miRTarBase - #MIRT320626 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNRF2   
Synonyms RNF202
Description zinc and ring finger 2
Transcript NM_147128   
Expression
Putative miRNA Targets on ZNRF2
3'UTR of ZNRF2
(miRNA target sites are highlighted)
>ZNRF2|NM_147128|3'UTR
   1 GCGTCAGCTTCCTGTTTTATAGGTTTTCTTGTCTTGACAAGATGCTTGAAAAACCAAGAGGATATGAAAATCTGTCTCTG
  81 GAGAAACAAAGACGCAGGCATACTCAGCCAGAAATCTGAGTTTTGTGAGACTTGGTAATACAGAGATGGACAATCGTACT
 161 GGGGTAAAAAAACCCTGCTGAAGAGAGGACAGTGACCACAGAACTCAGTGTACCAAACATGCATACAAAGGACACACAGG
 241 GATTTTGAAAATGCTGCACATCCCTTAATAGTCATCTACATAGGTAATACTGATAAACATTTTGTATTCAGACGCCAAAG
 321 TTAACTGATTTAAAAGTTGATTTACTTTTTATTAAGTTCTCCAGAGCTGCACAACTAGTTATGTTTTGATTTGTTTTGTT
 401 TTTTAATTTGGGGTCTCTTTGTTTTCCCCAACATAATGTTCATAATGTTTCTGCATTCATCTGTTCTTAAATTGAAAAAC
 481 ATATAATTTACTTCTTATAAATTGAAGTCTTAAATGTGAAACCAAGAAATGTAATCAAGCAGTAAAAACATCTGAATGTA
 561 GACCATGATCTCAAGTTCTTCCATTTTCTCCCCCACGAGTGGAAAATAGACTTCTACATAGGAAAGCTAAAATATGTTAA
 641 TATTTTTAAATTAAAGGTTTAATATCAGAATGCAGTCCAAAGAGCAAATCATATTACATAATTACATTTTAATTAAATAT
 721 AGAATATTCTACTGAATTGCAATTTATTAAATATTCTTATCCTCTTAAATAAAACTGCTCAACAGTTAATCAGCAGTGAA
 801 TCATCTTGCAGCTATGCAATTTAAAAAAAATACAGATTACCAATTTCAAGTGCTGCCAGCTAAAATAACTGTTTTAACGG
 881 GTATCTTTTGTTTGTTCTTTTCACTTAATTATTTTATTGTGCTTTGCATCTCCAGGCAGTTCTCTCACATTTGGGTAAAA
 961 TGTTTAGCAGGCTGTAAACTTAAGAAAAGGGTAAAATAAAATTTTCTGGAGAGGAACTTGGAATTTGAGGGAGATTTTAT
1041 ATACCTTTAAAAACTGTAATTTAATTGGGATGCCAGGTTTATAGCAATTTGCAACTTTAATTTTCCAGATAATCTGGAGG
1121 TTAGCATTTGATAAATGATTTTTTAAAGTAGATATGAAGATTTTGTTAATTTATAATTTATTCATGTGTTATTACTGTAA
1201 TTGAAAATGTTATAGACACTTTTAAATTCAGTTTGTGTAGAAAGAAATGTGTTAAACAAAATTATGTTAATAAATATTCC
1281 CACATAATACATCTGAATGGTTAAAAATACTGGAAGAGTTGTCAGGGCTACAATAGTGAATGTCCTTTTTTTTAATATCA
1361 AAAATATCGATAAGTAGGTTTTGTGTTTTCAACGTAGGGAAAATGTTATCAGTGAATAGGTGGTGTACTTTACTTGGTAT
1441 AATTTAAAGTTGCACAGTAAGTACTGTTTCCTTATTTTAATCTTTCTTTACTCATAATGTATTTAAGAATTTGCTGTTTT
1521 ATTTAACGCTGCTACTCTTAATCTTCTCTAAATTTTTCCCCCTACTTTCTTGCTTCTGTTTCACATTTTTTAAAAGGGCA
1601 AGTACAGGAGCAACTGCTGCTACCCAGAAAAATGTGTGTATTATAAATAATTAAAGAGTTTTTAATTGCTTTCTGTATGA
1681 AAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUG-GUAAUAC----ACGACGAu 5'
            |||:: ||  | |    ||||||| 
Target 5' ggCAAGTACAGGA-GCAACTGCTGCTa 3'
1597 - 1622 141.00 -13.44
2
miRNA  3' guguuUGGU--AA-UACACGACGau 5'
               ||||  || | |||||||  
Target 5' agattACCAATTTCAAGTGCTGCca 3'
834 - 858 139.00 -11.90
3
miRNA  3' guGUUUGGUAA-----UACACGACGAu 5'
            :||  :|||     || |||||:| 
Target 5' caTAATGTATTTAAGAATTTGCTGTTt 3'
1493 - 1519 136.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30526597 3 COSMIC
COSN27006716 4 COSMIC
COSN30626199 10 COSMIC
COSN27006714 19 COSMIC
COSN30463725 23 COSMIC
COSN30090549 26 COSMIC
COSN20046125 35 COSMIC
COSN25369195 743 COSMIC
COSN26253166 748 COSMIC
COSN25369196 858 COSMIC
COSN2218745 880 COSMIC
COSN6877977 1468 COSMIC
COSN24046745 1603 COSMIC
COSN25243384 1634 COSMIC
COSN19121998 1820 COSMIC
COSN21264116 1829 COSMIC
COSN21910710 2118 COSMIC
COSN26753075 2500 COSMIC
COSN24354593 2739 COSMIC
COSN19116862 3228 COSMIC
COSN31569271 3684 COSMIC
COSN26555734 3835 COSMIC
COSN29932763 4106 COSMIC
COSN22488638 4406 COSMIC
COSN31588197 4409 COSMIC
COSN31482996 4481 COSMIC
COSN26640829 4500 COSMIC
COSN31545075 4551 COSMIC
COSN31517076 4578 COSMIC
COSN31566209 4582 COSMIC
COSN17515791 4788 COSMIC
COSN29205503 4870 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201970411 4 dbSNP
rs1240978179 9 dbSNP
rs759899395 10 dbSNP
rs1376173661 13 dbSNP
rs769997626 18 dbSNP
rs372418451 20 dbSNP
rs74764872 21 dbSNP
rs968276420 24 dbSNP
rs763327154 25 dbSNP
rs201691924 27 dbSNP
rs768669077 27 dbSNP
rs1316567408 31 dbSNP
rs903648135 36 dbSNP
rs1362402449 41 dbSNP
rs764629016 47 dbSNP
rs751737194 53 dbSNP
rs1418634490 54 dbSNP
rs980967699 57 dbSNP
rs1405144687 59 dbSNP
rs926640746 63 dbSNP
rs146769458 68 dbSNP
rs1056988229 71 dbSNP
rs1008875358 75 dbSNP
rs919338994 78 dbSNP
rs929345566 81 dbSNP
rs541217755 86 dbSNP
rs1282221567 98 dbSNP
rs1182118274 103 dbSNP
rs567094230 105 dbSNP
rs1046894620 110 dbSNP
rs1384935860 111 dbSNP
rs1380206789 116 dbSNP
rs1283769866 118 dbSNP
rs534125954 122 dbSNP
rs1165039280 124 dbSNP
rs140373439 125 dbSNP
rs1005484787 126 dbSNP
rs1342135210 139 dbSNP
rs1298794101 143 dbSNP
rs564611522 144 dbSNP
rs1039630497 147 dbSNP
