miRTarBase - #MIRT313675 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ITGA2   
Synonyms BR, CD49B, GPIa, HPA-5, VLA-2, VLAA2
Description integrin subunit alpha 2
Transcript NM_002203   
Expression
Putative miRNA Targets on ITGA2
3'UTR of ITGA2
(miRNA target sites are highlighted)
>ITGA2|NM_002203|3'UTR
   1 ACCAGCAGACCTACCTGCAGTGGGAACCGGCAGCATCCCAGCCAGGGTTTGCTGTTTGCGTGAATGGATTTCTTTTTAAA
  81 TCCCATATTTTTTTTATCATGTCGTAGGTAAACTAACCTGGTATTTTAAGAGAAAACTGCAGGTCAGTTTGGAATGAAGA
 161 AATTGTGGGGGGTGGGGGAGGTGCGGGGGGCAGGTAGGGAAATAATAGGGAAAATACCTATTTTATATGATGGGGGAAAA
 241 AAAGTAATCTTTAAACTGGCTGGCCCAGAGTTTACATTCTAATTTGCATTGTGTCAGAAACATGAAATGCTTCCAAGCAT
 321 GACAACTTTTAAAGAAAAATATGATACTCTCAGATTTTAAGGGGGAAAACTGTTCTCTTTAAAATATTTGTCTTTAAACA
 401 GCAACTACAGAAGTGGAAGTGCTTGATATGTAAGTACTTCCACTTGTGTATATTTTAATGAATATTGATGTTAACAAGAG
 481 GGGAAAACAAAACACAGGTTTTTTCAATTTATGCTGCTCATCCAAAGTTGCCACAGATGATACTTCCAAGTGATAATTTT
 561 ATTTATAAACTAGGTAAAATTTGTTGTTGGTTCCTTTTAGACCACGGCTGCCCCTTCCACACCCCATCTTGCTCTAATGA
 641 TCAAAACATGCTTGAATAACTGAGCTTAGAGTATACCTCCTATATGTCCATTTAAGTTAGGAGAGGGGGCGATATAGAGA
 721 ATAAGGCACAAAATTTTGTTTAAAACTCAGAATATAACATGTAAAATCCCATCTGCTAGAAGCCCATCCTGTGCCAGAGG
 801 AAGGAAAAGGAGGAAATTTCCTTTCTCTTTTAGGAGGCACAACAGTTCTCTTCTAGGATTTGTTTGGCTGACTGGCAGTA
 881 ACCTAGTGAATTTCTGAAAGATGAGTAATTTCTTTGGCAACCTTCCTCCTCCCTTACTGAACCACTCTCCCACCTCCTGG
 961 TGGTACCATTATTATAGAAGCCCTCTACAGCCTGACTTTCTCTCCAGCGGTCCAAAGTTATCCCCTCCTTTACCCCTCAT
1041 CCAAAGTTCCCACTCCTTCAGGACAGCTGCTGTGCATTAGATATTAGGGGGGAAAGTCATCTGTTTAATTTACACACTTG
1121 CATGAATTACTGTATATAAACTCCTTAACTTCAGGGAGCTATTTTCATTTAGTGCTAAACAAGTAAGAAAAATAAGCTCG
1201 AGTGAATTTCTAAATGTTGGAATGTTATGGGATGTAAACAATGTAAAGTAAGACATCTCAGGATTTCACCAGAAGTTACA
1281 GATGAGGCACTGGAAGCCACCAAATTAGCAGGTGCACCTTCTGTGGCTGTCTTGTTTCTGAAGTACTTAAACTTCCACAA
1361 GAGTGAATTTGACCTAGGCAAGTTTGTTCAAAAGGTAGATCCTGAGATGATTTGGTCAGATTGGGATAAGGCCCAGCAAT
1441 CTGCATTTTAACAAGCACCCCAGTCACTAGGATGCAGATGGACCACACTTTGAGAAACACCACCCATTTCTACTTTTTGC
1521 ACCTTATTTTCTCTGTTCCTGAGCCCCCACATTCTCTAGGAGAAACTTAGAGGAAAAGGGCACAGACACTACATATCTAA
1601 AGCTTTGGACAAGTCCTTGACCTCTATAAACTTCAGAGTCCTCATTATAAAATGGGAAGACTGAGCTGGAGTTCAGCAGT
1681 GATGCTTTTAGTTTTAAAAGTCTATGATCTGGACTTCCTATAATACAAATACACAATCCTCCAAGAATTTGACTTGGAAA
1761 AAAATGTCAAAGGAAAACAGGTTATCTGCCCATGTGCATATGGACAACCTTGACTACCCTGGCCTGGCCCGTGGTGGCAG
1841 TCCAGGGCTATCTGTACTGTTTACAGAATTACTTTGTAGTTGACAACACAAAACAAACAAAAAAGGCATAAAATGCCAGC
1921 GGTTTATAGAAAAAACAGCATGGTATTCTCCAGTTAGGTATGCCAGAGTCCAATTCTTTTAACAGCTGTGAGAATTTGCT
2001 GCTTCATTCCAACAAAATTTTATTTAAAAAAAAAAAAAAAAGACTGGAGAAACTAGTCATTAGCTTGATAAAGAATATTT
2081 AACAGCTAGTGGTGCTGGTGTGTACCTGAAGCTCCAGCTACTTGAGAGACTGAGACAGGAAGATCGCTTGAGCCCAGGAG
2161 TTCAAGTCCAGCCTAAGCAACATAGCAAGACCCTGTCTCAAAAAAATGACTATTTAAAAAGACAATGTGGCCAGGCACGG
2241 TGGCTCACACCTGTAATCCCAACACTTTGGGAGGCTGAGGCCGGTGGATCACGAGGTCAGGAGTTTGAGACTAGCCTGGC
2321 CAACATGGTGAAACCCCATCTCTAATAATATAAAAATTAGCTGGGCGTAGTAGCAGGTGCCTGTAATCCCAGTTACTCGG
2401 GAAGCTGAGGCAGGAGAATCACTTGAACCCGGGAGGCAGAGGTTTCAGTGAGCCGAGATCGCGCCACTGCACTCCAGCCT
2481 GGGTGACAGGGCAAGACTCTGTCTCAAACAAACAAACAAAAAAAAAGTTAGTACTGTATATGTAAATACTAGCTTTTCAA
2561 TGTGCTATACAAACAATTATAGCACATCCTTCCTTTTACTCTGTCTCACCTCCTTTAGGTGAGTACTTCCTTAAATAAGT
2641 GCTAAACATACATATACGGAACTTGAAAGCTTTGGTTAGCCTTGCCTTAGGTAATCAGCCTAGTTTACACTGTTTCCAGG
2721 GAGTAGTTGAATTACTATAAACCATTAGCCACTTGTCTCTGCACCATTTATCACACCAGGACAGGGTCTCTCAACCTGGG
2801 CGCTACTGTCATTTGGGGCCAGGTGATTCTTCCTTGCAGGGGCTGTCCTGTACCTTGTAGGACAGCAGCCCTGTCCTAGA
2881 AGGTATGTTTAGCAGCATTCCTGGCCTCTAGCTACCCGATGCCAGAGCATGCTCCCCCCGCAGTCATGACAATCAAAAAA
2961 TGTCTCCAGACATTGTCAAATGCCTCCTGGGGGGCAGTATTTCTCAAGCACTTTTAAGCAAAGGTAAGTATTCATACAAG
3041 AAATTTAGGGGGAAAAAACATTGTTTAAATAAAAGCTATGTGTTCCTATTCAACAATATTTTTGCTTTAAAAGTAAGTAG
3121 AGGGCATAAAAGATGTCATATTCAAATTTCCATTTCATAAATGGTGTACAGACAAGGTCTATAGAATGTGGTAAAAACTT
3201 GACTGCAACACAAGGCTTATAAAATAGTAAGATAGTAAAATAGCTTATGAAGAAACTACAGAGATTTAAAATTGTGCATG
3281 ACTCATTTCAGCAGCAAAATAAGAACTCCTAACTGAACAGAAATTTTTCTACCTAGCAATGTTATTCTTGTAAAATAGTT
3361 ACCTATTAAAACTGTGAAGAGTAAAACTAAAGCCAATTTATTATAGTCACACAAGTGATTATACTAAAAATTATTATAAA
3441 GGTTATAATTTTATAATGTATTTACCTGTCCTGATATATAGCTATAACCCAATATATGAAAATCTCAAAAATTAAGACAT
3521 CATCATACAGAAGGCAGGATTCCTTAAACTGAGATCCCTGATCCATCTTTAATATTTCAATTTGCACACATAAAACAATG
3601 CCCTTTTGTGTACATTCAGGCATACCCATTTTAATCAATTTGAAAGGTTAATTTAAACCTCTAGAGGTGAATGAGAAACA
3681 TGGGGGAAAAGTATGAAATAGGTGAAAATCTTAACTATTTCTTTGAACTCTAAAGACTGAAACTGTAGCCATTATGTAAA
3761 TAAAGTTTCATATGTACCTGTTTATTTTGGCAGATTAAGTCAAAATATGAATGTATATATTGCATAACTATGTTAGAATT
