSNP
rs1039687483 1793 dbSNP
rs899847359 1795 dbSNP
rs1260315418 1799 dbSNP
rs1219466945 1805 dbSNP
rs567602961 1807 dbSNP
rs1027031037 1808 dbSNP
rs1368244789 1811 dbSNP
rs536287254 1812 dbSNP
rs1438162988 1820 dbSNP
rs1401828778 1823 dbSNP
rs1331361249 1825 dbSNP
rs779767749 1825 dbSNP
rs1464781092 1835 dbSNP
rs1370940479 1845 dbSNP
rs1168799588 1848 dbSNP
rs1435253215 1854 dbSNP
rs552945274 1859 dbSNP
rs1256274825 1860 dbSNP
rs1462786077 1861 dbSNP
rs558559953 1863 dbSNP
rs572853143 1873 dbSNP
rs1242805592 1875 dbSNP
rs1004331721 1877 dbSNP
rs1235207720 1885 dbSNP
rs545182179 1889 dbSNP
rs1025138362 1893 dbSNP
rs970936419 1894 dbSNP
rs981459158 1896 dbSNP
rs1428442983 1902 dbSNP
rs71651663 1907 dbSNP
rs577783224 1912 dbSNP
rs958632614 1922 dbSNP
rs1304188334 1929 dbSNP
rs543581911 1948 dbSNP
rs1360100460 1949 dbSNP
rs914330513 1978 dbSNP
rs945811964 1982 dbSNP
rs1382658858 2000 dbSNP
rs11910425 2006 dbSNP
rs1418557751 2008 dbSNP
rs1248764376 2019 dbSNP
rs1202379825 2023 dbSNP
rs142668569 2025 dbSNP
rs912421047 2025 dbSNP
rs1279347482 2027 dbSNP
rs1208406598 2028 dbSNP
rs529196554 2029 dbSNP
rs899793980 2030 dbSNP
rs1237749318 2031 dbSNP
rs1333475240 2033 dbSNP
rs1314505876 2039 dbSNP
rs1396267513 2042 dbSNP
rs1354362717 2046 dbSNP
rs1312687293 2049 dbSNP
rs542694128 2051 dbSNP
rs1433194186 2052 dbSNP
rs1363062013 2054 dbSNP
rs995922831 2056 dbSNP
rs1159751167 2067 dbSNP
rs1453218074 2070 dbSNP
rs1270558677 2073 dbSNP
rs1189629360 2074 dbSNP
rs1048417114 2075 dbSNP
rs1185586946 2076 dbSNP
rs887192030 2078 dbSNP
rs1004277925 2081 dbSNP
rs1361139562 2081 dbSNP
rs1025086205 2082 dbSNP
rs1285169752 2090 dbSNP
rs1244832412 2096 dbSNP
rs1354452910 2098 dbSNP
rs1291035705 2107 dbSNP
rs971315898 2110 dbSNP
rs1342756590 2112 dbSNP
rs35429903 2112 dbSNP
rs397867328 2112 dbSNP
rs398052682 2112 dbSNP
rs1382160775 2114 dbSNP
rs1383387271 2120 dbSNP
rs1462006382 2121 dbSNP
rs189760448 2121 dbSNP
rs1417458292 2122 dbSNP
rs1163044329 2127 dbSNP
rs1478715482 2133 dbSNP
rs1263652519 2135 dbSNP
rs1278168441 2137 dbSNP
rs1192124135 2146 dbSNP
rs1440921578 2146 dbSNP
rs148811101 2147 dbSNP
rs528052677 2150 dbSNP
rs1269316720 2153 dbSNP
rs1243084911 2155 dbSNP
rs958364073 2167 dbSNP
rs990213226 2172 dbSNP
rs1270959161 2176 dbSNP
rs1220100211 2184 dbSNP
rs1021339184 2189 dbSNP
rs1271169641 2203 dbSNP
rs1432173736 2209 dbSNP
rs201353954 2212 dbSNP
rs967099586 2212 dbSNP
rs1175108844 2222 dbSNP
rs1422543037 2225 dbSNP
rs1393810208 2230 dbSNP
rs912378492 2231 dbSNP
rs551206555 2238 dbSNP
rs1420450126 2240 dbSNP
rs1167131281 2242 dbSNP
rs180691813 2244 dbSNP
rs921172817 2247 dbSNP
rs1199488082 2250 dbSNP
rs1253960375 2252 dbSNP
rs564862506 2253 dbSNP