rs115526923 151 dbSNP
rs1398530561 169 dbSNP
rs113434075 180 dbSNP
rs997848883 205 dbSNP
rs1412634819 206 dbSNP
rs1029861466 208 dbSNP
rs538256510 216 dbSNP
rs982315233 217 dbSNP
rs1022481216 218 dbSNP
rs913536406 219 dbSNP
rs968160924 223 dbSNP
rs1289514184 228 dbSNP
rs1315081534 236 dbSNP
rs1231670962 241 dbSNP
rs1306022278 244 dbSNP
rs981011801 252 dbSNP
rs1203906187 253 dbSNP
rs1043845231 256 dbSNP
rs1252022835 258 dbSNP
rs1033889049 259 dbSNP
rs960726645 263 dbSNP
rs992177338 265 dbSNP
rs1049564657 275 dbSNP
rs1243100682 276 dbSNP
rs1323551436 284 dbSNP
rs1445562014 287 dbSNP
rs539961694 289 dbSNP
rs1409941678 292 dbSNP
rs1008088594 293 dbSNP
rs919212254 302 dbSNP
rs1416946842 306 dbSNP
rs180955154 319 dbSNP
rs985250360 320 dbSNP
rs1463373716 327 dbSNP
rs533305989 328 dbSNP
rs1193363718 334 dbSNP
rs1488880487 335 dbSNP
rs1252427313 341 dbSNP
rs187281156 342 dbSNP
rs941156109 345 dbSNP
rs755758652 346 dbSNP
rs1305481487 349 dbSNP
rs1039683409 354 dbSNP
rs993560533 365 dbSNP
rs1028123075 366 dbSNP
rs899743808 370 dbSNP
rs1425069321 374 dbSNP
rs143561717 376 dbSNP
rs1330202765 380 dbSNP
rs1033845778 382 dbSNP
rs960955814 383 dbSNP
rs928192071 384 dbSNP
rs1335948063 387 dbSNP
rs1050788378 388 dbSNP
rs1406801413 389 dbSNP
rs189463557 392 dbSNP
rs1434227270 399 dbSNP
rs150974570 401 dbSNP
rs1394963939 402 dbSNP
rs1191848625 405 dbSNP
rs1441555359 407 dbSNP
rs1009333528 411 dbSNP
rs1454348906 414 dbSNP
rs992372950 416 dbSNP
rs1360115587 418 dbSNP
rs1022452258 424 dbSNP
rs1479571083 427 dbSNP
rs777339770 450 dbSNP
rs1296563253 451 dbSNP
rs1347105219 454 dbSNP
rs1002318469 455 dbSNP
rs1221783731 456 dbSNP
rs944997508 459 dbSNP
rs1033772893 460 dbSNP
rs935596217 463 dbSNP
rs1263035133 466 dbSNP
rs777523873 467 dbSNP
rs1304994094 469 dbSNP
rs960945266 470 dbSNP
rs749665368 486 dbSNP
rs1466828941 489 dbSNP
rs1026325598 490 dbSNP
rs1172241650 493 dbSNP
rs1421667695 499 dbSNP
rs376214231 501 dbSNP
rs1417525260 502 dbSNP
rs925049009 502 dbSNP
rs1485189467 508 dbSNP
rs1278107433 509 dbSNP
rs550073041 512 dbSNP
rs1240668388 513 dbSNP
rs950762762 515 dbSNP
rs1259595931 518 dbSNP
rs42589 522 dbSNP
rs1312910741 529 dbSNP
rs770316980 529 dbSNP
rs890922444 529 dbSNP
rs909294374 530 dbSNP
rs1036885642 542 dbSNP
rs1186707945 551 dbSNP
rs941210029 556 dbSNP
rs975252748 557 dbSNP
rs1479158254 558 dbSNP
rs1165666177 561 dbSNP
rs921061261 563 dbSNP
rs1255121396 564 dbSNP
rs1175136022 566 dbSNP
rs933944083 570 dbSNP
rs1051427254 572 dbSNP
rs1202869713 603 dbSNP
rs993934622 613 dbSNP
rs892162324 620 dbSNP
rs945032553 621 dbSNP
rs1232284959 623 dbSNP
rs1334663899 625 dbSNP
rs1043487174 626 dbSNP
rs774748422 628 dbSNP
rs1327555834 629 dbSNP
rs150121470 630 dbSNP
rs1416158711 643 dbSNP
rs1392967098 646 dbSNP
rs1002259188 653 dbSNP
rs772091208 654 dbSNP
rs1461088128 655 dbSNP
rs1034266725 663 dbSNP
rs550182664 665 dbSNP
rs1477992098 666 dbSNP
rs960843115 669 dbSNP
rs992425558 673 dbSNP
rs1289612093 674 dbSNP
rs1033826913 675 dbSNP
rs896628403 677 dbSNP
rs542254632 681 dbSNP
rs562174504 681 dbSNP
rs924963173 684 dbSNP
rs201427219 687 dbSNP
rs1332959334 689 dbSNP
rs1304292676 692 dbSNP
rs1282797941 696 dbSNP
rs985185799 697 dbSNP
rs375882830 698 dbSNP
rs546777653 698 dbSNP
rs1026963253 699 dbSNP
rs1036812569 703 dbSNP
rs950787565 705 dbSNP
rs1478949491 724 dbSNP
rs1006627184 726 dbSNP
rs529627053 732 dbSNP
rs775629547 733 dbSNP
rs1217017211 734 dbSNP
rs761049483 745 dbSNP
rs964794059 748 dbSNP
rs529288222 749 dbSNP
rs887747079 756 dbSNP
rs1178861415 762 dbSNP
rs1438814977 765 dbSNP
rs775228256 771 dbSNP
rs921113398 786 dbSNP
rs955373348 791 dbSNP
rs1281598723 797 dbSNP
rs1478726497 798 dbSNP
rs1286106117 803 dbSNP
rs1233663729 816 dbSNP
rs1368864386 816 dbSNP
rs1055186686 818 dbSNP
rs896560542 819 dbSNP
rs1013788168 821 dbSNP
rs1326644854 826 dbSNP
rs776392906 827 dbSNP
rs1376010236 829 dbSNP
rs1021134226 833 dbSNP
rs986761454 834 dbSNP
rs1432400515 837 dbSNP
rs1381613274 842 dbSNP
rs1177477358 844 dbSNP
rs1469282426 847 dbSNP
rs1230768378 849 dbSNP
rs776936159 853 dbSNP
rs1336434746 855 dbSNP
rs181535026 858 dbSNP
rs766238001 861 dbSNP
rs1401048773 869 dbSNP
rs1210777716 875 dbSNP
rs1345875967 877 dbSNP
rs1224367281 880 dbSNP
rs569145693 880 dbSNP
rs945276728 891 dbSNP
rs1362682653 901 dbSNP
rs751493132 910 dbSNP
rs867058638 911 dbSNP
rs1288932767 927 dbSNP
