miRTarBase - #MIRT324745 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACER2   
Synonyms ALKCDase2, ASAH3L
Description alkaline ceramidase 2
Transcript NM_001010887   
Expression
Putative miRNA Targets on ACER2
3'UTR of ACER2
(miRNA target sites are highlighted)
>ACER2|NM_001010887|3'UTR
   1 TGGCAAGATGGTGGCTGGCTTCTCTGCTTATCGCCCCTCATGCAGTGGGCTTCCTTTGCTAGGAAGACAGCCAAGGGAGT
  81 TCGAATAGTTGGGGTGTGGGCTATCTTTTCAAAAATCTATTTGCTGGGGCTCTTAATTTCTTTAGTGTTCTTTGTATGTA
 161 GGGATTTAAACTTTGTCATATGGTACAAATATTCCCTGCCCCCCTGCAGTTTCCCATTTGTCTTTCAGTATGTTAATATT
 241 TTTGTGCCATACTGGTTTTAAACTTTCATGTTGTCACATCTGTTAATCTTTTCTTTAGGATTTCTGGATTTTGTGTAATT
 321 TTTAAAAAGGTCCCCTCCTCCTCCCTAATGTGTCTGTGGACCACCTGGATTCCACTGTACAAGGGGAAAAGTGTCTATTC
 401 CTTTCCCAAAGATGGAAAATGGAGGGCTTAGGGACACTAGATGCATCTTTCTCAGCATCACTTCCAGATGCAGTGACTTG
 481 TTGGGCTGCGTCCTTAATGGCCATGGCAGAGCAGTCCCTTGGGGGATCCAGCCCTGTACAATGCATCTCTTCCTGGAGAA
 561 AGCTGGCCTGCTCCAGACCCCACCATTCCCAGGCGCCCTTGGAGTGGACTCTACTGATGACAGACAGACCCTCTGAGAGA
 641 CAAGACCCTCTGACTCTGTGATGGAAGATGCCAGAGATTTTCCTTTGGGGTAATTGTCCTTAAACAAAACCAAACAGATG
 721 AAACACACACAGGACTTGTGGCTAAAAAGGCTAGTTTTTCACTTGCATTTCTCAACTAACCCAGGTTTTACATGCATCTG
 801 TGAATCCTTTTACTACTACCTCTGTGGAGAGATGGAGAGACTTCAGATAAACGTGAAGCTAATGAGTAAAACCCTCTCTG
 881 CCAAAACCTACACTCCACTTTAGGCCCTTCTTGAAGATGAGCACAATTTTTAAATACTGAGCACAATTTTTAAATACTGA
 961 CATCACTTCCTCTTCCCCCTCCCACCCCAGCTCAGCAGCCTCAAATCTACAGAGAAGAAGAATTATGGCATGAACATTCC
1041 CACAGACCCACCATCTTTAAGACTTGACCTCTGTAAGTTTACCAAAGGGCTCCTCACAATTGTGGTGGGGGTTCTGGTTC
1121 AAAATTTGGAGCAAACATGAAGTTTTTGGAAACGTTTTCTCATTTGAAGCCTCCAGTATGCTGTACTATTCTGGAAATTA
1201 CCTTCAAGAGTCTCACTTCTTGTTTCTGTTGTGTTTTCTGTGGGCATCATGTTCTTCACGCTTGCAGTAGAAGGTGCTTT
1281 CTCGGTTTCCCAGAGTATCCAACGGCTCACCTTTCTCAAGTGCTGGCAGTAGCTATGCACTCACGGGCTGGTTTGGGTCG
1361 CTGGTGCAGCAGCGCAAATCTGTTGCCTTCTGAATTTTTCTCACCTAATGTGACACTGGCTACAATGAATCTTCTCTTCA
1441 TCGGGCTGAATGAAAGATTCAAGAACCATCTTCAAGGTGCATGGTGGGAATTATCAACCTCAGGGATACTCATTTTAACT
1521 CAGGCGTGTCCTGCTTTGTAACATTCCATTGTTGGGAGAGGGCAGGACAGGTGTGTTCTTCTGTGGGCAGGAGTCATGTC
1601 ACTGTCCTACATATGTAAGAGTTGGGAAGGTGACGATTTTTGACACATCCAGGAACTCTTACTCTAGTTAGAATTTGTAC
1681 CAGATCCAAGGTGAAAACCCCAATAAGCAACTGAATTTAGAGTTTAAAAATGAATGACTTTATGCTACATCTGTGGTTAT
1761 CAAATTATATAGGTTGTTGAGAAGCAGAACGCTGTTTGTAGTAAGAAATCTTTGTGGAACCCCAGTGTGTGAAGTAAATT
1841 GTATGTTATTAAATTTATTTAAGGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |||     :||||||| 
Target 5' ccAAAACC-----TACACTCCa 3'
881 - 897 147.00 -15.40
2
miRNA  3' guuugugGUAACAGUGUGAGGu 5'
                 | |||| |||:||| 
Target 5' tgtcctgCTTTGTAACATTCCa 3'
1527 - 1548 143.00 -14.40
3
miRNA  3' guUUGUGGUAAC--A-GUGUGAGGu 5'
            |: |::|| |  |  |||:||| 