3841 GTATATATTTTAAAGAAATTGTCTTGGATATTTTCCTTTATACATAATAGATAAGTCTTTTTTCAAATGTGGTGTTTGAT
3921 GTTTTTGATTAAATGTGTTTTGCCTCTTTCCACAAAAACTGTAAAAATAAATGCATGTTTGTACAAAAAGTTGCAGAATT
4001 CATTTGATTTATGAGAAACAAAAATTAAATTGTAGTCAACAGTTAGTAGTTTTTCTCATATCCAAGTATAACAAACAGAA
4081 AAGTTTCATTATTGTAACCCACTTTTTTCATACCACATTATTGAATATTGTTACAATTGTTTTGAAAATAAAGCCATTTT
4161 CTTTGGGCTTTTATAAGTTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                :|| | | ||||||| 
Target 5' gtttttTCAATTTATGCTGCTc 3'
498 - 519 152.00 -8.80
2
miRNA  3' guguUUGGUA---AUACACGACGAu 5'
              |:|::|    || ||||||| 
Target 5' taacAGCTGTGAGAATTTGCTGCTt 3'
1980 - 2004 150.00 -10.60
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | |:|||  :| |||||:| 
Target 5' tcCCAGCCAGGGTTTGCTGTTt 3'
36 - 57 144.00 -13.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
353783 30 ClinVar
353784 36 ClinVar
353785 61 ClinVar
353786 61 ClinVar
905942 68 ClinVar
353787 88 ClinVar
353788 209 ClinVar
353789 232 ClinVar
905943 299 ClinVar
905944 423 ClinVar
353790 431 ClinVar
353791 463 ClinVar
908011 466 ClinVar
353792 473 ClinVar
353793 480 ClinVar
908012 484 ClinVar
353794 610 ClinVar
353795 614 ClinVar
908013 662 ClinVar
908014 683 ClinVar
908015 708 ClinVar
353796 722 ClinVar
904705 723 ClinVar
353797 759 ClinVar
904706 804 ClinVar
353798 846 ClinVar
353799 860 ClinVar
353800 895 ClinVar
353801 1043 ClinVar
353802 1200 ClinVar
353803 1253 ClinVar
905490 1301 ClinVar
353804 1323 ClinVar
905491 1347 ClinVar
353805 1357 ClinVar
905492 1366 ClinVar
905493 1450 ClinVar
906004 1636 ClinVar
353806 1642 ClinVar
353807 1672 ClinVar
353808 1750 ClinVar
353809 1758 ClinVar
353810 1818 ClinVar
353811 1826 ClinVar
906005 1898 ClinVar
906006 1916 ClinVar
353812 1922 ClinVar
353813 1948 ClinVar
907023 1958 ClinVar
907024 1981 ClinVar
907025 2010 ClinVar
353814 2026 ClinVar
353815 2026 ClinVar
907026 2052 ClinVar
907027 2065 ClinVar
353816 2076 ClinVar
353817 2090 ClinVar
353818 2152 ClinVar
353819 2199 ClinVar
353820 2266 ClinVar
904778 2368 ClinVar
353821 2393 ClinVar
904779 2415 ClinVar
353822 2430 ClinVar
353823 2451 ClinVar
353824 2505 ClinVar
353825 2522 ClinVar
353826 2526 ClinVar
353827 2571 ClinVar
353828 2571 ClinVar
353829 2575 ClinVar
353830 2609 ClinVar
905568 2649 ClinVar
353831 2654 ClinVar
353832 2675 ClinVar
906075 2683 ClinVar
906076 2691 ClinVar
353833 2717 ClinVar
353834 2724 ClinVar
353835 2783 ClinVar
353836 2883 ClinVar
353837 2922 ClinVar
353838 2940 ClinVar
353839 2941 ClinVar
353840 3000 ClinVar
353841 3027 ClinVar
353842 3029 ClinVar
353843 3049 ClinVar
353844 3114 ClinVar
353845 3163 ClinVar
353846 3165 ClinVar
903710 3167 ClinVar
353847 3238 ClinVar
353848 3306 ClinVar
353849 3311 ClinVar
903711 3332 ClinVar
353850 3359 ClinVar
353851 3383 ClinVar
903712 3399 ClinVar
905628 3405 ClinVar
353852 3410 ClinVar
353853 3415 ClinVar
905629 3456 ClinVar
353854 3595 ClinVar
353855 3598 ClinVar
353856 3598 ClinVar
905630 3598 ClinVar
905631 3725 ClinVar
353857 3762 ClinVar
905632 3814 ClinVar
353858 3821 ClinVar
353859 3890 ClinVar
353860 3919 ClinVar
353861 3987 ClinVar
353862 3997 ClinVar
353863 4002 ClinVar
353864 4029 ClinVar
353865 4041 ClinVar
353866 4043 ClinVar
353867 4044 ClinVar
906142 4084 ClinVar
353868 4099 ClinVar
COSN30182789 6 COSMIC
COSN31601388 31 COSMIC
COSN30530037 32 COSMIC
COSN30474297 39 COSMIC
COSN31502027 43 COSMIC
COSN20257940 96 COSMIC
COSN30551946 96 COSMIC
COSN30500364 99 COSMIC
COSN14172256 105 COSMIC
COSN30128529 106 COSMIC
COSN30532040 141 COSMIC
COSN20075285 177 COSMIC
COSN2110062 222 COSMIC
COSN7946493 237 COSMIC
COSN29882557 323 COSMIC
COSN20101211 476 COSMIC
COSN15923487 613 COSMIC
COSN9451241 641 COSMIC
COSN28767397 722 COSMIC
COSN18723476 1309 COSMIC
COSN21297400 1590 COSMIC
COSN27777060 1735 COSMIC
COSN9953364 1737 COSMIC
COSN21587306 2125 COSMIC
COSN23135542 2155 COSMIC
COSN21672368 2368 COSMIC
COSN20101217 2518 COSMIC
COSN23987693 2518 COSMIC
COSN8226810 2522 COSMIC
COSN14866789 2571 COSMIC
COSN20167541 2602 COSMIC
COSN20894644 2722 COSMIC
COSN20101219 2894 COSMIC
COSN17183057 3315 COSMIC
COSN26555674 3337 COSMIC
COSN20101225 3386 COSMIC
COSN2110064 3451 COSMIC
COSN28981787 3600 COSMIC
COSN6921670 3612 COSMIC
COSN20782717 3618 COSMIC
COSN17076324 3856 COSMIC
COSN2110066 3880 COSMIC
COSN14460919 3991 COSMIC
COSN20101231 4049 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1308828469 4 dbSNP
rs1271075765 6 dbSNP
rs1372672492 9 dbSNP
rs1403132229 16 dbSNP
rs756376853 17 dbSNP
rs1322992729 18 dbSNP
rs1330383309 21 dbSNP
