miRTarBase - #MIRT307141 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CTDSPL   
Synonyms C3orf8, HYA22, PSR1, RBSP3, SCP3
Description CTD small phosphatase like
Transcript NM_001008392   
Other Transcripts NM_005808   
Expression
Putative miRNA Targets on CTDSPL
3'UTR of CTDSPL
(miRNA target sites are highlighted)
>CTDSPL|NM_001008392|3'UTR
   1 CCCTGGCCTCTGCCTGCCTCCCGCCTGTGCACTCTGGAACCTCTGGCCTCAGGGGACCTGCCTGTCCTCAGCTCCCTGGG
  81 AGCTGAAAGTGAGGATACTCCGTGCTCCAGGCCACAGGGTGAATGTGGCCATGCCTACCTGTTTTGTTTTTTTAAGAACA
 161 GAAACAACTATTTTAAAAGAACTCTTTTAAGAAATTTCATAAAGGGACATGCATTTTACTGGGTTTGCTTTTCTTAAAAC
 241 ATACCAAAAAAGAAAAAAATAGAAAAAAAAAAAAAAAAAGCTTGATCTCTATCAGACTTCCTTTCAACTGTCCTCCCCTC
 321 CAAGCAGACCACCTGTCCCCTTCTATCCCAGCTCAGAGCAGCTGACCCAACTCAGAATCTCTTTCCTACAGGATGAAGTG
 401 CCTTTTGAATGTTATTTTAAGCCGAGAGTTAATTTTTCTACACAACATATTTCCAGACATCTTTTAGTCTTTTATTGTCT
 481 TAGATACTATAAGAAGATGAACATGACAATTTTCTAGAACCTGGTAGCGTGTGTGTGTGTGGCGGGGGGTGCTGAGGGAG
 561 GGGAGTGAGTCACAGGAGCCTGTCCCCCAACAGGTGTGACTGCTCTGACAACCTGTGGCATGCTGCAGGGTCAGGCTCCT
 641 GATAGGAGGATTTCATGACTATGTCATTGTCTCCACTCATTTTTGACCCAGTTTGGAATGTATCTGCAATTGTGTGGCTC
 721 AACACTTTAGGAAACAATAGATTATTTTATATTATTATTTCTGATGGTGACAAGTTTGTCTTGAGGTCACATTTTCTCCT
 801 TGAAAAGTGACATCCTGTCACTTCTGCTCTCACACTACTGCCATACATTTGTGTTTTTTGTTGTTATTGTTTGGGTAGAG
 881 CAGTTACAAGAAACCCTAAAACCCTTGGATATAAAAGAAATCTGTTTATTGATTTTTAAATCTTTCCTTTCCAAAAGCTG
 961 GATACACATGGAGCTGTTTGGGAATTTTCCTTGCTGCTACCGCGCTGCCACCAAATGGAATTGACCAGCGGCTGTTACAC
1041 TGTTCTTTGCCACTGTGCCTATGCTCAGAATATGCTCACTGCTAAGCTACAAACTCGGACAGGGTCAGAAACAGAGGTGT
1121 CCCATCCCATTGCAGCCTCCACCACCTGTAACCCCTTCCTGGCATTGGCCACTGAAGGGTACAAAGGCAAAAGGACCACA
1201 GCACCACTTAGGTGTAGCATGGATTTTAAACTGCAGTCAGTATCAGATCCTGTTTGATAAATAAGCTGACTGTTCTCTCT
1281 TGAGAACCTGTGGCCTCAACCAGCCACCAAGCTGATGTGGCCCAAGTCCATCTCTTGGTCTTCTCCTTTGAAGCACAGCC
1361 TATTTCTGAGCCAAGGGTTGGGGAAGCCTGTCTAGATGTGGGACTCATTGCCCCAAACCAGGGAGAGGAAGAGCTCCCAC
1441 AGGGAGAGCCCAGGCTCTCTTTGCAGCCTTTCCCAGTTTGGTGTTTAAGCAGTGCCATGTTCCTTGTTTGACAACAAGAC
1521 AGTCTGTAAAGTATTGCTCTTAAAAACAATTAAAAAGAACCCTTTCATATTGGCACCATTGCCTTAGTCCTCTGTGGGTT
1601 GGTCTTCAGCCAGCATTCTGGTGGGAGTGACTGGCATTAACAAGACTGGAAATCGGGGGTCAAAGTAAAATATCTTTGTT
1681 TTGCTTTCATTCACAAAGTAATGAAGCCAGCTGCCAATTACATCCTCCCAACAGCACTTTGGTCTGTGGACTGCTGTGTG
1761 AATATTCAGAAGGGAAGTAAGTATTCAGGGGGTAAACAGGTCTCCCAGCATTCTGAGTGTTCCAAACCAGTAATCCACAT
1841 GCCAATTCAAATAGAACAGCCCCTTGCTAGATATTACCACAGATAATGACAGTTACATGGTAGAACTGCCCATGCCACAA
1921 ATATTTATTTGGAAAAGTAGTCATTAAATGAACCCACTGCCTTAAATGTCTTGAATGTTGCAGTCAAGTGTCTGTCATGT
2001 GTTGATATCCACACAGAATTAGGCCCTAATGAGAGCCTTAGACCCTCAACCATGCCCCCTTCGTTGGCATCACAGGGCCT
2081 TATTTGGAAGAGCGGGCAAAGAGGATGGAAATCATAAAATATTTCATGGGAATCGAACCTAGGGATAGTGCTCCACTTCT
2161 GACGATGGAGTGAAGACACTTGGCAGACTTGAGCCAGACACTTCACCTAGTAGTTCCTGAAACTGTGAGCACCACTGCAC
2241 TAAGCCAGTGCGGAGCTGTTAGGGACGGGCCCAGCTCCTGCACCACGGACACAGAATGTCTGGAGAGGGCCAGCAGGCCC
2321 TCTGAGGGTTCTGGAATCTGTGCACCTTATTTGACCACACTCCAAAATTCTGTTTTTATTTTAACCCTTGAATCTGCTTT
2401 ATGTACATAATCAAAATATCTATATCTATATCTATATCTATATCTATATATTTTTAATCATCTACATGTAAATGAAGCAA
2481 TAGAATTCTAACATAAGGCCAAGAAATGAGACGAATGTTTGGGGTTTATGTTTTTTAAGGTAAATACGGGTATTGTTTTT