Target 5' gaAGAATTATGGCATGAACATTCCc 3'
1017 - 1041 130.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31506179 31 COSMIC
COSN30726443 33 COSMIC
COSN14386757 34 COSMIC
COSN30450684 46 COSMIC
COSN30455471 76 COSMIC
COSN30111944 83 COSMIC
COSN31599149 84 COSMIC
COSN1376453 95 COSMIC
COSN30186272 104 COSMIC
COSN30116007 120 COSMIC
COSN31963031 122 COSMIC
COSN29814822 275 COSMIC
COSN26647458 751 COSMIC
COSN31520740 772 COSMIC
COSN28775539 774 COSMIC
COSN26569374 802 COSMIC
COSN31595336 823 COSMIC
COSN26568120 830 COSMIC
COSN31593542 853 COSMIC
COSN26569648 857 COSMIC
COSN31537540 866 COSMIC
COSN14704065 972 COSMIC
COSN20301727 1182 COSMIC
COSN31557318 1265 COSMIC
COSN20106073 1317 COSMIC
COSN14903370 1318 COSMIC
COSN15668381 1361 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs746504706 1 dbSNP
rs1208557158 2 dbSNP
rs200253184 7 dbSNP
rs190538177 9 dbSNP
rs749693223 10 dbSNP
rs181043105 12 dbSNP
rs1431841980 15 dbSNP
rs1280463576 16 dbSNP
rs774834829 19 dbSNP
rs185934057 20 dbSNP
rs772702290 29 dbSNP
rs1378587841 30 dbSNP
rs190124016 33 dbSNP
rs760616235 34 dbSNP
rs766630650 36 dbSNP
rs369193535 37 dbSNP
rs1344108521 38 dbSNP
rs759399921 40 dbSNP
rs765070241 41 dbSNP
rs1273506074 43 dbSNP
rs752461868 44 dbSNP
rs562751101 46 dbSNP
rs1211123854 50 dbSNP
rs777625523 51 dbSNP
rs1405214610 55 dbSNP
rs1450317977 57 dbSNP
rs1322523248 58 dbSNP
rs1441782860 70 dbSNP
rs1019348949 73 dbSNP
rs900525967 79 dbSNP
rs1454801375 80 dbSNP
rs996600402 84 dbSNP
rs968112226 90 dbSNP
rs1285413545 99 dbSNP
rs1328260452 100 dbSNP
rs1219167313 101 dbSNP
rs1351962380 104 dbSNP
rs1238929728 120 dbSNP
rs1431657172 120 dbSNP
rs143913336 122 dbSNP
rs1276056890 127 dbSNP
rs1434226669 130 dbSNP
rs1318883668 131 dbSNP
rs1421348852 136 dbSNP
rs1358366251 138 dbSNP
rs551546294 141 dbSNP
rs1427383878 145 dbSNP
rs1189492561 157 dbSNP
rs960938511 160 dbSNP
rs1243269518 163 dbSNP
rs992445627 178 dbSNP
rs7855778 179 dbSNP
rs974153806 194 dbSNP
rs1280127399 199 dbSNP
rs563612990 199 dbSNP
rs1202320063 200 dbSNP
rs1343655600 203 dbSNP
rs929747989 204 dbSNP
rs1046921838 216 dbSNP
rs890991438 231 dbSNP
rs1297302949 233 dbSNP
rs943936756 247 dbSNP
rs1191864985 249 dbSNP
rs7855804 250 dbSNP
rs899763854 251 dbSNP
rs181099102 259 dbSNP
rs1176760210 263 dbSNP
rs1262933443 264 dbSNP
rs1022255638 268 dbSNP
rs1468089607 271 dbSNP
rs764330118 274 dbSNP
rs903944866 285 dbSNP
rs1220417212 287 dbSNP
rs185933565 287 dbSNP
rs1315928224 288 dbSNP
rs777007872 289 dbSNP
rs1160218823 295 dbSNP
rs549393206 297 dbSNP
rs1228742633 300 dbSNP
rs1381058651 302 dbSNP
rs370469884 316 dbSNP
rs1301369660 324 dbSNP
rs1447539934 325 dbSNP