rs780079205 23 dbSNP
rs749328236 25 dbSNP
rs779228093 29 dbSNP
rs13173706 30 dbSNP
rs772318397 32 dbSNP
rs113222066 36 dbSNP
rs889803830 38 dbSNP
rs374282668 40 dbSNP
rs1266046381 42 dbSNP
rs1451734139 43 dbSNP
rs199705548 44 dbSNP
rs769608735 52 dbSNP
rs775309869 53 dbSNP
rs1019658558 60 dbSNP
rs886060663 61 dbSNP
rs1344532175 68 dbSNP
rs1437160437 68 dbSNP
rs536293589 69 dbSNP
rs1402250479 70 dbSNP
rs1389024886 77 dbSNP
rs1176000899 79 dbSNP
rs1479564235 81 dbSNP
rs1021485288 83 dbSNP
rs1191839099 84 dbSNP
rs1475407298 86 dbSNP
rs1465655739 88 dbSNP
rs202180218 88 dbSNP
rs886060664 88 dbSNP
rs969021942 88 dbSNP
rs1262857855 96 dbSNP
rs1187533132 104 dbSNP
rs1280211985 109 dbSNP
rs980033788 110 dbSNP
rs1419403281 111 dbSNP
rs1268353138 115 dbSNP
rs554903428 138 dbSNP
rs1432743815 144 dbSNP
rs1408742857 145 dbSNP
rs1166936973 165 dbSNP
rs1335800447 167 dbSNP
rs1350551739 167 dbSNP
rs1468494006 170 dbSNP
rs1424179137 171 dbSNP
rs576470386 172 dbSNP
rs1176983453 174 dbSNP
rs868453957 176 dbSNP
rs1409456324 177 dbSNP
rs543864974 178 dbSNP
rs1188823866 180 dbSNP
rs1450614768 182 dbSNP
rs1301518927 183 dbSNP
rs1182132201 185 dbSNP
rs1362752787 185 dbSNP
rs1401593758 189 dbSNP
rs1270590762 190 dbSNP
rs1358588849 191 dbSNP
rs1361138043 192 dbSNP
rs1212758323 199 dbSNP
rs1270240792 207 dbSNP
rs190842751 209 dbSNP
rs1342776829 211 dbSNP
rs1359544808 216 dbSNP
rs1314181195 218 dbSNP
rs938334754 221 dbSNP
rs1221181953 228 dbSNP
rs3212647 232 dbSNP
rs886060665 232 dbSNP
rs999300416 232 dbSNP
rs1303675186 235 dbSNP
rs1491503450 236 dbSNP
rs992539522 236 dbSNP
rs1431023928 237 dbSNP
rs1491427597 237 dbSNP
rs901519225 237 dbSNP
rs907615852 238 dbSNP
rs577542995 239 dbSNP
rs940485792 245 dbSNP
rs766120006 256 dbSNP
rs1006331806 263 dbSNP
rs1016410276 267 dbSNP
rs1480086935 267 dbSNP
rs761096118 271 dbSNP
rs1037594474 276 dbSNP
rs920132711 285 dbSNP
rs1474678517 287 dbSNP
rs931536643 289 dbSNP
rs928617987 291 dbSNP
rs960312981 292 dbSNP
rs1223480131 298 dbSNP
rs1184111868 299 dbSNP
rs1310005468 310 dbSNP
rs1410517902 317 dbSNP
rs1364973391 320 dbSNP
rs1049981655 324 dbSNP
rs1386478144 328 dbSNP
rs1459858461 329 dbSNP
rs1369461812 347 dbSNP
rs889751491 351 dbSNP
rs1158822743 378 dbSNP
rs373632695 378 dbSNP
rs767049117 386 dbSNP
rs541624904 388 dbSNP
rs991547657 393 dbSNP
rs112997326 398 dbSNP
rs1418216516 399 dbSNP
rs916479054 401 dbSNP
rs1183825060 409 dbSNP
rs1472646656 419 dbSNP
rs1444070466 427 dbSNP
rs1220215442 430 dbSNP
rs886060666 431 dbSNP
rs1265868042 435 dbSNP
rs1041057477 441 dbSNP
rs947982401 444 dbSNP
rs1043562965 458 dbSNP
rs1401535336 461 dbSNP
rs3212648 462 dbSNP
rs182541283 463 dbSNP
rs1021854035 466 dbSNP
rs1392082711 469 dbSNP
rs1452102800 473 dbSNP
rs199677547 473 dbSNP
rs765069348 473 dbSNP
rs968593532 475 dbSNP
rs75521362 476 dbSNP
rs1160967030 477 dbSNP
rs1472696569 478 dbSNP
rs886060667 480 dbSNP
rs901631694 480 dbSNP
rs1001418120 481 dbSNP
rs1434903909 483 dbSNP
rs1034269446 484 dbSNP
rs959986331 485 dbSNP
rs889346608 488 dbSNP
rs186777139 489 dbSNP
rs1261417804 490 dbSNP
rs1244577182 493 dbSNP
rs1331697316 494 dbSNP
rs900914701 494 dbSNP
rs1380985999 499 dbSNP
rs1367847839 522 dbSNP
rs1321616803 528 dbSNP
rs907563597 544 dbSNP
rs962083950 545 dbSNP
rs1170373551 557 dbSNP
rs755433166 559 dbSNP
rs973197485 568 dbSNP
rs1377645974 575 dbSNP
rs1169690622 589 dbSNP
rs993501432 591 dbSNP
rs1249726131 593 dbSNP
rs1042322 601 dbSNP
rs1224003427 604 dbSNP
rs1036183842 606 dbSNP
rs1460656926 607 dbSNP
rs886060668 610 dbSNP
rs560903377 612 dbSNP
rs537086711 614 dbSNP
rs368338722 622 dbSNP
rs1022990545 624 dbSNP
rs1345845798 625 dbSNP
rs931491427 628 dbSNP
rs1049922228 643 dbSNP
rs752211514 643 dbSNP
rs1225940997 644 dbSNP
rs969270822 650 dbSNP
rs911465454 658 dbSNP
rs1298887149 670 dbSNP
rs944319260 671 dbSNP
rs1244265736 672 dbSNP
rs752313807 673 dbSNP
rs891812726 675 dbSNP
rs549875177 677 dbSNP
rs1470602476 679 dbSNP
rs3212650 683 dbSNP
rs1043153715 691 dbSNP
rs1402343322 692 dbSNP
rs935154831 701 dbSNP
rs191591133 708 dbSNP
rs371532995 712 dbSNP
rs534633435 714 dbSNP
rs933107581 716 dbSNP
rs1366460649 717 dbSNP
rs1109527 722 dbSNP
rs888792814 723 dbSNP
rs377218380 726 dbSNP
rs942251737 732 dbSNP
rs1037917394 738 dbSNP
rs1275989572 744 dbSNP
rs777162566 747 dbSNP
rs796992147 758 dbSNP
rs3212652 759 dbSNP
rs959932834 760 dbSNP
rs1014204930 768 dbSNP
rs1014982291 784 dbSNP
rs182608802 789 dbSNP
rs746587821 793 dbSNP
rs532426859 794 dbSNP
rs1340698355 801 dbSNP
rs993620468 813 dbSNP
rs1407472947 814 dbSNP