2561 AATTATTACCATGTATTAAATTGTGGGCTTTGAAACCTAATGAAACCTGTTAGCCACTTCTCTGTGCCATATACTTCCCA
2641 TGTTACCAAAATACCCCCAACTCTTTAGCCAAAAGAGAACCCTGACCTCCTGAGTTTCCATGCTCCTTTCTGTACCAGGT
2721 TTAAATGTAGTCTTCTGGAGAAGTATTTTTGACATTGAGCTCTGGGACAGGACACCTTGGGTTTGTGGACTGCAGCCCAC
2801 TATGATGTTATTACTTCTCTGGCCAGGCCTCCAGTGGAAGTGCACAGGCACTCCCAATGTTGTTAATGCTCTGTCTTCCA
2881 TTTGTTCTGGAATCCTACGTGTTGGTCTGTGGTTCCATGCATTAGCTGTTTGTAAATAATGCATTTGCATACTGAAAAAG
2961 GAATGCCACCTGCCACAGTTGATGGTGAGGAAGCTCCTTTGACGTGGTGCAATTTTGATGAGATGTCTCTGGGGACACGA
3041 GGATGCCCTAATGATGCTGACTTGTCATGGTTGCAGCATTTGAACTTTTGGTGTTAAAAAAAAAAACCTGTAAGTCTGTA
3121 ACCTGGCAACATTTTACAACCCTGTATTTTTAAAGATGGCTTTCTAATAAAAAATCCAGAACCACACAGCCCTATGGTCA
3201 AACAATCCTACGTTTGTGCCTCTGCTTTTAAAGGTGCTGTGCTGGACAGTTGGCATGCCAGGGTTCGAGAAGAGTGAATG
3281 GCTTGACGTACTTGCAGTTAACTGTGCAAAATTGGCTGGCTGCCTCTGTTCCTACTGTACTGTAACTTTGATCATGTCTG
3361 TTCCTGTTCCATTCTCCCAGGAGCTTCTCTGCAGACTGACACACCCTCCCCCACCCCGGGTAGTGGAGATGCTGGTGTCT
3441 GGGTAGTCATGGATTTCTGCTGGACATTTGAATGTGATAAACAATCCAGCATTACTTAGGAAATGCTACATGCGGAATGT
3521 GCACGTTTCCAGGGGCGAGTATTGTCAATCAAAAGGTTTGCAATGATTTCCTTCCTGCCAAAAATAAACATGTGAAACTG
3601 CA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             :||:: ||   ||||||| 
Target 5' tggGAATT-TTCCTTGCTGCTa 3'
979 - 999 146.00 -12.40
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            ||| |::| :  ||||||  
Target 5' gaCAACCTGTGGCATGCTGCag 3'
607 - 628 136.00 -12.20
3
miRNA  3' gugUUUGGUAAUAC-ACGAC-GAu 5'
             | :|| | ||| ||||| || 
Target 5' aggATGCCCTAATGATGCTGACTt 3'
3040 - 3063 127.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31962041 10 COSMIC
COSN31572488 62 COSMIC
COSN30164726 110 COSMIC
COSN15326632 124 COSMIC
COSN30538046 180 COSMIC
COSN24511633 199 COSMIC
COSN32252248 280 COSMIC
COSN30543590 362 COSMIC
COSN8489158 365 COSMIC
COSN28131593 412 COSMIC
COSN26643417 470 COSMIC
COSN28451664 541 COSMIC
COSN31575862 558 COSMIC
COSN31962042 579 COSMIC
COSN21857042 585 COSMIC
COSN1276604 586 COSMIC
COSN31609123 943 COSMIC
COSN28878060 971 COSMIC
COSN30575806 975 COSMIC
COSN28646819 1196 COSMIC
COSN6767369 1212 COSMIC
COSN31513431 1402 COSMIC
COSN2503847 1403 COSMIC
COSN31524455 1521 COSMIC
COSN31517871 1582 COSMIC
COSN26155145 1694 COSMIC
COSN1276605 1725 COSMIC
COSN32061246 1886 COSMIC
COSN31539812 1913 COSMIC
COSN28185950 1935 COSMIC
COSN28673576 2051 COSMIC
COSN8489159 2063 COSMIC
COSN31537098 2079 COSMIC
COSN31548152 2114 COSMIC
COSN31561960 2136 COSMIC
COSN31516448 2513 COSMIC
COSN31566573 2554 COSMIC
COSN17078238 2942 COSMIC
COSN27220440 3107 COSMIC
COSN27330299 3107 COSMIC
COSN1276606 3245 COSMIC
COSN26550357 3315 COSMIC
COSN20098293 3394 COSMIC
COSN28872114 3485 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1306577403 5 dbSNP
rs762824395 13 dbSNP
rs1009697243 15 dbSNP
rs1021159834 20 dbSNP
rs770753432 23 dbSNP
rs774112951 24 dbSNP
rs374217787 28 dbSNP
rs1252502040 32 dbSNP
rs753262642 33 dbSNP
rs1313651474 34 dbSNP
rs761020815 37 dbSNP
rs535149835 71 dbSNP
rs1361237148 72 dbSNP
rs1352525467 74 dbSNP
rs1301579520 75 dbSNP
rs879585147 78 dbSNP
rs1349158052 83 dbSNP
rs1034078267 86 dbSNP
rs959342169 102 dbSNP
rs1264430116 103 dbSNP