rs1031116444 330 dbSNP
rs7856222 331 dbSNP
rs539784267 335 dbSNP
rs1406974835 338 dbSNP
rs765754090 339 dbSNP
rs1023854419 341 dbSNP
rs1412035605 352 dbSNP
rs1345272517 353 dbSNP
rs1472233068 357 dbSNP
rs970046635 362 dbSNP
rs1199909942 363 dbSNP
rs558327246 375 dbSNP
rs190634499 376 dbSNP
rs1257410216 378 dbSNP
rs534265237 381 dbSNP
rs1262955911 385 dbSNP
rs973760595 386 dbSNP
rs555920357 387 dbSNP
rs574215593 406 dbSNP
rs1227969638 409 dbSNP
rs117421848 412 dbSNP
rs1311733069 414 dbSNP
rs982550574 421 dbSNP
rs1399611271 430 dbSNP
rs1294670991 446 dbSNP
rs1459861522 448 dbSNP
rs555096610 452 dbSNP
rs866065294 454 dbSNP
rs1199681377 455 dbSNP
rs1422885608 462 dbSNP
rs766823425 466 dbSNP
rs577869235 468 dbSNP
rs1437334412 471 dbSNP
rs1237004102 474 dbSNP
rs1479294657 475 dbSNP
rs1183736720 486 dbSNP
rs1263458186 490 dbSNP
rs544981013 491 dbSNP
rs560250995 504 dbSNP
rs116181661 505 dbSNP
rs1043701091 508 dbSNP
rs903892683 510 dbSNP
rs1376293537 513 dbSNP
rs12002047 515 dbSNP
rs1156779544 518 dbSNP
rs1358691043 520 dbSNP
rs1052439846 523 dbSNP
rs1293455591 525 dbSNP
rs372704190 536 dbSNP
rs1303920002 539 dbSNP
rs896571286 542 dbSNP
rs1362826039 548 dbSNP
rs1385407110 556 dbSNP
rs1309644592 564 dbSNP
rs146162661 568 dbSNP
rs1176066660 569 dbSNP
rs1238933903 572 dbSNP
rs1024260749 574 dbSNP
rs1265249528 575 dbSNP
rs1190528275 578 dbSNP
rs183580902 579 dbSNP
rs1214749269 586 dbSNP
rs996188202 589 dbSNP
rs1360967922 592 dbSNP
rs554297793 595 dbSNP
rs60768880 596 dbSNP
rs982458979 609 dbSNP
rs1489731579 611 dbSNP
rs571200904 612 dbSNP
rs533627957 614 dbSNP
rs912283289 616 dbSNP
rs1397748447 626 dbSNP
rs1383871701 632 dbSNP
rs965506974 634 dbSNP
rs1250928813 640 dbSNP
rs1375396503 642 dbSNP
rs1220475705 643 dbSNP
rs551803665 646 dbSNP
rs1418347652 650 dbSNP
rs975270872 657 dbSNP
rs921131709 661 dbSNP
rs947313438 662 dbSNP
rs567027489 672 dbSNP
rs1387022711 693 dbSNP
rs534110180 694 dbSNP
rs924543675 712 dbSNP
rs935299135 712 dbSNP
rs1164321117 724 dbSNP
rs1482342752 725 dbSNP
rs1365149121 726 dbSNP
rs1219811982 728 dbSNP
rs1320533468 731 dbSNP
rs1052389318 733 dbSNP
rs1218468035 734 dbSNP
rs747865465 736 dbSNP
rs1397374941 739 dbSNP
rs556032633 751 dbSNP
rs1335420761 756 dbSNP
rs1466080014 763 dbSNP
rs1402457598 767 dbSNP
rs1474990133 768 dbSNP
rs755894157 770 dbSNP
rs1397640004 777 dbSNP
rs1391245686 782 dbSNP
rs1422238617 792 dbSNP
rs905381614 801 dbSNP
rs1329823965 807 dbSNP
rs995691231 808 dbSNP
rs1027212651 816 dbSNP
rs1286270376 820 dbSNP
rs1246007210 825 dbSNP
rs1246551580 828 dbSNP
rs1338268142 834 dbSNP
rs1313920173 836 dbSNP
rs188959445 839 dbSNP
rs538391479 842 dbSNP