rs1371819276 816 dbSNP
rs973528973 824 dbSNP
rs920361741 841 dbSNP
rs1308594374 844 dbSNP
rs752068879 846 dbSNP
rs886060669 846 dbSNP
rs1202343449 854 dbSNP
rs886060670 860 dbSNP
rs985578170 863 dbSNP
rs757183636 865 dbSNP
rs1363443007 868 dbSNP
rs1231376258 877 dbSNP
rs1479153847 879 dbSNP
rs781149300 879 dbSNP
rs1201270462 883 dbSNP
rs895871316 887 dbSNP
rs1109526 895 dbSNP
rs570007588 913 dbSNP
rs968715009 915 dbSNP
rs1469165506 929 dbSNP
rs371406911 933 dbSNP
rs1174174916 946 dbSNP
rs1398616753 949 dbSNP
rs1410016462 954 dbSNP
rs977044157 961 dbSNP
rs1333581934 962 dbSNP
rs913190179 963 dbSNP
rs1351841565 965 dbSNP
rs1288407525 967 dbSNP
rs956636888 970 dbSNP
rs1329271850 981 dbSNP
rs1345280166 984 dbSNP
rs1325368084 989 dbSNP
rs1222138522 999 dbSNP
rs559045932 1009 dbSNP
rs1043489174 1010 dbSNP
rs1195276272 1013 dbSNP
rs577409557 1016 dbSNP
rs1198768185 1024 dbSNP
rs1477045615 1029 dbSNP
rs1453480027 1032 dbSNP
rs1200141680 1034 dbSNP
rs1223502884 1041 dbSNP
rs886060671 1043 dbSNP
rs933035236 1043 dbSNP
rs1479979143 1047 dbSNP
rs1266594331 1048 dbSNP
rs1197070860 1049 dbSNP
rs937438674 1050 dbSNP
rs1330758123 1063 dbSNP
rs1268287716 1079 dbSNP
rs1055618020 1083 dbSNP
rs1218133346 1086 dbSNP
rs1364807670 1087 dbSNP
rs1276566161 1091 dbSNP
rs985905122 1094 dbSNP
rs1475718262 1095 dbSNP
rs1318267030 1105 dbSNP
rs1437613939 1107 dbSNP
rs1389646529 1112 dbSNP
rs1175904155 1114 dbSNP
rs895670777 1115 dbSNP
rs1166757318 1116 dbSNP
rs1427311626 1121 dbSNP
rs910176820 1122 dbSNP
rs1475362334 1125 dbSNP
rs941695222 1128 dbSNP
rs1190903238 1133 dbSNP
rs1465577095 1135 dbSNP
rs1248273669 1145 dbSNP
rs1208928070 1153 dbSNP
rs535231514 1183 dbSNP
rs1309964379 1184 dbSNP
rs1280085190 1193 dbSNP
rs553561043 1194 dbSNP
rs1341349416 1199 dbSNP
rs1042323 1200 dbSNP
rs575225281 1201 dbSNP
rs898072299 1204 dbSNP
rs1336361003 1212 dbSNP
rs187264968 1215 dbSNP
rs553165905 1221 dbSNP
rs1361018085 1231 dbSNP
rs1364638820 1234 dbSNP
rs1403471693 1235 dbSNP
rs897446417 1238 dbSNP
rs779071657 1240 dbSNP
rs1170967158 1243 dbSNP
rs1388865583 1243 dbSNP
rs1450503238 1250 dbSNP
rs1384955377 1251 dbSNP
rs1042324 1253 dbSNP
rs896000266 1259 dbSNP
rs1013383984 1263 dbSNP
rs529322208 1273 dbSNP
rs545299919 1276 dbSNP
rs1482402139 1278 dbSNP
rs1272422702 1280 dbSNP
rs564058921 1283 dbSNP
rs1268418850 1293 dbSNP
rs1018368683 1294 dbSNP
rs1042325 1297 dbSNP
rs965526283 1301 dbSNP
rs977367891 1303 dbSNP
rs913481768 1304 dbSNP
rs1223392302 1307 dbSNP
rs1000183469 1309 dbSNP
rs369001095 1323 dbSNP
rs1310420814 1324 dbSNP
rs1430916720 1325 dbSNP
rs978774097 1329 dbSNP
rs149335245 1330 dbSNP
rs773148609 1330 dbSNP
rs925967109 1332 dbSNP
rs1182037549 1335 dbSNP
rs760873794 1342 dbSNP
rs937386238 1343 dbSNP
rs1055904276 1347 dbSNP
rs771530392 1357 dbSNP
rs949918953 1361 dbSNP
rs910292856 1366 dbSNP
rs1036646813 1374 dbSNP
rs897726828 1375 dbSNP
rs1371333336 1380 dbSNP
rs576021149 1380 dbSNP
rs1227972010 1386 dbSNP
rs973026725 1397 dbSNP
rs1445910202 1401 dbSNP
rs544486981 1406 dbSNP
rs759929093 1407 dbSNP
rs1384191038 1410 dbSNP
rs370203257 1412 dbSNP
rs1367506843 1413 dbSNP
rs1027251378 1418 dbSNP
rs888792786 1422 dbSNP
rs1292221768 1426 dbSNP
rs765727599 1427 dbSNP
rs1350795909 1432 dbSNP
rs1165247920 1447 dbSNP
rs1456362882 1448 dbSNP
rs1409209351 1463 dbSNP
rs543041276 1474 dbSNP
rs1472595121 1475 dbSNP
rs564684692 1478 dbSNP
rs1018652163 1479 dbSNP
rs762500538 1481 dbSNP
rs1489357984 1484 dbSNP
rs11549774 1486 dbSNP
rs1265777244 1489 dbSNP
rs965805688 1490 dbSNP
rs976938918 1491 dbSNP
rs796356790 1496 dbSNP
rs1044618495 1497 dbSNP
rs1299863193 1497 dbSNP
rs904588816 1498 dbSNP
rs1368811905 1501 dbSNP
rs1382077799 1506 dbSNP
rs1320295186 1512 dbSNP
rs1433993316 1517 dbSNP
rs532032748 1520 dbSNP
rs1386002743 1524 dbSNP
rs1160854334 1528 dbSNP
rs1000298020 1542 dbSNP
rs967639467 1545 dbSNP
rs1173914440 1546 dbSNP
rs979441825 1555 dbSNP
rs1053078258 1561 dbSNP
rs1434813681 1563 dbSNP
rs1316826788 1566 dbSNP
rs925916204 1568 dbSNP
rs1385681712 1570 dbSNP
rs867757863 1579 dbSNP
rs1463323023 1588 dbSNP
rs1246761863 1592 dbSNP
rs1250147933 1592 dbSNP
rs1209540104 1610 dbSNP
rs1482991955 1611 dbSNP
rs1254311373 1614 dbSNP
rs1313296405 1620 dbSNP
rs41339247 1623 dbSNP
rs3212654 1625 dbSNP
rs1322174481 1626 dbSNP
rs1382405368 1629 dbSNP
rs1400927918 1629 dbSNP
rs192927707 1636 dbSNP
rs917337939 1639 dbSNP
rs10076541 1642 dbSNP
rs1204402317 1644 dbSNP
rs1447454869 1645 dbSNP
rs1391755636 1656 dbSNP
rs1194230465 1659 dbSNP