rs1405103014 106 dbSNP
rs1180869411 108 dbSNP
rs781639421 116 dbSNP
rs1472657231 123 dbSNP
rs1253505598 129 dbSNP
rs1196922003 133 dbSNP
rs1266057241 147 dbSNP
rs1488321289 147 dbSNP
rs1224356305 163 dbSNP
rs1315690759 164 dbSNP
rs1268092732 169 dbSNP
rs1229056891 170 dbSNP
rs1352472807 180 dbSNP
rs1485928000 183 dbSNP
rs551986927 185 dbSNP
rs973388808 188 dbSNP
rs961180119 198 dbSNP
rs981979895 214 dbSNP
rs920646055 224 dbSNP
rs1158408623 229 dbSNP
rs34667536 229 dbSNP
rs1206335207 243 dbSNP
rs1264545164 245 dbSNP
rs1413535805 246 dbSNP
rs1448175241 246 dbSNP
rs1030181071 253 dbSNP
rs1432254450 253 dbSNP
rs951475651 261 dbSNP
rs1232746983 263 dbSNP
rs1247938250 263 dbSNP
rs375264235 263 dbSNP
rs797018488 263 dbSNP
rs983215200 263 dbSNP
rs571852035 264 dbSNP
rs537341739 268 dbSNP
rs1349470601 278 dbSNP
rs1319728365 280 dbSNP
rs1454391001 280 dbSNP
rs78245739 281 dbSNP
rs937722679 282 dbSNP
rs990586577 285 dbSNP
rs1448044636 288 dbSNP
rs914868050 290 dbSNP
rs950804943 292 dbSNP
rs983688461 308 dbSNP
rs547243694 315 dbSNP
rs946398228 317 dbSNP
rs1483649221 319 dbSNP
rs766349020 325 dbSNP
rs1038975147 329 dbSNP
rs1225520488 330 dbSNP
rs921865242 333 dbSNP
rs909874850 334 dbSNP
rs935625735 335 dbSNP
rs1228999048 336 dbSNP
rs1367226796 347 dbSNP
rs1310543624 350 dbSNP
rs1384735163 353 dbSNP
rs1402382612 354 dbSNP
rs1243450066 355 dbSNP
rs902796883 357 dbSNP
rs774103807 371 dbSNP
rs569509684 372 dbSNP
rs891546350 378 dbSNP
rs148027928 383 dbSNP
rs1451765190 390 dbSNP
rs538749379 394 dbSNP
rs1463983261 423 dbSNP
rs564546406 424 dbSNP
rs900678291 441 dbSNP
rs996627844 448 dbSNP
rs1027759634 450 dbSNP
rs1203224028 474 dbSNP
rs887762671 491 dbSNP
rs906725152 503 dbSNP
rs1004137159 509 dbSNP
rs1413401612 521 dbSNP
rs1419861496 522 dbSNP
rs571788507 525 dbSNP
rs1015515895 528 dbSNP
rs1033907669 529 dbSNP
rs1314276157 529 dbSNP
rs773773535 529 dbSNP
rs141699705 530 dbSNP
rs982032377 534 dbSNP
rs959623489 536 dbSNP
rs112149111 544 dbSNP
rs1458882323 545 dbSNP
rs1370222464 550 dbSNP
rs963328328 551 dbSNP
rs1027651007 554 dbSNP
rs1180066994 564 dbSNP
rs1472333317 568 dbSNP
rs1252795310 580 dbSNP
rs1392765400 584 dbSNP
rs780582820 591 dbSNP
rs1439274142 601 dbSNP
rs990945845 613 dbSNP
rs983584528 626 dbSNP
rs915026502 627 dbSNP
rs946367247 630 dbSNP
rs1357004680 635 dbSNP
rs1267194728 639 dbSNP
rs977768050 643 dbSNP
rs533327037 644 dbSNP
rs1327865999 649 dbSNP
rs1411291178 650 dbSNP
rs911697241 675 dbSNP
rs1223546266 680 dbSNP
rs1323343484 688 dbSNP
rs1387745324 704 dbSNP
rs1393487668 715 dbSNP
rs1157661603 734 dbSNP
rs1456770757 736 dbSNP
rs965884221 738 dbSNP
rs1412799174 745 dbSNP
rs748800732 767 dbSNP
rs1264326642 772 dbSNP
rs1477176285 773 dbSNP
rs924188971 791 dbSNP
rs1197868424 805 dbSNP
rs944927513 811 dbSNP
rs1254804456 815 dbSNP
rs1206821152 827 dbSNP
rs974997838 830 dbSNP
rs1208514334 834 dbSNP
rs1268233732 840 dbSNP
rs900647394 868 dbSNP
rs557524852 875 dbSNP
rs932185058 876 dbSNP
rs1273931234 877 dbSNP
rs577769078 889 dbSNP
rs935941244 890 dbSNP
rs768166306 895 dbSNP
rs1481115195 902 dbSNP
rs1319049850 905 dbSNP
rs1179183504 906 dbSNP
rs184162511 909 dbSNP