rs1302787357 928 dbSNP
rs42590 934 dbSNP
rs1438732671 935 dbSNP
rs953712703 937 dbSNP
rs534413634 938 dbSNP
rs985626627 941 dbSNP
rs1373302270 942 dbSNP
rs1054787476 944 dbSNP
rs1405346133 945 dbSNP
rs896675296 954 dbSNP
rs1418999328 957 dbSNP
rs1187916968 962 dbSNP
rs1288672773 962 dbSNP
rs1357755449 970 dbSNP
rs943817392 974 dbSNP
rs1216607982 986 dbSNP
rs1446436250 990 dbSNP
rs1282504257 993 dbSNP
rs138718961 998 dbSNP
rs1335295657 1000 dbSNP
rs1292418959 1002 dbSNP
rs1265270691 1007 dbSNP
rs369172923 1010 dbSNP
rs538367145 1019 dbSNP
rs1289305053 1028 dbSNP
rs931226205 1029 dbSNP
rs1342908869 1035 dbSNP
rs1325172286 1036 dbSNP
rs1048285409 1038 dbSNP
rs1452783932 1053 dbSNP
rs1201881030 1058 dbSNP
rs369964328 1065 dbSNP
rs886700132 1073 dbSNP
rs1422278263 1077 dbSNP
rs1206606053 1084 dbSNP
rs1006440495 1092 dbSNP
rs776000331 1108 dbSNP
rs112213885 1109 dbSNP
rs1469101027 1114 dbSNP
rs1272715187 1118 dbSNP
rs1211589685 1121 dbSNP
rs1055113919 1126 dbSNP
rs1296276553 1129 dbSNP
rs75545378 1139 dbSNP
rs1359303917 1144 dbSNP
rs1030404775 1167 dbSNP
rs377207851 1173 dbSNP
rs1391791511 1176 dbSNP
rs1407123121 1180 dbSNP
rs987043854 1182 dbSNP
rs1323401030 1186 dbSNP
rs1327010738 1192 dbSNP
rs1356628884 1194 dbSNP
rs1171796399 1199 dbSNP
rs1013670285 1205 dbSNP
rs1195605471 1210 dbSNP
rs370435622 1213 dbSNP
rs1252677796 1216 dbSNP
rs577764510 1217 dbSNP
rs1481519378 1222 dbSNP
rs767001329 1223 dbSNP
rs763348154 1232 dbSNP
rs967046450 1234 dbSNP
rs1203507295 1235 dbSNP
rs1001541539 1246 dbSNP
rs1282305978 1250 dbSNP
rs573016497 1254 dbSNP
rs1380986239 1255 dbSNP
rs1245724904 1256 dbSNP
rs924977660 1257 dbSNP
rs201922026 1260 dbSNP
rs1315280494 1270 dbSNP
rs1358072548 1281 dbSNP
rs937660663 1287 dbSNP
rs1448506015 1293 dbSNP
rs1483423764 1294 dbSNP
rs1376040381 1296 dbSNP
rs1299134218 1297 dbSNP
rs1054840358 1299 dbSNP
rs954426603 1306 dbSNP
rs146919854 1307 dbSNP
rs1437914164 1318 dbSNP
rs1172051475 1319 dbSNP
rs1421139915 1320 dbSNP
rs146619947 1325 dbSNP
rs965108287 1325 dbSNP
rs972418247 1325 dbSNP
rs918438698 1326 dbSNP
rs113475310 1335 dbSNP
rs1211490304 1336 dbSNP
rs1241226774 1339 dbSNP
rs1346587913 1345 dbSNP
rs952548551 1349 dbSNP
rs984349467 1350 dbSNP
rs927257823 1351 dbSNP
rs1460688949 1356 dbSNP
rs949130520 1373 dbSNP
rs937254833 1377 dbSNP
rs558618914 1380 dbSNP
rs1371610073 1388 dbSNP
rs558440456 1401 dbSNP
rs1369267387 1403 dbSNP
rs1375330794 1405 dbSNP
rs138541527 1406 dbSNP
rs1455358197 1416 dbSNP
rs1364602353 1422 dbSNP
rs1006493118 1427 dbSNP
rs949448814 1434 dbSNP
rs1166383104 1448 dbSNP
rs1418807702 1449 dbSNP
rs1419735417 1450 dbSNP
rs1466235209 1451 dbSNP
rs755562721 1452 dbSNP
rs777420359 1456 dbSNP
rs1452329300 1458 dbSNP
rs1255264457 1460 dbSNP
rs1206394954 1468 dbSNP
rs186056850 1470 dbSNP
rs996178892 1480 dbSNP
rs1030296015 1481 dbSNP
rs748895966 1482 dbSNP
rs1236401377 1489 dbSNP
rs1327570793 1494 dbSNP
rs1295532337 1500 dbSNP
rs1234231867 1505 dbSNP
rs890537218 1512 dbSNP
rs1311120728 1515 dbSNP
rs1224713202 1520 dbSNP
rs757655625 1524 dbSNP
rs1413599813 1527 dbSNP
rs1010296008 1532 dbSNP
rs1021218277 1539 dbSNP
rs562239544 1541 dbSNP
rs529642776 1546 dbSNP
rs1032217868 1549 dbSNP
rs1261147093 1550 dbSNP
rs541383996 1554 dbSNP
rs993892525 1555 dbSNP
rs990454111 1556 dbSNP
rs1195218561 1562 dbSNP
rs1428641964 1570 dbSNP
rs917552474 1577 dbSNP
rs1257939759 1589 dbSNP
rs949176993 1595 dbSNP
rs560855107 1598 dbSNP
rs527947894 1601 dbSNP
rs908065639 1603 dbSNP
rs1469552492 1604 dbSNP
rs1273362701 1607 dbSNP
rs1214709470 1611 dbSNP
rs1025422575 1620 dbSNP
rs942160507 1622 dbSNP
rs779310992 1629 dbSNP
rs528298498 1630 dbSNP
rs751982415 1638 dbSNP
rs10251223 1648 dbSNP
rs570988980 1655 dbSNP
rs1432932960 1667 dbSNP
rs1373491746 1676 dbSNP
rs984012943 1695 dbSNP
rs534550184 1700 dbSNP
rs1034591762 1715 dbSNP
rs932180407 1723 dbSNP
rs1169616968 1724 dbSNP
rs1462457869 1728 dbSNP
rs1372381335 1730 dbSNP
rs1173680889 1734 dbSNP
rs531929579 1738 dbSNP
rs746421543 1748 dbSNP
rs890431483 1753 dbSNP
rs917939958 1755 dbSNP
rs949334851 1759 dbSNP
rs1197884486 1774 dbSNP
rs1340718916 1777 dbSNP
rs1251192023 1784 dbSNP
rs762007092 1786 dbSNP
rs978072851 1791 dbSNP
rs1010764683 1792 dbSNP
rs1304504204 1798 dbSNP
rs1317171720 1801 dbSNP
rs551327170 1804 dbSNP
rs568521742 1809 dbSNP
rs571419161 1813 dbSNP
rs1344334517 1819 dbSNP