rs1442051953 1666 dbSNP
rs531102187 1672 dbSNP
rs1202253201 1695 dbSNP
rs1274584511 1705 dbSNP
rs963076356 1705 dbSNP
rs1203583282 1706 dbSNP
rs919101014 1709 dbSNP
rs930547252 1714 dbSNP
rs1227780485 1715 dbSNP
rs1242018054 1717 dbSNP
rs1442318861 1722 dbSNP
rs1310048375 1726 dbSNP
rs1397279926 1729 dbSNP
rs1375467542 1739 dbSNP
rs1160829162 1740 dbSNP
rs548494960 1750 dbSNP
rs950416836 1751 dbSNP
rs1372244784 1754 dbSNP
rs3212655 1758 dbSNP
rs1408878939 1761 dbSNP
rs917500340 1763 dbSNP
rs1366951387 1774 dbSNP
rs1411327982 1779 dbSNP
rs569836214 1784 dbSNP
rs537496412 1793 dbSNP
rs1454014909 1795 dbSNP
rs1336088497 1798 dbSNP
rs1380691618 1799 dbSNP
rs552287916 1806 dbSNP
rs1393273763 1810 dbSNP
rs1180708130 1818 dbSNP
rs543100435 1818 dbSNP
rs886060672 1818 dbSNP
rs570965140 1826 dbSNP
rs1007177113 1828 dbSNP
rs1040050184 1831 dbSNP
rs756811377 1832 dbSNP
rs1354613942 1847 dbSNP
rs1263333646 1850 dbSNP
rs1246481020 1851 dbSNP
rs1044560181 1852 dbSNP
rs1316593067 1863 dbSNP
rs1407997047 1874 dbSNP
rs535084289 1876 dbSNP
rs185508853 1883 dbSNP
rs936036182 1885 dbSNP
rs540956528 1891 dbSNP
rs891913296 1896 dbSNP
rs79223114 1898 dbSNP
rs1388262672 1899 dbSNP
rs1009756006 1905 dbSNP
rs140728831 1916 dbSNP
rs879210296 1918 dbSNP
rs9292006 1922 dbSNP
rs1262500988 1923 dbSNP
rs1473575469 1936 dbSNP
rs750394741 1946 dbSNP
rs890362742 1947 dbSNP
rs561106268 1948 dbSNP
rs991481626 1949 dbSNP
rs917277361 1951 dbSNP
rs971480664 1963 dbSNP
rs1215242402 1970 dbSNP
rs972569562 1974 dbSNP
rs1418173514 1984 dbSNP
rs1180058896 1987 dbSNP
rs899013229 1989 dbSNP
rs994507767 1994 dbSNP
rs1325263164 2003 dbSNP
rs528619477 2006 dbSNP
rs1442000858 2008 dbSNP
rs1388184739 2010 dbSNP
rs1157141999 2014 dbSNP
rs1458903340 2017 dbSNP
rs919061424 2017 dbSNP
rs1176319626 2020 dbSNP
rs1408753617 2023 dbSNP
rs1404622656 2025 dbSNP
rs1491092378 2025 dbSNP
rs1206395490 2026 dbSNP
rs1284321836 2026 dbSNP
rs1379804493 2026 dbSNP
rs1453264534 2026 dbSNP
rs1491103056 2026 dbSNP
rs35863692 2026 dbSNP
rs376277558 2026 dbSNP
rs754105075 2026 dbSNP
rs886060673 2026 dbSNP
rs1463562411 2027 dbSNP
rs1298866867 2028 dbSNP
rs1372809397 2029 dbSNP
rs1234765394 2031 dbSNP
rs1389917817 2039 dbSNP
rs1286149237 2045 dbSNP
rs1347172309 2046 dbSNP
rs1223966045 2052 dbSNP
rs1282530479 2056 dbSNP
rs1437504379 2058 dbSNP
rs201170451 2065 dbSNP
rs950556560 2068 dbSNP
rs188770677 2076 dbSNP
rs910461275 2084 dbSNP
rs543408809 2089 dbSNP
rs886060674 2090 dbSNP
rs1449276530 2099 dbSNP
rs943318267 2119 dbSNP
rs1388676199 2122 dbSNP
rs1480069592 2124 dbSNP
rs1476183551 2126 dbSNP
rs1242259858 2128 dbSNP
rs779723519 2132 dbSNP
rs1208820304 2139 dbSNP
rs1024409525 2146 dbSNP
rs1039999386 2147 dbSNP
rs76840527 2152 dbSNP
rs576546906 2154 dbSNP
rs1480965732 2161 dbSNP
rs565894190 2169 dbSNP
rs1216604036 2186 dbSNP
rs540698536 2199 dbSNP
rs1423655662 2210 dbSNP
rs926069999 2215 dbSNP
rs1445946295 2222 dbSNP
rs772177206 2226 dbSNP
rs193291508 2227 dbSNP
rs1033214659 2234 dbSNP
rs1170871774 2235 dbSNP
rs151275096 2239 dbSNP
rs1051081697 2240 dbSNP
rs1180870166 2249 dbSNP
rs958923875 2250 dbSNP
rs1471539397 2258 dbSNP
rs533206560 2266 dbSNP
rs886060675 2266 dbSNP
rs35522051 2269 dbSNP
rs778093562 2277 dbSNP
rs747061670 2278 dbSNP
rs183719570 2283 dbSNP
rs1206381159 2284 dbSNP
rs1038931588 2285 dbSNP
rs1289475797 2293 dbSNP
rs563649415 2294 dbSNP
rs1357503663 2302 dbSNP
rs1305169266 2303 dbSNP
rs1366476168 2306 dbSNP
rs1409824918 2311 dbSNP
rs530673565 2321 dbSNP
rs994623698 2326 dbSNP
rs1349621113 2327 dbSNP
rs1186886560 2329 dbSNP
rs140594482 2330 dbSNP
rs1216262857 2337 dbSNP
rs1026596095 2357 dbSNP
rs971809949 2359 dbSNP
rs1249558319 2364 dbSNP
rs972134795 2365 dbSNP
rs1178839227 2366 dbSNP
rs1480861687 2367 dbSNP
rs1026813584 2368 dbSNP
rs1219720252 2384 dbSNP
rs952196983 2387 dbSNP
rs886060676 2393 dbSNP
rs1225632060 2399 dbSNP
rs1327099070 2400 dbSNP
rs984574877 2401 dbSNP
rs1490425153 2402 dbSNP
rs1392449520 2404 dbSNP
rs552617149 2405 dbSNP
rs1245372709 2408 dbSNP
rs1487096359 2410 dbSNP
rs200790251 2415 dbSNP
rs943266254 2420 dbSNP
rs886060677 2430 dbSNP
rs975985475 2431 dbSNP
rs1419493770 2432 dbSNP
rs922929094 2433 dbSNP
rs1447705550 2440 dbSNP
rs1161270556 2444 dbSNP
rs570829022 2445 dbSNP
rs1419591356 2447 dbSNP
rs945040962 2449 dbSNP
rs886060678 2451 dbSNP
rs1042095691 2452 dbSNP
rs903595779 2453 dbSNP
rs1347604203 2455 dbSNP
rs1208298399 2456 dbSNP
rs936436679 2459 dbSNP
rs1262546029 2461 dbSNP
rs1240459185 2462 dbSNP
rs1312117495 2463 dbSNP