rs543308891 914 dbSNP
rs1049592523 918 dbSNP
rs1249153597 927 dbSNP
rs1486562935 940 dbSNP
rs1412877765 941 dbSNP
rs1182209882 943 dbSNP
rs1255434791 946 dbSNP
rs764580744 949 dbSNP
rs912929717 965 dbSNP
rs1172654805 968 dbSNP
rs1478233075 970 dbSNP
rs1390804434 976 dbSNP
rs945767042 978 dbSNP
rs774024711 980 dbSNP
rs1377494550 1002 dbSNP
rs1449283570 1003 dbSNP
rs199705780 1004 dbSNP
rs747734370 1005 dbSNP
rs906959492 1008 dbSNP
rs1003680102 1009 dbSNP
rs1277471672 1016 dbSNP
rs1365373110 1017 dbSNP
rs1227008621 1022 dbSNP
rs1055704711 1026 dbSNP
rs895399702 1031 dbSNP
rs1350427673 1032 dbSNP
rs1203121395 1035 dbSNP
rs199614542 1036 dbSNP
rs995085213 1046 dbSNP
rs1210594674 1054 dbSNP
rs1027600506 1063 dbSNP
rs757586131 1064 dbSNP
rs950744186 1068 dbSNP
rs563614679 1069 dbSNP
rs1005312419 1077 dbSNP
rs529242803 1084 dbSNP
rs546721571 1090 dbSNP
rs1019002613 1093 dbSNP
rs187270186 1097 dbSNP
rs959454649 1098 dbSNP
rs974597679 1108 dbSNP
rs1377004117 1111 dbSNP
rs1166447720 1112 dbSNP
rs1284607251 1131 dbSNP
rs1390697637 1136 dbSNP
rs1370443748 1142 dbSNP
rs1012105756 1153 dbSNP
rs1236396585 1157 dbSNP
rs1187755878 1166 dbSNP
rs1028862584 1169 dbSNP
rs1278465175 1173 dbSNP
rs1204859638 1188 dbSNP
rs10095 1196 dbSNP
rs528588196 1201 dbSNP
rs1275720434 1203 dbSNP
rs913170184 1212 dbSNP
rs773049465 1213 dbSNP
rs981521655 1216 dbSNP
rs1416741731 1217 dbSNP
rs1348831025 1219 dbSNP
rs1307717785 1222 dbSNP
rs928364387 1233 dbSNP
rs1428862808 1236 dbSNP
rs977820506 1253 dbSNP
rs1172371029 1259 dbSNP
rs781615830 1262 dbSNP
rs551952101 1266 dbSNP
rs1163302737 1278 dbSNP
rs937126483 1283 dbSNP
rs1200314574 1285 dbSNP
rs965704710 1288 dbSNP
rs1055213440 1296 dbSNP
rs535500399 1307 dbSNP
rs1181100178 1321 dbSNP
rs1483549927 1322 dbSNP
rs1234979370 1340 dbSNP
rs930879876 1368 dbSNP
rs1190558171 1372 dbSNP
rs1049280220 1377 dbSNP
rs1321608506 1379 dbSNP
rs1291281078 1388 dbSNP
rs886707113 1397 dbSNP
rs1004853101 1398 dbSNP
rs571702768 1407 dbSNP
rs766275999 1414 dbSNP
rs1410679323 1418 dbSNP
rs1373724335 1421 dbSNP
rs1299699645 1426 dbSNP
rs901916357 1429 dbSNP
rs996692017 1438 dbSNP
rs1028810167 1441 dbSNP
rs1349207020 1443 dbSNP
rs1165641110 1456 dbSNP
rs79391721 1466 dbSNP
rs989994997 1469 dbSNP
rs192175061 1481 dbSNP
rs1036465144 1498 dbSNP
rs907173184 1519 dbSNP
rs1189818376 1521 dbSNP
rs372238850 1527 dbSNP
rs1247793013 1540 dbSNP
rs1216101590 1544 dbSNP
rs771383446 1561 dbSNP
rs1347625751 1567 dbSNP
rs928324170 1570 dbSNP
rs937094396 1571 dbSNP
rs991224133 1577 dbSNP
rs1274800178 1580 dbSNP
rs919697063 1583 dbSNP
rs930785562 1591 dbSNP
rs1363245071 1610 dbSNP
rs879053400 1621 dbSNP
rs1049229352 1626 dbSNP
rs1318926752 1628 dbSNP
rs1231128753 1634 dbSNP
rs886656853 1635 dbSNP
rs764200902 1638 dbSNP
rs1326422980 1655 dbSNP
rs1443036866 1655 dbSNP
rs940972003 1656 dbSNP
rs1243768406 1657 dbSNP
rs1022051082 1664 dbSNP
rs1040360580 1666 dbSNP
rs1449004973 1668 dbSNP
rs1186735042 1674 dbSNP
rs1397163386 1675 dbSNP
rs1415220703 1676 dbSNP
rs1175810022 1679 dbSNP
rs751841541 1683 dbSNP
rs183050771 1695 dbSNP
rs145967390 1701 dbSNP
rs1388518144 1702 dbSNP
rs1161768178 1703 dbSNP