rs1395688693 1820 dbSNP
rs889912949 1826 dbSNP
rs553848884 1829 dbSNP
rs566781600 1830 dbSNP
rs768807449 1832 dbSNP
rs190518565 1836 dbSNP
rs990730444 1841 dbSNP
rs1234207851 1843 dbSNP
rs901421248 1848 dbSNP
rs993819102 1850 dbSNP
rs1025075592 1851 dbSNP
rs1488776939 1852 dbSNP
rs181133965 1856 dbSNP
rs1350193294 1876 dbSNP
rs1281165713 1882 dbSNP
rs186441469 1888 dbSNP
rs1343151909 1891 dbSNP
rs907617219 1892 dbSNP
rs780193468 1893 dbSNP
rs942211499 1894 dbSNP
rs973568587 1896 dbSNP
rs1334933585 1899 dbSNP
rs1379935211 1917 dbSNP
rs1416513223 1920 dbSNP
rs1375948225 1922 dbSNP
rs1311770855 1931 dbSNP
rs777026081 1932 dbSNP
rs932232986 1937 dbSNP
rs374757641 1941 dbSNP
rs543954443 1942 dbSNP
rs1470752158 1958 dbSNP
rs1411645031 1969 dbSNP
rs1180418307 1971 dbSNP
rs536780467 1974 dbSNP
rs1024255037 1975 dbSNP
rs1210258157 1992 dbSNP
rs555848497 2001 dbSNP
rs144346956 2007 dbSNP
rs1300907084 2009 dbSNP
rs978156544 2014 dbSNP
rs946065303 2016 dbSNP
rs923928780 2019 dbSNP
rs1292530814 2026 dbSNP
rs1042227505 2031 dbSNP
rs1344277302 2032 dbSNP
rs1386865061 2034 dbSNP
rs1303288244 2035 dbSNP
rs1333945980 2036 dbSNP
rs958156181 2038 dbSNP
rs1318623540 2042 dbSNP
rs989948161 2043 dbSNP
rs139535807 2047 dbSNP
rs761317441 2047 dbSNP
rs1238050800 2061 dbSNP
rs1181778872 2074 dbSNP
rs1309781899 2074 dbSNP
rs1355597068 2076 dbSNP
rs1471879145 2088 dbSNP
rs942901930 2089 dbSNP
rs1219027233 2092 dbSNP
rs1216540057 2103 dbSNP
rs1464634772 2104 dbSNP
rs1289897040 2108 dbSNP
rs904623453 2110 dbSNP
rs1000198576 2116 dbSNP
rs1053570044 2120 dbSNP
rs1041178740 2126 dbSNP
rs541831165 2128 dbSNP
rs1215342311 2133 dbSNP
rs922897509 2134 dbSNP
rs1210556379 2136 dbSNP
rs1363938216 2138 dbSNP
rs749438316 2138 dbSNP
rs1270290181 2142 dbSNP
rs1429341637 2159 dbSNP
rs1270092228 2165 dbSNP
rs559917597 2186 dbSNP
rs1327495763 2187 dbSNP
rs930222643 2188 dbSNP
rs1395643317 2193 dbSNP
rs367796838 2198 dbSNP
rs1404128975 2201 dbSNP
rs888072555 2202 dbSNP
rs1012607690 2206 dbSNP
rs1187201980 2207 dbSNP
rs1181740169 2211 dbSNP
rs776964236 2212 dbSNP
rs1024876636 2215 dbSNP
rs970841980 2220 dbSNP
rs1448872450 2225 dbSNP
rs762098134 2226 dbSNP
rs1195721010 2228 dbSNP
rs1014556936 2233 dbSNP
rs1055920962 2239 dbSNP
rs1245886073 2240 dbSNP
rs1356786376 2242 dbSNP
rs1219045525 2248 dbSNP
rs1309194895 2251 dbSNP
rs963139525 2253 dbSNP
rs973118758 2265 dbSNP
rs1213545387 2280 dbSNP
rs546217576 2282 dbSNP
rs564764846 2286 dbSNP
rs1441143836 2299 dbSNP
rs894215172 2299 dbSNP
rs190934864 2300 dbSNP
rs182695670 2314 dbSNP
rs988167699 2318 dbSNP
rs568586232 2327 dbSNP
rs1388381974 2332 dbSNP
rs999144181 2335 dbSNP
rs1283221316 2338 dbSNP
rs1189250455 2339 dbSNP
rs1266865144 2339 dbSNP
rs1031019960 2346 dbSNP
rs1233443314 2349 dbSNP
rs958250973 2357 dbSNP
rs1161229843 2359 dbSNP
rs1481810214 2363 dbSNP
rs1281881396 2373 dbSNP
rs1234322030 2376 dbSNP
rs1311264193 2385 dbSNP
rs989484405 2402 dbSNP
rs946257821 2406 dbSNP
rs1041721611 2408 dbSNP
rs1457938798 2420 dbSNP
rs1409723667 2421 dbSNP
rs925933308 2424 dbSNP
rs911331175 2425 dbSNP
rs1314850246 2431 dbSNP
rs1435343264 2434 dbSNP
rs1377348118 2444 dbSNP
rs1294840298 2448 dbSNP
rs1174200014 2455 dbSNP
rs1420704602 2461 dbSNP
rs936101016 2470 dbSNP
rs1471582513 2476 dbSNP
rs1259456382 2477 dbSNP
rs1390688087 2479 dbSNP
rs1055793656 2485 dbSNP
rs922742300 2490 dbSNP
rs1243566159 2493 dbSNP
rs895007510 2496 dbSNP
rs930249502 2500 dbSNP
rs1047735894 2506 dbSNP
rs1245595331 2512 dbSNP
rs1295646553 2514 dbSNP
rs774190858 2529 dbSNP
rs941050254 2531 dbSNP
rs189011162 2532 dbSNP
rs1345959362 2534 dbSNP
rs1158166944 2535 dbSNP
rs906460320 2541 dbSNP
rs148780483 2542 dbSNP
rs1420021784 2547 dbSNP
rs1188554633 2557 dbSNP
rs535815689 2563 dbSNP
rs1253428985 2566 dbSNP
rs1187728836 2569 dbSNP
rs963024136 2571 dbSNP
rs1045598189 2578 dbSNP
rs565975088 2584 dbSNP
rs902979201 2586 dbSNP
rs1275650826 2588 dbSNP
rs998796426 2598 dbSNP
rs539813109 2605 dbSNP
rs1424086571 2611 dbSNP
rs1028742951 2612 dbSNP
rs1366209007 2619 dbSNP
rs1320139377 2621 dbSNP
rs1455498069 2623 dbSNP
rs1396383338 2627 dbSNP
rs1165619603 2628 dbSNP
rs191208138 2630 dbSNP
rs1366599334 2636 dbSNP
rs1370775119 2638 dbSNP
rs987665007 2639 dbSNP
rs1247089567 2641 dbSNP
rs912007620 2647 dbSNP
rs1463852920 2649 dbSNP
rs1331933045 2656 dbSNP
rs1210759396 2665 dbSNP
rs1356278048 2666 dbSNP