rs188382965 2464 dbSNP
rs1054602863 2467 dbSNP
rs1424301399 2473 dbSNP
rs1302233675 2482 dbSNP
rs1433882651 2505 dbSNP
rs547148787 2505 dbSNP
rs72277253 2505 dbSNP
rs1432706937 2510 dbSNP
rs199794354 2514 dbSNP
rs750038712 2514 dbSNP
rs762197262 2514 dbSNP
rs772108329 2514 dbSNP
rs386687985 2516 dbSNP
rs376992600 2517 dbSNP
rs1171624148 2518 dbSNP
rs1358517082 2518 dbSNP
rs1453772478 2518 dbSNP
rs35440530 2518 dbSNP
rs369729740 2518 dbSNP
rs913411053 2518 dbSNP
rs934063638 2519 dbSNP
rs181154338 2520 dbSNP
rs199635147 2520 dbSNP
rs79488788 2522 dbSNP
rs1264027068 2523 dbSNP
rs1361235100 2526 dbSNP
rs886060680 2526 dbSNP
rs1205794295 2528 dbSNP
rs1024978953 2533 dbSNP
rs536093105 2535 dbSNP
rs1432235335 2536 dbSNP
rs1482940442 2540 dbSNP
rs1254797181 2542 dbSNP
rs1316561926 2552 dbSNP
rs1213606120 2563 dbSNP
rs1349112779 2566 dbSNP
rs911187546 2569 dbSNP
rs1900182 2571 dbSNP
rs1297206373 2572 dbSNP
rs75427194 2575 dbSNP
rs1377756514 2579 dbSNP
rs1311033639 2581 dbSNP
rs558152595 2582 dbSNP
rs184231631 2586 dbSNP
rs952111841 2590 dbSNP
rs1217034179 2599 dbSNP
rs1242028127 2603 dbSNP
rs930585913 2604 dbSNP
rs984859747 2606 dbSNP
rs1017363246 2607 dbSNP
rs886060681 2609 dbSNP
rs190079796 2615 dbSNP
rs1423363701 2620 dbSNP
rs923179915 2622 dbSNP
rs1243830465 2624 dbSNP
rs945348760 2625 dbSNP
rs1045885564 2633 dbSNP
rs1486284497 2636 dbSNP
rs905642331 2645 dbSNP
rs1001186003 2649 dbSNP
rs978150870 2650 dbSNP
rs886060682 2654 dbSNP
rs957587597 2655 dbSNP
rs1320639877 2656 dbSNP
rs1402201140 2658 dbSNP
rs1416612888 2658 dbSNP
rs1010919927 2659 dbSNP
rs936374519 2664 dbSNP
rs1389494310 2666 dbSNP
rs1054886880 2671 dbSNP
rs886060683 2675 dbSNP
rs552693744 2678 dbSNP
rs1338044566 2679 dbSNP
rs1415862577 2682 dbSNP
rs775163275 2683 dbSNP
rs1451349784 2684 dbSNP
rs948863085 2692 dbSNP
rs1251759560 2699 dbSNP
rs1282058328 2700 dbSNP
rs1180232742 2710 dbSNP
rs149715267 2717 dbSNP
rs1251655758 2721 dbSNP
rs763702932 2723 dbSNP
rs145580223 2724 dbSNP
rs993788549 2727 dbSNP
rs866302168 2728 dbSNP
rs1334866884 2733 dbSNP
rs1284050177 2734 dbSNP
rs887792002 2743 dbSNP
rs1006228976 2745 dbSNP
rs974027147 2746 dbSNP
rs1206139064 2750 dbSNP
rs1337371399 2769 dbSNP
rs1329293792 2775 dbSNP
rs1264370751 2778 dbSNP
rs919940673 2781 dbSNP
rs886060684 2783 dbSNP
rs1017646536 2785 dbSNP
rs1411287072 2789 dbSNP
rs1234793972 2791 dbSNP
rs1373153582 2795 dbSNP
rs1470647674 2796 dbSNP
rs1157386371 2798 dbSNP
rs930527042 2803 dbSNP
rs1364803730 2805 dbSNP
rs1177526908 2808 dbSNP
rs1467372769 2811 dbSNP
rs1250775238 2816 dbSNP
rs563301805 2819 dbSNP
rs1455518997 2828 dbSNP
rs1178481659 2841 dbSNP
rs1468575348 2844 dbSNP
rs1282926574 2845 dbSNP
rs1203389812 2858 dbSNP
rs1352760810 2859 dbSNP
rs997752026 2864 dbSNP
rs1280012366 2869 dbSNP
rs1030196083 2881 dbSNP
rs1371429515 2883 dbSNP
rs6149022 2883 dbSNP
rs33919911 2884 dbSNP
rs967013726 2893 dbSNP
rs1316302122 2898 dbSNP
rs1406818321 2903 dbSNP
rs907824407 2912 dbSNP
rs978045504 2917 dbSNP
rs924905103 2919 dbSNP
rs1452998621 2920 dbSNP
rs886060685 2922 dbSNP
rs1355885469 2927 dbSNP
rs1442491515 2934 dbSNP
rs1454444553 2937 dbSNP
rs1045595463 2938 dbSNP
rs990523178 2939 dbSNP
rs7700416 2940 dbSNP
rs6898333 2941 dbSNP
rs1361532949 2947 dbSNP
rs1268578973 2948 dbSNP
rs1323507128 2951 dbSNP
rs1046301202 2955 dbSNP
rs928836769 2965 dbSNP
rs79525857 2967 dbSNP
rs1433388511 2971 dbSNP
rs1377719531 2973 dbSNP
rs763634642 2976 dbSNP
rs570466009 2989 dbSNP
rs929519939 2990 dbSNP
rs1418382874 2991 dbSNP
rs1184367477 2994 dbSNP
rs1476133370 2995 dbSNP
rs1204105218 2998 dbSNP
rs562689130 2999 dbSNP
rs6880055 3000 dbSNP
rs1471483315 3006 dbSNP
rs1187203104 3008 dbSNP
rs1484645509 3010 dbSNP
rs866612949 3013 dbSNP
rs1211348454 3025 dbSNP
rs1306655353 3025 dbSNP
rs759856324 3025 dbSNP
rs7719848 3027 dbSNP
rs547012254 3029 dbSNP
rs1292747320 3031 dbSNP
rs1170227604 3033 dbSNP
rs1039047184 3036 dbSNP
rs374432971 3047 dbSNP
rs900583927 3047 dbSNP
rs373424452 3048 dbSNP
rs375893644 3048 dbSNP
rs115863238 3049 dbSNP
rs1313973232 3051 dbSNP
rs1409639517 3053 dbSNP
rs1410101322 3053 dbSNP
rs1307024332 3059 dbSNP
rs919886563 3061 dbSNP
rs951457402 3064 dbSNP
rs1419689970 3074 dbSNP
rs886060686 3114 dbSNP
rs1473905865 3119 dbSNP
rs1304154575 3133 dbSNP
rs1188516356 3134 dbSNP
rs1330990597 3134 dbSNP
rs1230951448 3142 dbSNP
rs1206972902 3145 dbSNP
rs1438614649 3148 dbSNP
rs1272719788 3150 dbSNP
rs982835294 3151 dbSNP
rs907768248 3153 dbSNP
rs529328662 3154 dbSNP
rs1223696945 3157 dbSNP
rs1271944516 3163 dbSNP