rs758516128 1704 dbSNP
rs1029052627 1708 dbSNP
rs893232434 1710 dbSNP
rs1413718920 1711 dbSNP
rs1294715389 1715 dbSNP
rs1467849394 1717 dbSNP
rs1369310604 1718 dbSNP
rs1335657397 1723 dbSNP
rs1486923568 1724 dbSNP
rs1219388990 1725 dbSNP
rs1209692866 1733 dbSNP
rs767843185 1735 dbSNP
rs779928145 1736 dbSNP
rs1397233265 1737 dbSNP
rs1210345417 1749 dbSNP
rs1268752091 1751 dbSNP
rs1464365428 1754 dbSNP
rs1020169407 1755 dbSNP
rs747103604 1757 dbSNP
rs1296858104 1773 dbSNP
rs1382290510 1775 dbSNP
rs1386494845 1778 dbSNP
rs1478480203 1778 dbSNP
rs10574398 1787 dbSNP
rs1300653994 1787 dbSNP
rs1190894295 1788 dbSNP
rs966088396 1790 dbSNP
rs1421300225 1793 dbSNP
rs1160323711 1798 dbSNP
rs1390090989 1801 dbSNP
rs1388587275 1803 dbSNP
rs769673698 1805 dbSNP
rs1317975759 1806 dbSNP
rs1194604599 1809 dbSNP
rs1321689636 1815 dbSNP
rs1351052319 1817 dbSNP
rs750797615 1820 dbSNP
rs1256809107 1823 dbSNP
rs756477392 1824 dbSNP
rs1181453162 1838 dbSNP
rs1364934168 1848 dbSNP
rs1282792494 1853 dbSNP
rs1212735512 1884 dbSNP
rs35294369 1893 dbSNP
rs1247127420 1898 dbSNP
rs1003231389 1899 dbSNP
rs1035345182 1901 dbSNP
rs1286193554 1910 dbSNP
rs958593387 1916 dbSNP
rs1228081898 1921 dbSNP
rs1354476085 1924 dbSNP
rs187387844 1937 dbSNP
rs1309991703 1940 dbSNP
rs919644820 1942 dbSNP
rs1394985509 1949 dbSNP
rs953619601 1951 dbSNP
rs567053284 1967 dbSNP
rs780451295 1969 dbSNP
rs1314392660 1972 dbSNP
rs1227850404 1977 dbSNP
rs1370342257 1978 dbSNP
rs749764982 1982 dbSNP
rs985448277 1983 dbSNP
rs1466244226 1986 dbSNP
rs534367073 1995 dbSNP
rs984923729 1998 dbSNP
rs940851791 1999 dbSNP
rs908062274 2010 dbSNP
rs773149996 2018 dbSNP
rs1036433635 2031 dbSNP
rs928728108 2036 dbSNP
rs1247267369 2038 dbSNP
rs1259867011 2040 dbSNP
rs940932391 2042 dbSNP
rs1461628235 2045 dbSNP
rs11129775 2051 dbSNP
rs1481915517 2052 dbSNP
rs923559168 2056 dbSNP
rs1055833920 2057 dbSNP
rs879629599 2059 dbSNP
rs11709029 2063 dbSNP
rs375209790 2064 dbSNP
rs1043645241 2074 dbSNP
rs893222532 2078 dbSNP
rs747645056 2080 dbSNP
rs1041539121 2094 dbSNP
rs1157634053 2095 dbSNP
rs999346518 2098 dbSNP
rs1393544830 2107 dbSNP
rs903039735 2114 dbSNP
rs1389181082 2121 dbSNP
rs1388491344 2128 dbSNP
rs77923385 2135 dbSNP
rs1035988968 2136 dbSNP
rs958624899 2139 dbSNP
rs1461966273 2144 dbSNP
rs1420128768 2148 dbSNP
rs1157151620 2160 dbSNP
rs901626456 2162 dbSNP
rs115135888 2165 dbSNP
rs1026649121 2170 dbSNP
rs1182230005 2189 dbSNP
rs952448336 2191 dbSNP
rs1280299995 2192 dbSNP
rs1212999612 2195 dbSNP
rs982517087 2202 dbSNP
rs558012435 2210 dbSNP
rs962491293 2213 dbSNP
rs1226606835 2219 dbSNP
rs1267451382 2221 dbSNP
rs75142232 2226 dbSNP
rs985011632 2227 dbSNP
rs746801560 2232 dbSNP
rs1279825593 2234 dbSNP
rs932260729 2235 dbSNP
rs542982572 2241 dbSNP
rs1050409374 2251 dbSNP
rs766989431 2253 dbSNP
rs1301115104 2255 dbSNP
rs1202035334 2257 dbSNP
rs947435021 2259 dbSNP
rs1042172047 2260 dbSNP
rs903281823 2267 dbSNP
rs79505957 2268 dbSNP
rs1318585111 2271 dbSNP
rs1056970237 2273 dbSNP
rs894397093 2282 dbSNP
rs1012822953 2288 dbSNP
rs1471001504 2290 dbSNP
rs1375735918 2295 dbSNP
rs571502520 2299 dbSNP
rs1192877173 2301 dbSNP
rs1454682895 2302 dbSNP