rs1264134628 2667 dbSNP
rs967674091 2671 dbSNP
rs1229793259 2674 dbSNP
rs141511101 2690 dbSNP
rs1450181943 2698 dbSNP
rs964106648 2700 dbSNP
rs1373422774 2703 dbSNP
rs976767074 2704 dbSNP
rs1385959478 2707 dbSNP
rs1335908748 2712 dbSNP
rs1379638831 2713 dbSNP
rs1388570406 2713 dbSNP
rs752007559 2713 dbSNP
rs759685887 2713 dbSNP
rs1029806401 2714 dbSNP
rs1198054279 2714 dbSNP
rs1200031832 2714 dbSNP
rs1265953521 2714 dbSNP
rs1275652973 2714 dbSNP
rs1329112164 2714 dbSNP
rs1350345631 2714 dbSNP
rs1395249443 2714 dbSNP
rs1429886086 2714 dbSNP
rs1451390121 2714 dbSNP
rs1483447604 2714 dbSNP
rs533354831 2714 dbSNP
rs746202260 2714 dbSNP
rs758613588 2714 dbSNP
rs781715788 2714 dbSNP
rs925985812 2714 dbSNP
rs935986405 2715 dbSNP
rs1396756007 2716 dbSNP
rs991574502 2717 dbSNP
rs982956162 2719 dbSNP
rs1218144590 2720 dbSNP
rs1259230975 2721 dbSNP
rs1320698767 2722 dbSNP
rs1202150487 2723 dbSNP
rs1237202433 2724 dbSNP
rs1483784082 2725 dbSNP
rs910146994 2726 dbSNP
rs1259294235 2730 dbSNP
rs1402553251 2734 dbSNP
rs1171627483 2738 dbSNP
rs1376254076 2739 dbSNP
rs42591 2739 dbSNP
rs1176311874 2740 dbSNP
rs1170858076 2741 dbSNP
rs12333608 2742 dbSNP
rs1425672181 2743 dbSNP
rs1468115297 2744 dbSNP
rs1175625263 2746 dbSNP
rs1359486793 2748 dbSNP
rs1467410519 2752 dbSNP
rs1304784343 2753 dbSNP
rs1360184436 2754 dbSNP
rs1399472919 2756 dbSNP
rs1281091091 2758 dbSNP
rs1278976426 2759 dbSNP
rs1342462930 2761 dbSNP
rs1222143077 2762 dbSNP
rs1278573833 2763 dbSNP
rs77186202 2764 dbSNP
rs1202907770 2765 dbSNP
rs1416152739 2765 dbSNP
rs991185899 2765 dbSNP
rs1212735978 2774 dbSNP
rs1412435596 2775 dbSNP
rs1258582838 2778 dbSNP
rs1487793220 2779 dbSNP
rs915990957 2781 dbSNP
rs1458038024 2782 dbSNP
rs554922668 2783 dbSNP
rs1411945557 2785 dbSNP
rs1193953193 2786 dbSNP
rs1046244694 2788 dbSNP
rs1473838586 2794 dbSNP
rs763560650 2798 dbSNP
rs1186866908 2799 dbSNP
rs555911864 2801 dbSNP
rs1440921615 2804 dbSNP
rs1286521814 2821 dbSNP
rs1209195817 2823 dbSNP
rs1328210680 2830 dbSNP
rs1266206033 2833 dbSNP
rs1235036531 2834 dbSNP
rs1379740152 2835 dbSNP
rs1283123101 2843 dbSNP
rs915545662 2857 dbSNP
rs1272624117 2858 dbSNP
rs949783721 2859 dbSNP
rs1190505374 2881 dbSNP
rs906328102 2883 dbSNP
rs574269197 2884 dbSNP
rs1036260606 2889 dbSNP
rs902922060 2899 dbSNP
rs898869350 2903 dbSNP
rs1157337947 2904 dbSNP
rs73687832 2905 dbSNP
rs1415076994 2906 dbSNP
rs553819326 2909 dbSNP
rs1054294104 2911 dbSNP
rs1471844008 2914 dbSNP
rs183376307 2915 dbSNP
rs545738809 2916 dbSNP
rs1189419413 2919 dbSNP
rs1464311636 2922 dbSNP
rs893078233 2925 dbSNP
rs1007444417 2938 dbSNP
rs1028628966 2939 dbSNP
rs1288981326 2943 dbSNP
rs1226172399 2954 dbSNP
rs756887228 2960 dbSNP
rs1419263202 2967 dbSNP
rs187379664 2969 dbSNP
rs1227246391 2970 dbSNP
rs529428816 2970 dbSNP
rs1362493077 2975 dbSNP
rs1403238648 2976 dbSNP
rs1438982969 2981 dbSNP
rs888873319 2982 dbSNP
rs1009039511 2985 dbSNP
rs115725530 2995 dbSNP
rs544054613 2996 dbSNP
rs1403716820 2999 dbSNP
rs192218052 3003 dbSNP
rs983393078 3007 dbSNP
rs1305234357 3009 dbSNP
rs1388478534 3015 dbSNP
rs1192716126 3023 dbSNP
rs1353444974 3026 dbSNP
rs1216838188 3028 dbSNP
rs1017093206 3029 dbSNP
rs1033223906 3034 dbSNP
rs963296394 3038 dbSNP
rs1274778737 3046 dbSNP
rs1226943435 3051 dbSNP
rs1489624946 3061 dbSNP
rs991700092 3069 dbSNP
rs957404628 3080 dbSNP
rs915598152 3087 dbSNP
rs1305158630 3092 dbSNP
rs1220237902 3093 dbSNP
rs1221361644 3094 dbSNP
rs991459756 3096 dbSNP
rs915861079 3103 dbSNP
rs1274826953 3109 dbSNP
rs1434975077 3115 dbSNP
rs950174793 3116 dbSNP
rs1308716415 3120 dbSNP
rs1429118618 3129 dbSNP
rs981085946 3132 dbSNP
rs1178496871 3135 dbSNP
rs924395797 3136 dbSNP
rs1424235515 3142 dbSNP
rs779215617 3145 dbSNP
rs1247210091 3147 dbSNP
rs1479000878 3151 dbSNP
rs750807445 3155 dbSNP
rs1210359063 3156 dbSNP
rs556025843 3157 dbSNP
rs1379378453 3160 dbSNP
rs934420935 3172 dbSNP
rs529475115 3174 dbSNP
rs1159422423 3178 dbSNP
rs374264149 3185 dbSNP
rs1352878879 3192 dbSNP
rs940502322 3197 dbSNP
rs1403675219 3198 dbSNP
rs770532186 3202 dbSNP
rs1348671482 3203 dbSNP
rs377646551 3205 dbSNP
rs1036312580 3207 dbSNP
rs879041358 3209 dbSNP
rs1358735594 3213 dbSNP
rs1038902392 3216 dbSNP
rs899089446 3218 dbSNP
rs1350559000 3221 dbSNP
rs761869661 3224 dbSNP
rs780559683 3234 dbSNP
rs1329949507 3245 dbSNP
rs1181325583 3246 dbSNP
rs1376564431 3254 dbSNP