rs886060687 3163 dbSNP
rs7737412 3165 dbSNP
rs181728009 3171 dbSNP
rs927125800 3174 dbSNP
rs756028919 3178 dbSNP
rs999808702 3183 dbSNP
rs1419350973 3184 dbSNP
rs1490915112 3187 dbSNP
rs1032256688 3188 dbSNP
rs937041257 3188 dbSNP
rs1269342514 3190 dbSNP
rs1450906979 3191 dbSNP
rs957974478 3199 dbSNP
rs990470724 3200 dbSNP
rs1405616564 3203 dbSNP
rs1196651645 3222 dbSNP
rs1470362528 3224 dbSNP
rs1252646752 3225 dbSNP
rs1054210610 3228 dbSNP
rs916272290 3229 dbSNP
rs1374791344 3234 dbSNP
rs1475438527 3236 dbSNP
rs886060688 3238 dbSNP
rs892932541 3242 dbSNP
rs1315660530 3244 dbSNP
rs970860004 3249 dbSNP
rs1224708204 3251 dbSNP
rs1164530689 3257 dbSNP
rs981898455 3260 dbSNP
rs928762114 3272 dbSNP
rs1390480136 3278 dbSNP
rs756489618 3300 dbSNP
rs929495029 3300 dbSNP
rs1293611209 3301 dbSNP
rs539623752 3302 dbSNP
rs139102895 3306 dbSNP
rs886060689 3306 dbSNP
rs1161154478 3308 dbSNP
rs1401116922 3309 dbSNP
rs1008498848 3311 dbSNP
rs557257907 3311 dbSNP
rs1455739587 3313 dbSNP
rs1434429204 3314 dbSNP
rs566817341 3316 dbSNP
rs1018362305 3319 dbSNP
rs140380471 3332 dbSNP
rs1361781367 3357 dbSNP
rs552507591 3359 dbSNP
rs574487733 3367 dbSNP
rs535651515 3368 dbSNP
rs535171255 3369 dbSNP
rs1217090021 3375 dbSNP
rs556994179 3379 dbSNP
rs1347673348 3380 dbSNP
rs1278614746 3381 dbSNP
rs1236865553 3382 dbSNP
rs1352217802 3383 dbSNP
rs34163919 3384 dbSNP
rs59915734 3386 dbSNP
rs1447537959 3387 dbSNP
rs376215418 3387 dbSNP
rs370827826 3388 dbSNP
rs1187340750 3396 dbSNP
rs137861998 3399 dbSNP
rs1446020832 3404 dbSNP
rs1183806468 3405 dbSNP
rs542924934 3410 dbSNP
rs546009701 3415 dbSNP
rs748160673 3416 dbSNP
rs999357112 3417 dbSNP
rs1171525782 3429 dbSNP
rs1386247687 3430 dbSNP
rs1457184047 3432 dbSNP
rs1318563018 3435 dbSNP
rs561351069 3435 dbSNP
rs1263918192 3443 dbSNP
rs34808683 3444 dbSNP
rs1385070835 3446 dbSNP
rs1032205893 3447 dbSNP
rs893708736 3456 dbSNP
rs1213499020 3459 dbSNP
rs1312242424 3469 dbSNP
rs374663121 3470 dbSNP
rs1012189498 3472 dbSNP
rs1226214992 3473 dbSNP
rs1305322418 3478 dbSNP
rs1023277114 3480 dbSNP
rs1242278066 3486 dbSNP
rs1262301480 3488 dbSNP
rs1329702619 3489 dbSNP
rs1310940510 3493 dbSNP
rs981366146 3504 dbSNP
rs770917819 3509 dbSNP
rs927073868 3510 dbSNP
rs1460646298 3518 dbSNP
rs1266223473 3523 dbSNP
rs937157380 3524 dbSNP
rs1183708109 3526 dbSNP
rs1255017601 3530 dbSNP
rs1190659502 3537 dbSNP
rs187155679 3543 dbSNP
rs1443406660 3552 dbSNP
rs1250246131 3556 dbSNP
rs1194944110 3558 dbSNP
rs1479458983 3566 dbSNP
rs970428096 3571 dbSNP
rs1218729216 3576 dbSNP
rs990019547 3579 dbSNP
rs1291405966 3593 dbSNP
rs886060690 3594 dbSNP
rs865957589 3595 dbSNP
rs140054322 3598 dbSNP
rs72760448 3598 dbSNP
rs57674800 3600 dbSNP
rs868478924 3601 dbSNP
rs982229938 3604 dbSNP
rs945840982 3613 dbSNP
rs1392351713 3622 dbSNP
rs1167811562 3628 dbSNP
rs1473412042 3628 dbSNP
rs1025391487 3640 dbSNP
rs1364754698 3648 dbSNP
rs1363664477 3665 dbSNP
rs1472504470 3666 dbSNP
rs1041754434 3671 dbSNP
rs890811702 3680 dbSNP
rs944254543 3687 dbSNP
rs1467677631 3688 dbSNP
rs780102404 3692 dbSNP
rs557001587 3701 dbSNP
rs573128146 3703 dbSNP
rs540640768 3711 dbSNP
rs1236656209 3716 dbSNP
rs191917189 3725 dbSNP
rs1393363961 3730 dbSNP
rs1440431330 3732 dbSNP
rs1308802549 3733 dbSNP
rs1368958412 3736 dbSNP
rs1328014257 3740 dbSNP
rs1405972630 3742 dbSNP
rs1384893616 3744 dbSNP
rs1350871574 3755 dbSNP
rs1157296018 3756 dbSNP
rs1178929933 3757 dbSNP
rs900127661 3757 dbSNP
rs145759303 3762 dbSNP
rs909410081 3769 dbSNP
rs1027130762 3770 dbSNP
rs887165413 3773 dbSNP
rs529411713 3775 dbSNP
rs1210146180 3781 dbSNP
rs550824377 3786 dbSNP
rs1254931363 3787 dbSNP
rs1004311417 3797 dbSNP
rs753542284 3797 dbSNP
rs1233215296 3810 dbSNP
rs1025364138 3811 dbSNP
rs1305833945 3816 dbSNP
rs754848351 3817 dbSNP
rs1316898912 3818 dbSNP
rs1384403184 3819 dbSNP
rs886060692 3821 dbSNP
rs942266314 3825 dbSNP
rs1482039519 3834 dbSNP
rs1433184798 3836 dbSNP
rs1197171174 3837 dbSNP
rs1173938315 3840 dbSNP
rs1478098401 3866 dbSNP
rs540625371 3872 dbSNP
rs1482917868 3882 dbSNP
rs1196796278 3890 dbSNP
rs530007169 3890 dbSNP
rs1180532950 3891 dbSNP
rs777807757 3892 dbSNP
rs1432023685 3893 dbSNP
rs1481069060 3897 dbSNP
rs1220008881 3907 dbSNP
rs1268487160 3909 dbSNP
rs1338885268 3909 dbSNP
rs1175365771 3917 dbSNP
rs10471829 3919 dbSNP
rs1312761952 3921 dbSNP
rs902583109 3936 dbSNP
rs1377631558 3937 dbSNP
rs935425899 3943 dbSNP
rs1034262852 3960 dbSNP
rs1053594571 3975 dbSNP
rs958640475 3976 dbSNP
rs1370226080 3979 dbSNP
rs1165669071 3980 dbSNP