rs1026588256 2303 dbSNP
rs1254861355 2308 dbSNP
rs938747067 2309 dbSNP
rs73058996 2318 dbSNP
rs191920665 2325 dbSNP
rs1180791938 2332 dbSNP
rs565395240 2357 dbSNP
rs1411922787 2358 dbSNP
rs1343250891 2369 dbSNP
rs1303167281 2371 dbSNP
rs1470585002 2387 dbSNP
rs1174735184 2388 dbSNP
rs1015724793 2408 dbSNP
rs947390019 2415 dbSNP
rs1311984264 2416 dbSNP
rs140359516 2416 dbSNP
rs377492187 2416 dbSNP
rs535742965 2416 dbSNP
rs547650422 2416 dbSNP
rs549785731 2416 dbSNP
rs568390826 2416 dbSNP
rs57451778 2416 dbSNP
rs774963333 2416 dbSNP
rs1435161147 2417 dbSNP
rs1400530885 2418 dbSNP
rs1043612782 2422 dbSNP
rs903805899 2423 dbSNP
rs965158613 2427 dbSNP
rs1279221650 2435 dbSNP
rs1440306994 2435 dbSNP
rs1212025632 2441 dbSNP
rs976653522 2443 dbSNP
rs1350585529 2445 dbSNP
rs1273027241 2447 dbSNP
rs528476456 2447 dbSNP
rs1030533129 2449 dbSNP
rs530988091 2457 dbSNP
rs1272033882 2463 dbSNP
rs551134603 2467 dbSNP
rs1329828613 2469 dbSNP
rs1352505821 2476 dbSNP
rs1408122447 2483 dbSNP
rs1287805085 2487 dbSNP
rs953597161 2499 dbSNP
rs759458757 2513 dbSNP
rs901674399 2514 dbSNP
rs1415168495 2515 dbSNP
rs1377057586 2516 dbSNP
rs1235346610 2517 dbSNP
rs1254106529 2531 dbSNP
rs1409332434 2545 dbSNP
rs1344077933 2548 dbSNP
rs997249716 2549 dbSNP
rs1196112335 2556 dbSNP
rs1029171607 2557 dbSNP
rs1188225125 2561 dbSNP
rs914839081 2579 dbSNP
rs117337275 2583 dbSNP
rs1250096775 2588 dbSNP
rs1204394047 2589 dbSNP
rs530321796 2593 dbSNP
rs888773471 2601 dbSNP
rs1226670635 2613 dbSNP
rs765249496 2618 dbSNP
rs781476898 2638 dbSNP
rs546890620 2639 dbSNP
rs1294067047 2640 dbSNP
rs1064192 2656 dbSNP
rs1235389564 2677 dbSNP
rs1016522849 2680 dbSNP
rs1201650337 2681 dbSNP
rs1441268953 2682 dbSNP
rs1376386798 2683 dbSNP
rs977450125 2685 dbSNP
rs1330891371 2693 dbSNP
rs565292917 2698 dbSNP
rs924654570 2703 dbSNP
rs1416542781 2704 dbSNP
rs1165135954 2706 dbSNP
rs1477917816 2708 dbSNP
rs1168830142 2713 dbSNP
rs962322322 2733 dbSNP
rs1476002206 2755 dbSNP
rs112902991 2756 dbSNP
rs1176966600 2758 dbSNP
rs1235101398 2761 dbSNP
rs1220013530 2763 dbSNP
rs774636628 2769 dbSNP
rs894344728 2770 dbSNP
rs960504050 2776 dbSNP
rs1215675580 2779 dbSNP
rs948570610 2789 dbSNP
rs1327311095 2790 dbSNP
rs1306630196 2796 dbSNP
rs1222992056 2798 dbSNP
rs1048277305 2800 dbSNP
rs1373792182 2803 dbSNP
rs879031997 2808 dbSNP
rs139392831 2809 dbSNP
rs1438654319 2811 dbSNP
rs1393048906 2841 dbSNP
rs187988618 2842 dbSNP
rs1015294360 2843 dbSNP
rs900917335 2844 dbSNP
rs1158014062 2846 dbSNP
rs1419985118 2860 dbSNP
rs1189940874 2863 dbSNP
rs997970207 2863 dbSNP
rs1227941039 2864 dbSNP
rs1454192496 2879 dbSNP
rs150041889 2885 dbSNP
rs750611740 2888 dbSNP
rs1416434251 2889 dbSNP
rs1339701884 2898 dbSNP
rs1030491529 2900 dbSNP
rs1216788143 2910 dbSNP
rs1317240959 2912 dbSNP
rs1286125590 2918 dbSNP
rs1231860369 2925 dbSNP
rs1052798489 2936 dbSNP
rs1304148440 2943 dbSNP
rs1442461971 2948 dbSNP
rs1359265345 2950 dbSNP
rs1287870969 2953 dbSNP
rs953496492 2961 dbSNP
rs1346636197 2962 dbSNP
rs1052570667 2969 dbSNP
rs536779770 2971 dbSNP
rs1434549367 2981 dbSNP
rs557109005 2996 dbSNP
rs1396205545 2997 dbSNP
rs1207501851 3004 dbSNP