rs1250602015 2262 dbSNP
rs1199938655 2263 dbSNP
rs1048363638 2271 dbSNP
rs887138306 2272 dbSNP
rs778382098 2277 dbSNP
rs141668617 2279 dbSNP
rs1046483180 2284 dbSNP
rs71651665 2293 dbSNP
rs1224136295 2307 dbSNP
rs771245081 2309 dbSNP
rs1274340739 2322 dbSNP
rs1301386594 2324 dbSNP
rs1370826367 2324 dbSNP
rs147069073 2329 dbSNP
rs1225703862 2332 dbSNP
rs1285274414 2339 dbSNP
rs1328400346 2343 dbSNP
rs1033884894 2349 dbSNP
rs1404071562 2350 dbSNP
rs1173958054 2351 dbSNP
rs1453754702 2354 dbSNP
rs563386312 2354 dbSNP
rs1353436509 2357 dbSNP
rs1214985239 2359 dbSNP
rs553211173 2362 dbSNP
rs370384324 2367 dbSNP
rs1011184180 2374 dbSNP
rs1271612710 2374 dbSNP
rs1021285064 2379 dbSNP
rs1211998795 2389 dbSNP
rs1281177552 2389 dbSNP
rs1443725362 2389 dbSNP
rs1490658434 2391 dbSNP
rs1198020447 2397 dbSNP
rs71651666 2398 dbSNP
rs866174406 2400 dbSNP
rs1470907422 2402 dbSNP
rs1374143045 2405 dbSNP
rs1019793188 2407 dbSNP
rs71651667 2407 dbSNP
rs199776826 2409 dbSNP
rs1313283906 2410 dbSNP
rs1433842105 2415 dbSNP
rs558812994 2417 dbSNP
rs1417617545 2418 dbSNP
rs1400839030 2419 dbSNP
rs770291553 2433 dbSNP
rs921130705 2439 dbSNP
rs1473594692 2452 dbSNP
rs191051389 2460 dbSNP
rs1189160954 2471 dbSNP
rs1485531903 2480 dbSNP
rs1404286791 2484 dbSNP
rs1218545726 2488 dbSNP
rs1317988798 2494 dbSNP
rs543296471 2494 dbSNP
rs13047591 2495 dbSNP
rs1283689134 2497 dbSNP
rs984016852 2508 dbSNP
rs1322914628 2511 dbSNP
rs1329391962 2513 dbSNP
rs1294096213 2520 dbSNP
rs557191799 2527 dbSNP
rs1444503405 2534 dbSNP
rs1280348260 2540 dbSNP
rs908525781 2554 dbSNP
rs573836867 2561 dbSNP
rs1431392491 2565 dbSNP
rs940026733 2580 dbSNP
rs1156345206 2583 dbSNP
rs1406578071 2587 dbSNP
rs1418174060 2594 dbSNP
rs1163758865 2599 dbSNP
rs183804750 2604 dbSNP
rs1255866721 2606 dbSNP
rs1188610329 2609 dbSNP
rs559656451 2618 dbSNP
rs906602802 2639 dbSNP
rs1213780201 2650 dbSNP
rs528099258 2653 dbSNP
rs1469874893 2654 dbSNP
rs1274104283 2682 dbSNP
rs112288038 2685 dbSNP
rs1232912822 2687 dbSNP
rs938146291 2688 dbSNP
rs1055679947 2698 dbSNP
rs1279897342 2703 dbSNP
rs1214893330 2704 dbSNP
rs894001616 2712 dbSNP
rs1287016942 2714 dbSNP
rs1438074713 2732 dbSNP
rs1394565514 2735 dbSNP
rs1011131991 2736 dbSNP
rs1288400583 2739 dbSNP
rs1021221239 2740 dbSNP
rs1439038997 2747 dbSNP
rs902818830 2749 dbSNP
rs376957538 2766 dbSNP
rs71651668 2773 dbSNP
rs1419504484 2777 dbSNP
rs770591564 2787 dbSNP
rs1237125574 2792 dbSNP
rs1253708236 2794 dbSNP
rs1019316766 2797 dbSNP
rs965483319 2802 dbSNP
rs564871379 2804 dbSNP
rs1253273052 2808 dbSNP
rs1205010639 2812 dbSNP
rs1306702501 2817 dbSNP
rs868735864 2827 dbSNP
rs1371557369 2836 dbSNP
rs1389475007 2847 dbSNP
rs1302087870 2849 dbSNP