rs989964270 3982 dbSNP
rs893656653 3985 dbSNP
rs7725246 3987 dbSNP
rs1238970264 3991 dbSNP
rs547944577 3995 dbSNP
rs566829678 3997 dbSNP
rs755698160 3999 dbSNP
rs1318661869 4002 dbSNP
rs528320695 4002 dbSNP
rs886060693 4002 dbSNP
rs977199713 4002 dbSNP
rs1231986838 4005 dbSNP
rs1003204166 4007 dbSNP
rs912339814 4017 dbSNP
rs1441865295 4020 dbSNP
rs1353587152 4022 dbSNP
rs1025761936 4026 dbSNP
rs879585300 4029 dbSNP
rs1178273826 4030 dbSNP
rs1039373716 4031 dbSNP
rs781434148 4034 dbSNP
rs921496226 4037 dbSNP
rs1415788595 4039 dbSNP
rs1182245858 4041 dbSNP
rs143236463 4041 dbSNP
rs765702538 4041 dbSNP
rs886060694 4041 dbSNP
rs181976027 4043 dbSNP
rs1229030354 4044 dbSNP
rs71727762 4044 dbSNP
rs1458318786 4057 dbSNP
rs1274883754 4058 dbSNP
rs1272623898 4059 dbSNP
rs1016359872 4064 dbSNP
rs1482536874 4066 dbSNP
rs1203409406 4069 dbSNP
rs1291155069 4070 dbSNP
rs963514020 4070 dbSNP
rs1271500042 4073 dbSNP
rs1371596306 4074 dbSNP
rs1306696850 4075 dbSNP
rs974919174 4084 dbSNP
rs546594110 4088 dbSNP
rs1191108474 4090 dbSNP
rs10471830 4099 dbSNP
rs1351569835 4102 dbSNP
rs1165347136 4103 dbSNP
rs35142049 4103 dbSNP
rs1430351186 4109 dbSNP
rs1046475062 4112 dbSNP
rs1389726178 4118 dbSNP
rs1428096044 4119 dbSNP
rs1405503579 4120 dbSNP
rs1166406666 4122 dbSNP
rs906647003 4124 dbSNP
rs1440554199 4133 dbSNP
rs1252543481 4137 dbSNP
rs1437016868 4146 dbSNP
rs1292844488 4173 dbSNP
rs1365469236 4174 dbSNP
rs1002194767 4175 dbSNP
rs1247839927 4175 dbSNP
rs1383366546 4178 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                :|| | | ||||||| 
Target 5' -uuuuuUCAAUUUAUGCUGCUc 3'
1 - 21
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000296585.5 | 3UTR | UUUUUUCAAUUUAUGCUGCUCAUCCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.287 4.3e-3 0.196 3.8e-2 83 Click to see details
GSE32688 Pancreatic cancer 0.416 8.9e-3 0.253 8.1e-2 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.496 1.3e-2 0.362 5.8e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.429 1.8e-2 -0.393 2.9e-2 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.323 6.6e-2 0.400 2.9e-2 23 Click to see details
GSE19350 CNS germ cell tumors 0.386 1.1e-1 0.210 2.6e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.251 1.1e-1 0.273 9.3e-2 25 Click to see details
GSE21849 B cell lymphoma -0.164 2.0e-1 0.286 6.6e-2 29 Click to see details
GSE19536 Breast cancer 0.081 2.1e-1 0.038 3.5e-1 100 Click to see details
GSE17306 Multiple myeloma 0.108 2.3e-1 0.114 2.2e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.077 2.4e-1 -0.078 2.3e-1 90 Click to see details
GSE17498 Multiple myeloma 0.088 2.9e-1 0.113 2.4e-1 40 Click to see details
GSE21687 Ependynoma primary tumors 0.056 3.3e-1 0.023 4.3e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.092 3.3e-1 0.259 1.1e-1 25 Click to see details
GSE28544 Breast cancer 0.094 3.3e-1 0.314 6.8e-2 24 Click to see details
GSE28260 Renal cortex and medulla -0.128 3.4e-1 0.005 4.9e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer -0.095 3.5e-1 -0.215 1.8e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.044 3.5e-1 0.005 4.8e-1 79 Click to see details
GSE27834 Pluripotent stem cells 0.069 4.0e-1 0.068 4.0e-1 16 Click to see details
GSE38226 Liver fibrosis 0.041 4.3e-1 -0.128 2.9e-1 21 Click to see details
GSE38226 Liver fibrosis 0.041 4.3e-1 -0.128 2.9e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.477 0 -0.477 0 84 Click to see details
STAD 0.513 0 0.539 0 32 Click to see details
BLCA 0.549 0.01 0.583 0.01 18 Click to see details
LUAD 0.65 0.01 0.699 0.01 12 Click to see details
ESCA 0.664 0.01 0.609 0.02 11 Click to see details
CHOL -0.587 0.05 -0.817 0 9 Click to see details
UCEC -0.28 0.12 -0.226 0.18 19 Click to see details
KIRC -0.141 0.13 -0.054 0.33 68 Click to see details
KICH 0.232 0.13 0.162 0.22 25 Click to see details
KIRP -0.197 0.14 -0.154 0.2 32 Click to see details
PCPG 0.837 0.18 1.000 0.5 3 Click to see details
LIHC -0.125 0.2 -0.105 0.24 49 Click to see details
THCA 0.091 0.25 -0.026 0.42 59 Click to see details
PAAD -0.505 0.25 -0.400 0.3 4 Click to see details
HNSC -0.085 0.3 -0.157 0.16 42 Click to see details
PRAD -0.056 0.35 -0.203 0.08 50 Click to see details
LUSC -0.047 0.39 -0.165 0.16 38 Click to see details
COAD 0.072 0.43 -0.143 0.37 8 Click to see details
CESC -0.041 0.49 -0.500 0.33 3 Click to see details
CESC -0.041 0.49 -0.500 0.33 3 Click to see details
CESC -0.041 0.49 -0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1