rs1021845252 3005 dbSNP
rs756469981 3007 dbSNP
rs114207812 3010 dbSNP
rs1189679289 3015 dbSNP
rs977815886 3024 dbSNP
rs1392434888 3029 dbSNP
rs924672299 3031 dbSNP
rs1486954868 3033 dbSNP
rs1235997182 3040 dbSNP
rs1208450307 3049 dbSNP
rs938744199 3052 dbSNP
rs1280879944 3062 dbSNP
rs1168234021 3064 dbSNP
rs992900615 3069 dbSNP
rs113710751 3077 dbSNP
rs1382344072 3094 dbSNP
rs1363616543 3095 dbSNP
rs372254919 3096 dbSNP
rs878927808 3096 dbSNP
rs1459556723 3106 dbSNP
rs1291832824 3107 dbSNP
rs1390002897 3121 dbSNP
rs553314174 3131 dbSNP
rs1037336705 3137 dbSNP
rs1171200091 3140 dbSNP
rs1362772247 3141 dbSNP
rs1430438791 3142 dbSNP
rs1415952175 3144 dbSNP
rs1048225255 3147 dbSNP
rs1485191818 3160 dbSNP
rs1257999100 3161 dbSNP
rs993728351 3175 dbSNP
rs1479603077 3206 dbSNP
rs1250745480 3208 dbSNP
rs888356784 3211 dbSNP
rs1315337007 3212 dbSNP
rs939993023 3213 dbSNP
rs1037087652 3219 dbSNP
rs573240813 3226 dbSNP
rs998272249 3229 dbSNP
rs1049482172 3234 dbSNP
rs755537888 3243 dbSNP
rs1390078620 3251 dbSNP
rs1323121856 3255 dbSNP
rs1463533653 3267 dbSNP
rs545409318 3268 dbSNP
rs1164424982 3272 dbSNP
rs1475638414 3278 dbSNP
rs1420353406 3280 dbSNP
rs7633400 3288 dbSNP
rs1417088961 3289 dbSNP
rs1264336830 3300 dbSNP
rs1196371949 3305 dbSNP
rs1023049309 3306 dbSNP
rs1270769959 3310 dbSNP
rs1350694849 3313 dbSNP
rs1212558380 3320 dbSNP
rs752253197 3326 dbSNP
rs1294760374 3328 dbSNP
rs1209913792 3330 dbSNP
rs1365029456 3335 dbSNP
rs575680561 3338 dbSNP
rs1288707330 3340 dbSNP
rs1308317652 3342 dbSNP
rs978816065 3347 dbSNP
rs76657333 3356 dbSNP
rs1325252219 3357 dbSNP
rs1291929422 3359 dbSNP
rs1452310437 3361 dbSNP
rs1220897300 3364 dbSNP
rs1245242323 3372 dbSNP
rs192266087 3377 dbSNP
rs184292727 3378 dbSNP
rs923204082 3386 dbSNP
rs1182398805 3392 dbSNP
rs1441424807 3392 dbSNP
rs60500371 3393 dbSNP
rs759840493 3393 dbSNP
rs1192396503 3394 dbSNP
rs575963533 3401 dbSNP
rs1167824655 3403 dbSNP
rs754769358 3408 dbSNP
rs190465310 3409 dbSNP
rs1163428602 3410 dbSNP
rs1347793606 3411 dbSNP
rs1411224153 3412 dbSNP
rs910395248 3413 dbSNP
rs1349711861 3415 dbSNP
rs1467152195 3416 dbSNP
rs770642239 3418 dbSNP
rs1285929392 3419 dbSNP
rs1356924431 3426 dbSNP
rs1395692824 3428 dbSNP
rs781063196 3429 dbSNP
rs1287752513 3430 dbSNP
rs999138401 3431 dbSNP
rs1206056673 3435 dbSNP
rs1251357019 3436 dbSNP
rs1303323793 3438 dbSNP
rs1441730287 3442 dbSNP
rs1482312576 3444 dbSNP
rs1190024888 3447 dbSNP
rs758739481 3453 dbSNP
rs1373364422 3461 dbSNP
rs1316467036 3467 dbSNP
rs1400386202 3474 dbSNP
rs1393942447 3477 dbSNP
rs993193504 3480 dbSNP
rs1421301841 3491 dbSNP
rs1393120529 3496 dbSNP
rs1057366052 3500 dbSNP
rs1311485938 3511 dbSNP
rs896098088 3514 dbSNP
rs546851935 3515 dbSNP
rs1190533593 3520 dbSNP
rs780455323 3522 dbSNP
rs369753273 3525 dbSNP
rs781095938 3526 dbSNP
rs1262014366 3537 dbSNP
rs745650114 3538 dbSNP
rs1346252770 3546 dbSNP
rs769889776 3548 dbSNP
rs560432975 3552 dbSNP
rs915963448 3557 dbSNP
rs1270633120 3564 dbSNP
rs544605013 3572 dbSNP
rs1268453655 3590 dbSNP
rs1208571694 3592 dbSNP
rs983917191 3602 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ||:: ||   ||||||| 