rs1050105672 3255 dbSNP
rs370838915 3256 dbSNP
rs1008676952 3265 dbSNP
rs887224017 3267 dbSNP
rs1004265603 3268 dbSNP
rs547616739 3273 dbSNP
rs1227232169 3280 dbSNP
rs962887369 3283 dbSNP
rs1314951488 3293 dbSNP
rs1013077766 3295 dbSNP
rs1378794639 3297 dbSNP
rs903391659 3298 dbSNP
rs559794956 3312 dbSNP
rs1437061522 3318 dbSNP
rs533180923 3319 dbSNP
rs1158080281 3328 dbSNP
rs376168614 3329 dbSNP
rs747478804 3334 dbSNP
rs368555694 3341 dbSNP
rs1180351822 3343 dbSNP
rs981139915 3347 dbSNP
rs1422713287 3348 dbSNP
rs1382393540 3369 dbSNP
rs1190071968 3375 dbSNP
rs551326171 3383 dbSNP
rs1162896346 3384 dbSNP
rs1208430639 3386 dbSNP
rs1414576525 3387 dbSNP
rs768898956 3397 dbSNP
rs1245699943 3400 dbSNP
rs1169136769 3408 dbSNP
rs1033109339 3409 dbSNP
rs957623250 3410 dbSNP
rs1366152271 3411 dbSNP
rs914405532 3412 dbSNP
rs1447977663 3417 dbSNP
rs570435139 3420 dbSNP
rs781401231 3422 dbSNP
rs537776030 3434 dbSNP
rs971783642 3437 dbSNP
rs981587724 3438 dbSNP
rs42592 3442 dbSNP
rs961418958 3443 dbSNP
rs1169899645 3447 dbSNP
rs1038822484 3448 dbSNP
rs1389111969 3450 dbSNP
rs567951975 3459 dbSNP
rs997967221 3460 dbSNP
rs541698346 3467 dbSNP
rs1446745330 3469 dbSNP
rs1284452447 3471 dbSNP
rs1210934758 3480 dbSNP
rs1488413498 3483 dbSNP
rs1289724347 3490 dbSNP
rs1207300806 3491 dbSNP
rs920403265 3495 dbSNP
rs200894123 3499 dbSNP
rs1297123440 3516 dbSNP
rs930560776 3519 dbSNP
rs1050759156 3524 dbSNP
rs1301951072 3533 dbSNP
rs1386158923 3537 dbSNP
rs770058137 3545 dbSNP
rs150863902 3547 dbSNP
rs944369628 3549 dbSNP
rs1429813607 3556 dbSNP
rs1200473592 3560 dbSNP
rs1369638526 3569 dbSNP
rs560031279 3572 dbSNP
rs902941810 3573 dbSNP
rs572068398 3579 dbSNP
rs1187045590 3583 dbSNP
rs1267313452 3588 dbSNP
rs773248907 3588 dbSNP
rs1054573291 3590 dbSNP
rs1274236699 3590 dbSNP
rs539079915 3594 dbSNP
rs139611088 3599 dbSNP
rs1473801585 3602 dbSNP
rs1347330311 3617 dbSNP
rs184776786 3618 dbSNP
rs1423519483 3635 dbSNP
rs1013143643 3636 dbSNP
rs42593 3642 dbSNP
rs1290135946 3650 dbSNP
rs1409948520 3653 dbSNP
rs1429718686 3658 dbSNP
rs971454494 3662 dbSNP
rs1349315071 3671 dbSNP
rs1003291957 3672 dbSNP
rs1015554584 3673 dbSNP
rs1402389186 3676 dbSNP
rs1173541520 3678 dbSNP
rs961467746 3681 dbSNP
rs1469598135 3687 dbSNP
rs188094669 3691 dbSNP
rs771719570 3694 dbSNP
rs1334374402 3699 dbSNP
rs1472986177 3704 dbSNP
rs1251196395 3706 dbSNP
rs1341966324 3707 dbSNP
rs115928752 3711 dbSNP
rs1444361136 3714 dbSNP
rs1257113280 3718 dbSNP
rs1031770416 3724 dbSNP
rs775442952 3728 dbSNP
rs920449348 3729 dbSNP
rs1321116883 3732 dbSNP
rs545950562 3732 dbSNP
rs951845667 3733 dbSNP
rs774606324 3734 dbSNP
rs79934850 3735 dbSNP
rs541572469 3736 dbSNP
rs559601986 3737 dbSNP
rs910457180 3738 dbSNP
rs1333088835 3739 dbSNP
rs1452419251 3740 dbSNP
rs964429096 3744 dbSNP
rs944598016 3745 dbSNP
rs1458254811 3747 dbSNP
rs1040450324 3748 dbSNP
rs1279593287 3750 dbSNP
rs924249512 3751 dbSNP
rs1407824741 3752 dbSNP
rs559607620 3753 dbSNP
rs1473816515 3754 dbSNP
rs934437090 3758 dbSNP
rs1214736368 3760 dbSNP
rs1183203306 3768 dbSNP
rs1262476081 3770 dbSNP
rs1249697482 3776 dbSNP
rs1209050246 3777 dbSNP
rs1464395516 3785 dbSNP
rs1478207355 3788 dbSNP
rs1282047514 3789 dbSNP
rs1054122318 3798 dbSNP
rs1356399123 3799 dbSNP
rs974582614 3800 dbSNP
rs893341275 3801 dbSNP
rs74689925 3802 dbSNP
rs1322970459 3803 dbSNP
rs1436263279 3807 dbSNP
rs933242440 3810 dbSNP
rs1316816488 3826 dbSNP
rs1407204794 3837 dbSNP
rs1391573315 3838 dbSNP
rs1044532401 3846 dbSNP
rs763650017 3853 dbSNP
rs1162966098 3856 dbSNP
rs192666620 3859 dbSNP
rs1392195383 3865 dbSNP
rs1417409648 3868 dbSNP
rs1016029537 3869 dbSNP
rs1474956613 3874 dbSNP
rs908550987 3877 dbSNP
rs112241149 3892 dbSNP
rs995619234 3893 dbSNP
rs563737458 3906 dbSNP
rs1038774136 3915 dbSNP
rs1027063231 3918 dbSNP
rs1401363423 3924 dbSNP
rs1297875599 3928 dbSNP
rs951897912 3940 dbSNP
rs986370487 3941 dbSNP
rs1361676525 3949 dbSNP
rs1299070192 3954 dbSNP
rs1439259809 3957 dbSNP
rs1330520196 3958 dbSNP
rs529310400 3959 dbSNP
rs898614519 3961 dbSNP
rs1017401769 3963 dbSNP
rs966368306 3966 dbSNP
rs975999525 3967 dbSNP
rs1409206744 3968 dbSNP
rs924311742 3971 dbSNP
rs1214676277 3973 dbSNP
rs530801436 3975 dbSNP
rs934322713 3982 dbSNP
rs1268019229 3988 dbSNP
rs1414481720 3992 dbSNP
rs116662794 3994 dbSNP
rs1483733781 3994 dbSNP
rs892027618 3996 dbSNP