rs1438046709 2857 dbSNP
rs1402067548 2859 dbSNP
rs1385654455 2864 dbSNP
rs1462867984 2865 dbSNP
rs1354326990 2877 dbSNP
rs1168695129 2887 dbSNP
rs1423819512 2888 dbSNP
rs1028546719 2890 dbSNP
rs1460792987 2898 dbSNP
rs952565111 2906 dbSNP
rs983962822 2908 dbSNP
rs768773536 2910 dbSNP
rs865917569 2914 dbSNP
rs751137437 2927 dbSNP
rs548570200 2929 dbSNP
rs1177988058 2931 dbSNP
rs961309626 2937 dbSNP
rs530626023 2944 dbSNP
rs35609693 2946 dbSNP
rs550213082 2949 dbSNP
rs561155417 2958 dbSNP
rs1329633175 2964 dbSNP
rs1212706866 2966 dbSNP
rs530198777 2974 dbSNP
rs1279480305 2982 dbSNP
rs1231523146 2986 dbSNP
rs1444871761 2988 dbSNP
rs1307014444 2995 dbSNP
rs188295759 2997 dbSNP
rs1370673067 2998 dbSNP
rs368427310 2999 dbSNP
rs928008370 3001 dbSNP
rs567133055 3006 dbSNP
rs1282928779 3012 dbSNP
rs1342101199 3016 dbSNP
rs1159841012 3022 dbSNP
rs34074450 3025 dbSNP
rs1418755461 3038 dbSNP
rs1248656782 3039 dbSNP
rs774332456 3040 dbSNP
rs1055226730 3055 dbSNP
rs375530790 3063 dbSNP
rs1208657330 3064 dbSNP
rs1317249860 3064 dbSNP
rs1260833532 3068 dbSNP
rs538692894 3069 dbSNP
rs915357382 3070 dbSNP
rs946877490 3071 dbSNP
rs1312595138 3074 dbSNP
rs1042615882 3076 dbSNP
rs192499722 3078 dbSNP
rs1159244933 3084 dbSNP
rs569302117 3086 dbSNP
rs1362344792 3089 dbSNP
rs34230234 3090 dbSNP
rs1167350719 3096 dbSNP
rs1475623146 3099 dbSNP
rs1416900745 3101 dbSNP
rs1041096210 3107 dbSNP
rs900850131 3112 dbSNP
rs538346838 3115 dbSNP
rs1262315663 3118 dbSNP
rs996977960 3118 dbSNP
rs775565521 3120 dbSNP
rs952512745 3126 dbSNP
rs1233539820 3128 dbSNP
rs547938386 3136 dbSNP
rs1399615414 3141 dbSNP
rs36008029 3141 dbSNP
rs1293098650 3143 dbSNP
rs760684534 3143 dbSNP
rs761998620 3150 dbSNP
rs1328745464 3154 dbSNP
rs1015420006 3155 dbSNP
rs1381776740 3161 dbSNP
rs1386557092 3162 dbSNP
rs1464170254 3163 dbSNP
rs71651669 3166 dbSNP
rs772231695 3166 dbSNP
rs1161293254 3171 dbSNP
rs1476253882 3175 dbSNP
rs764050846 3177 dbSNP
rs1373643558 3192 dbSNP
rs1192368673 3194 dbSNP
rs1426607270 3195 dbSNP
rs1338942128 3202 dbSNP
rs1213733668 3208 dbSNP
rs1407191702 3215 dbSNP
rs1395748819 3217 dbSNP
rs961256505 3219 dbSNP
rs1208494310 3227 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ||  | | ||||||| 
Target 5' ---uuuCCCCUCUCUGCUGCUu 3'
1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                ||  | | ||||||| 
Target 5' ---uuuCCCCUCUCUGCUGCUu 3'
1 - 19
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000354828.3 | 3UTR | UUUCCCCUCUCUGCUGCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000354828.3 | 3UTR | UUUCCCCUCUCUGCUGCUUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.765 4.3e-5 0.809 7.8e-6 20 Click to see details