Target 5' ----AAUU-UUCCUUGCUGCUa 3'
1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              ||:: ||   ||||||| 
Target 5' ----AAUU-UUCCUUGCUGCUa 3'
1 - 17
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000443503.2 | 3UTR | aauuuuccuugcugcuacc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000443503.2 | 3UTR | aauuuuccuugcugcuaccg
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.307 9.5e-4 0.205 2.0e-2 100 Click to see details
GSE19783 ER- ER- breast cancer 0.252 1.3e-2 0.166 7.2e-2 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.425 2.2e-2 -0.373 4.0e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.55 2.6e-2 -0.522 3.4e-2 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.438 2.7e-2 0.388 4.5e-2 20 Click to see details
GSE38226 Liver fibrosis -0.398 3.7e-2 -0.355 5.7e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.319 6.4e-2 0.299 7.8e-2 24 Click to see details
GSE21032 Prostate cancer -0.158 7.7e-2 -0.244 1.3e-2 83 Click to see details
GSE14794 Lymphoblastoid cells 0.139 9.6e-2 0.259 6.9e-3 90 Click to see details
GSE21849 B cell lymphoma -0.212 1.3e-1 0.371 2.4e-2 29 Click to see details
GSE19350 CNS germ cell tumors 0.339 1.4e-1 0.154 3.2e-1 12 Click to see details
GSE17498 Multiple myeloma 0.169 1.5e-1 -0.008 4.8e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.189 1.8e-1 0.173 2.0e-1 25 Click to see details
GSE28544 Breast cancer 0.134 2.7e-1 0.424 1.9e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.111 3.2e-1 0.107 3.3e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.054 3.8e-1 -0.012 4.7e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.045 4.2e-1 -0.107 3.1e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.016 4.8e-1 -0.015 4.8e-1 16 Click to see details
GSE17306 Multiple myeloma -0.007 4.8e-1 -0.133 1.8e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.005 4.8e-1 0.022 4.3e-1 64 Click to see details
GSE21687 Ependynoma primary tumors -0.005 4.8e-1 0.022 4.3e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.723 0 -0.734 0 32 Click to see details
PAAD -0.977 0.01 -0.800 0.1 4 Click to see details
BRCA -0.247 0.01 -0.272 0.01 84 Click to see details
KIRC -0.256 0.02 -0.228 0.03 68 Click to see details
LUSC -0.282 0.04 -0.267 0.05 38 Click to see details
THCA -0.217 0.05 -0.350 0 59 Click to see details
UCEC 0.353 0.07 0.414 0.04 19 Click to see details
HNSC -0.181 0.13 -0.091 0.28 42 Click to see details
COAD 0.382 0.18 0.095 0.41 8 Click to see details
BLCA -0.229 0.18 -0.168 0.25 18 Click to see details
LIHC -0.117 0.21 -0.066 0.33 49 Click to see details
KIRP 0.069 0.35 0.053 0.39 32 Click to see details
PCPG -0.443 0.35 -0.500 0.33 3 Click to see details
LUAD -0.082 0.4 -0.021 0.47 12 Click to see details
CHOL -0.097 0.4 -0.217 0.29 9 Click to see details
ESCA 0.07 0.42 0.027 0.47 11 Click to see details
PRAD 0.023 0.44 0.076 0.3 50 Click to see details
CESC 0.137 0.46 0.500 0.33 3 Click to see details
KICH -0.011 0.48 0.063 0.38 25 Click to see details
KICH -0.011 0.48 0.063 0.38 25 Click to see details
KICH -0.011 0.48 0.063 0.38 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*