rs1203408453 4004 dbSNP
rs1265871117 4004 dbSNP
rs1305360311 4006 dbSNP
rs1451482069 4010 dbSNP
rs1271330828 4015 dbSNP
rs1200208841 4020 dbSNP
rs368341460 4038 dbSNP
rs568296683 4040 dbSNP
rs1368991165 4050 dbSNP
rs1283198289 4053 dbSNP
rs1438256139 4058 dbSNP
rs1157658656 4059 dbSNP
rs1352389590 4059 dbSNP
rs749998496 4063 dbSNP
rs1352908933 4064 dbSNP
rs1357028749 4069 dbSNP
rs371804663 4072 dbSNP
rs948465325 4076 dbSNP
rs1414809746 4095 dbSNP
rs1428566650 4100 dbSNP
rs1174159286 4102 dbSNP
rs1473506075 4110 dbSNP
rs1251948004 4119 dbSNP
rs1176060994 4121 dbSNP
rs1420985065 4127 dbSNP
rs1291342375 4130 dbSNP
rs543004680 4135 dbSNP
rs1212763643 4141 dbSNP
rs1324676349 4146 dbSNP
rs907346041 4151 dbSNP
rs780536512 4156 dbSNP
rs1331781794 4159 dbSNP
rs1298124724 4168 dbSNP
rs1037272918 4169 dbSNP
rs974425859 4170 dbSNP
rs763934394 4171 dbSNP
rs530397852 4173 dbSNP
rs954517955 4175 dbSNP
rs995503306 4176 dbSNP
rs1405116487 4178 dbSNP
rs907825716 4180 dbSNP
rs146533721 4183 dbSNP
rs867849211 4198 dbSNP
rs1354770573 4199 dbSNP
rs889875142 4200 dbSNP
rs1006945369 4203 dbSNP
rs1416788044 4205 dbSNP
rs139426270 4214 dbSNP
rs965895661 4218 dbSNP
rs1355772121 4224 dbSNP
rs1242952464 4235 dbSNP
rs111981091 4244 dbSNP
rs1261810236 4261 dbSNP
rs200298506 4267 dbSNP
rs1044468486 4268 dbSNP
rs1255504172 4273 dbSNP
rs1315183080 4287 dbSNP
rs1031549188 4290 dbSNP
rs1364157078 4291 dbSNP
rs907271210 4297 dbSNP
rs955920027 4299 dbSNP
rs1312664180 4306 dbSNP
rs1389374807 4310 dbSNP
rs557871367 4311 dbSNP
rs1178487437 4318 dbSNP
rs42594 4319 dbSNP
rs1441093885 4321 dbSNP
rs1443632504 4321 dbSNP
rs757222368 4326 dbSNP
rs914211383 4333 dbSNP
rs1451711629 4341 dbSNP
rs1012209772 4344 dbSNP
rs1205086211 4345 dbSNP
rs1021250201 4354 dbSNP
rs527683143 4361 dbSNP
rs1267312900 4362 dbSNP
rs1162260313 4366 dbSNP
rs1359065355 4367 dbSNP
rs537042852 4370 dbSNP
rs1289859643 4391 dbSNP
rs1230389893 4394 dbSNP
rs1326780520 4401 dbSNP
rs1380489009 4401 dbSNP
rs900155348 4401 dbSNP
rs1457985490 4402 dbSNP
rs948494316 4409 dbSNP
rs1423437516 4410 dbSNP
rs42595 4422 dbSNP
rs1445767645 4435 dbSNP
rs954594817 4439 dbSNP
rs928824443 4444 dbSNP
rs1378845492 4448 dbSNP
rs938854684 4451 dbSNP
rs1310875429 4456 dbSNP
rs189315516 4457 dbSNP
rs963327858 4458 dbSNP
rs1245670358 4459 dbSNP
rs1340269672 4479 dbSNP
rs1275598360 4481 dbSNP
rs1224890497 4482 dbSNP
rs973704109 4494 dbSNP
rs1316660248 4506 dbSNP
rs1283842026 4511 dbSNP
rs1403839401 4516 dbSNP
rs897412718 4526 dbSNP
rs1259028336 4528 dbSNP
rs1309277976 4530 dbSNP
rs1481839171 4548 dbSNP
rs1391620441 4549 dbSNP
rs1395254169 4554 dbSNP
rs1179697543 4564 dbSNP
rs1460784745 4565 dbSNP
rs1255104400 4568 dbSNP
rs1423857768 4570 dbSNP
rs1189527508 4576 dbSNP
rs1480367093 4581 dbSNP
rs541286794 4584 dbSNP
rs1184353746 4591 dbSNP
rs1438623258 4608 dbSNP
rs948726727 4618 dbSNP
rs760698765 4625 dbSNP
rs1040782738 4627 dbSNP
rs1484092578 4633 dbSNP
rs1464978210 4648 dbSNP
rs868200078 4654 dbSNP
rs1048437324 4657 dbSNP
rs928746261 4670 dbSNP
rs755530534 4672 dbSNP
rs938758968 4675 dbSNP
rs1239126798 4683 dbSNP
rs1007407216 4685 dbSNP
rs553558244 4687 dbSNP
rs1334874205 4710 dbSNP
rs42596 4718 dbSNP
rs891921490 4734 dbSNP
rs1408784103 4743 dbSNP
rs901715428 4745 dbSNP
rs1469742043 4748 dbSNP
rs997308676 4749 dbSNP
rs1464400212 4756 dbSNP
rs1160424118 4762 dbSNP
rs1031434494 4765 dbSNP
rs545136201 4776 dbSNP
rs1179892224 4778 dbSNP
rs1444305964 4780 dbSNP
rs1043261532 4783 dbSNP
rs1202738685 4792 dbSNP
rs900750874 4798 dbSNP
rs1269938079 4811 dbSNP
rs1378808463 4814 dbSNP
rs1277218340 4823 dbSNP
rs1349306717 4823 dbSNP
rs1011426179 4827 dbSNP
rs1246572381 4832 dbSNP
rs1021269817 4846 dbSNP
rs1316185753 4847 dbSNP
rs1452356385 4847 dbSNP
rs766621414 4847 dbSNP
rs1404617110 4858 dbSNP
rs1295144340 4859 dbSNP
rs1338521663 4861 dbSNP
rs1051370155 4863 dbSNP
rs1279409962 4879 dbSNP
rs1446690417 4882 dbSNP
rs969738074 4889 dbSNP
rs1182829144 4891 dbSNP
rs980293257 4893 dbSNP
rs928401688 4895 dbSNP
rs551634126 4902 dbSNP
rs373141179 4909 dbSNP
rs748249043 4913 dbSNP
rs1014777637 4916 dbSNP
rs1208515905 4919 dbSNP
rs1255044809 4923 dbSNP
rs1281526694 4924 dbSNP
rs963513006 4924 dbSNP
rs918727945 4939 dbSNP
rs1359779426 4940 dbSNP
rs769710499 4949 dbSNP
rs1290574273 4963 dbSNP
rs1048657453 4972 dbSNP
rs1245751548 4973 dbSNP
rs1483405303 4975 dbSNP