GSE21032 Prostate cancer 0.249 1.2e-2 0.269 7.0e-3 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.47 1.2e-2 -0.442 1.7e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.23 1.5e-2 -0.216 2.0e-2 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.416 1.9e-2 0.331 5.3e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.443 2.5e-2 -0.550 6.0e-3 20 Click to see details
GSE21687 Ependynoma primary tumors 0.189 6.7e-2 0.292 9.6e-3 64 Click to see details
GSE38226 Liver fibrosis -0.312 8.4e-2 -0.214 1.8e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.152 9.1e-2 0.175 6.1e-2 79 Click to see details
GSE21849 B cell lymphoma 0.251 9.5e-2 0.344 3.4e-2 29 Click to see details
GSE28260 Renal cortex and medulla -0.304 1.6e-1 -0.110 3.6e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.188 1.8e-1 0.196 1.7e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.212 2.5e-1 -0.084 4.0e-1 12 Click to see details
GSE27834 Pluripotent stem cells 0.17 2.6e-1 0.179 2.5e-1 16 Click to see details
GSE28544 Breast cancer 0.094 3.3e-1 0.130 2.7e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.091 3.4e-1 -0.019 4.6e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.073 3.5e-1 -0.032 4.3e-1 32 Click to see details
GSE17498 Multiple myeloma -0.056 3.7e-1 -0.052 3.7e-1 40 Click to see details
GSE17306 Multiple myeloma -0.02 4.5e-1 -0.031 4.2e-1 49 Click to see details
GSE19536 Breast cancer 0.009 4.6e-1 0.027 3.9e-1 100 Click to see details
GSE19536 Breast cancer 0.009 4.6e-1 0.027 3.9e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.36 0.02 -0.403 0.01 32 Click to see details
UCEC 0.397 0.05 0.312 0.1 19 Click to see details
KIRC 0.171 0.08 0.153 0.11 68 Click to see details
PAAD 0.795 0.1 0.800 0.1 4 Click to see details
HNSC -0.196 0.11 -0.139 0.19 42 Click to see details
LIHC -0.179 0.11 -0.176 0.11 49 Click to see details
BRCA 0.135 0.11 0.086 0.22 84 Click to see details
LUAD -0.259 0.21 -0.301 0.17 12 Click to see details
KICH -0.162 0.22 -0.081 0.35 25 Click to see details
BLCA -0.193 0.22 -0.271 0.14 18 Click to see details
LUSC 0.115 0.25 0.177 0.14 38 Click to see details
COAD -0.282 0.25 -0.643 0.04 8 Click to see details
ESCA -0.211 0.27 -0.355 0.14 11 Click to see details
CESC 0.602 0.29 0.500 0.33 3 Click to see details
PCPG -0.554 0.31 -0.500 0.33 3 Click to see details
THCA -0.063 0.32 -0.092 0.24 59 Click to see details
CHOL -0.165 0.34 -0.067 0.43 9 Click to see details
PRAD -0.046 0.38 0.035 0.4 50 Click to see details
KIRP -0.014 0.47 -0.015 0.47 32 Click to see details
KIRP -0.014 0.47 -0.015 0.47 32 Click to see details
KIRP -0.014 0.47 -0.015 0.47 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*