rs994658802 4980 dbSNP
rs1272239450 4994 dbSNP
rs563436698 5004 dbSNP
rs754026637 5004 dbSNP
rs1023578279 5007 dbSNP
rs911249337 5008 dbSNP
rs1316388479 5009 dbSNP
rs1426622371 5012 dbSNP
rs942715709 5016 dbSNP
rs1041406779 5025 dbSNP
rs530815547 5026 dbSNP
rs1194271662 5033 dbSNP
rs181735276 5035 dbSNP
rs766732305 5036 dbSNP
rs758260305 5041 dbSNP
rs1240267137 5045 dbSNP
rs1201035535 5054 dbSNP
rs561852586 5055 dbSNP
rs989280217 5059 dbSNP
rs1267794440 5065 dbSNP
rs1011477158 5075 dbSNP
rs1219824415 5095 dbSNP
rs778083371 5106 dbSNP
rs749439348 5107 dbSNP
rs529160545 5111 dbSNP
rs1001210086 5113 dbSNP
rs1339385875 5122 dbSNP
rs564970056 5126 dbSNP
rs1268903487 5128 dbSNP
rs947572463 5131 dbSNP
rs763783871 5132 dbSNP
rs547355654 5136 dbSNP
rs565903983 5137 dbSNP
rs1170952060 5140 dbSNP
rs1409146468 5147 dbSNP
rs542513886 5148 dbSNP
rs149966255 5152 dbSNP
rs918780068 5155 dbSNP
rs1399526634 5164 dbSNP
rs1178472804 5170 dbSNP
rs374881010 5171 dbSNP
rs1480693841 5180 dbSNP
rs1428023041 5184 dbSNP
rs1279353218 5189 dbSNP
rs922227428 5192 dbSNP
rs1364782878 5196 dbSNP
rs952841523 5200 dbSNP
rs1437593805 5201 dbSNP
rs1256510441 5206 dbSNP
rs1300948443 5206 dbSNP
rs1324816886 5210 dbSNP
rs771950750 5222 dbSNP
rs1375882722 5223 dbSNP
rs1235981883 5230 dbSNP
rs1283499141 5231 dbSNP
rs1487658435 5232 dbSNP
rs1051379884 5238 dbSNP
rs1470257347 5239 dbSNP
rs751580809 5246 dbSNP
rs1173721621 5255 dbSNP
rs530586550 5256 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' --uacaggagcaacUGCUGCUa 3'
1 - 20
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000323037.4 | 3UTR | UACAGGAGCAACUGCUGCUACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.671 6.0e-4 0.750 7.0e-5 20 Click to see details
GSE21032 Prostate cancer -0.235 1.6e-2 -0.229 1.9e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.41 3.6e-2 0.371 5.4e-2 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.354 4.5e-2 0.350 4.7e-2 24 Click to see details
GSE19536 Breast cancer 0.156 6.1e-2 0.099 1.6e-1 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.317 7.0e-2 0.306 7.8e-2 23 Click to see details
GSE27834 Pluripotent stem cells -0.381 7.3e-2 -0.424 5.1e-2 16 Click to see details
GSE28260 Renal cortex and medulla 0.312 1.5e-1 0.198 2.6e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.11 1.7e-1 0.029 4.0e-1 79 Click to see details
GSE28544 Breast cancer -0.142 2.5e-1 -0.521 4.5e-3 24 Click to see details
GSE19350 CNS germ cell tumors -0.121 3.5e-1 -0.196 2.7e-1 12 Click to see details
GSE17306 Multiple myeloma -0.049 3.7e-1 -0.039 4.0e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.036 3.9e-1 -0.012 4.6e-1 64 Click to see details
GSE21849 B cell lymphoma -0.035 4.3e-1 0.065 3.7e-1 29 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.02 4.6e-1 -0.049 4.1e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.019 4.6e-1 0.240 1.2e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.013 4.7e-1 0.021 4.5e-1 32 Click to see details
GSE38226 Liver fibrosis -0.014 4.8e-1 -0.082 3.6e-1 21 Click to see details
GSE14794 Lymphoblastoid cells -0.004 4.9e-1 0.037 3.6e-1 90 Click to see details
GSE14794 Lymphoblastoid cells -0.004 4.9e-1 0.037 3.6e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.581 0 0.573 0 32 Click to see details
BLCA 0.526 0.01 0.364 0.07 18 Click to see details
HNSC 0.341 0.01 0.342 0.01 42 Click to see details
LIHC -0.267 0.03 -0.118 0.21 49 Click to see details
BRCA -0.117 0.14 -0.095 0.2 84 Click to see details
CHOL 0.302 0.21 0.383 0.15 9 Click to see details
UCEC -0.191 0.22 -0.186 0.22 19 Click to see details
PRAD 0.11 0.22 0.216 0.07 50 Click to see details
KIRC 0.091 0.23 0.086 0.24 68 Click to see details
CESC 0.669 0.27 0.500 0.33 3 Click to see details
THCA 0.072 0.29 0.193 0.07 59 Click to see details
KICH 0.104 0.31 0.133 0.26 25 Click to see details
KIRP -0.089 0.31 -0.132 0.24 32 Click to see details
PAAD 0.304 0.35 -0.200 0.4 4 Click to see details
LUAD 0.063 0.42 0.035 0.46 12 Click to see details
PCPG -0.201 0.44 0.500 0.33 3 Click to see details
COAD 0.038 0.46 -0.190 0.33 8 Click to see details
ESCA 0.021 0.48 -0.118 0.36 11 Click to see details
LUSC -0.005 0.49 -0.047 0.39 38 Click to see details
LUSC -0.005 0.49 -0.047 0.39 38 Click to see details
LUSC -0.005 0.49 -0.047 0.39 38 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460