rs1003844791 850 dbSNP
rs777597158 853 dbSNP
rs1019739431 854 dbSNP
rs965150294 857 dbSNP
rs1384906812 860 dbSNP
rs1284473885 862 dbSNP
rs975598330 864 dbSNP
rs1441665195 865 dbSNP
rs1236387587 874 dbSNP
rs1181746749 891 dbSNP
rs1028140399 892 dbSNP
rs556282131 899 dbSNP
rs370907419 901 dbSNP
rs1356076359 902 dbSNP
rs1290644644 911 dbSNP
rs1045353282 918 dbSNP
rs142441473 920 dbSNP
rs1306398454 927 dbSNP
rs1441411697 928 dbSNP
rs150881610 940 dbSNP
rs553801743 942 dbSNP
rs544851883 943 dbSNP
rs1384908716 947 dbSNP
rs917937240 947 dbSNP
rs1364696989 948 dbSNP
rs770863316 950 dbSNP
rs192251135 952 dbSNP
rs1421699751 966 dbSNP
rs1378561761 967 dbSNP
rs1461739408 970 dbSNP
rs1182955489 971 dbSNP
rs2891133 972 dbSNP
rs1422195557 976 dbSNP
rs1490302382 978 dbSNP
rs1264285027 980 dbSNP
rs905290942 985 dbSNP
rs1355320162 986 dbSNP
rs1281538320 991 dbSNP
rs931436332 992 dbSNP
rs1461747140 993 dbSNP
rs1345076185 998 dbSNP
rs1276599450 1002 dbSNP
rs1048600189 1007 dbSNP
rs182606356 1009 dbSNP
rs1408883901 1012 dbSNP
rs762427098 1013 dbSNP
rs1004502149 1021 dbSNP
rs1358929510 1029 dbSNP
rs1317902933 1032 dbSNP
rs1019264371 1033 dbSNP
rs1427326600 1036 dbSNP
rs1336700485 1037 dbSNP
rs117977795 1038 dbSNP
rs542989346 1040 dbSNP
rs1383423461 1043 dbSNP
rs139335534 1048 dbSNP
rs1295776222 1054 dbSNP
rs543117600 1065 dbSNP
rs879033428 1070 dbSNP
rs1240045816 1074 dbSNP
rs762174056 1078 dbSNP
rs1306587223 1089 dbSNP
rs996545554 1092 dbSNP
rs1221618586 1093 dbSNP
rs564864322 1094 dbSNP
rs150022470 1096 dbSNP
rs547398049 1099 dbSNP
rs1031500044 1102 dbSNP
rs1448967150 1106 dbSNP
rs1360997411 1111 dbSNP
rs374175884 1113 dbSNP
rs1332197598 1115 dbSNP
rs1469748070 1117 dbSNP
rs955941444 1119 dbSNP
rs1173424564 1130 dbSNP
rs187689495 1138 dbSNP
rs1235729781 1139 dbSNP
rs1482279833 1144 dbSNP
rs528034517 1149 dbSNP
rs7032360 1154 dbSNP
rs949383203 1155 dbSNP
rs770252614 1157 dbSNP
rs926663013 1160 dbSNP
rs931426466 1162 dbSNP
rs567865371 1165 dbSNP
rs1271971538 1172 dbSNP
rs12343276 1174 dbSNP
rs41270117 1176 dbSNP
rs1041671817 1179 dbSNP
rs766847726 1182 dbSNP
rs1288978099 1184 dbSNP
rs1377718489 1189 dbSNP
rs1333983226 1192 dbSNP
rs1464487641 1193 dbSNP
rs571586278 1203 dbSNP
rs538632380 1206 dbSNP
rs1407424050 1207 dbSNP
rs901432102 1208 dbSNP
rs996875416 1218 dbSNP
rs1284868613 1222 dbSNP
rs1443534266 1242 dbSNP
rs1345906176 1244 dbSNP
rs1222677941 1246 dbSNP
rs1049445224 1249 dbSNP
rs554170293 1253 dbSNP
rs867265231 1260 dbSNP
rs752010810 1261 dbSNP
rs1323277403 1262 dbSNP
rs999928576 1270 dbSNP
rs1318679958 1273 dbSNP
rs1031446035 1274 dbSNP
rs1390182597 1277 dbSNP
rs955847850 1285 dbSNP
rs1439099641 1304 dbSNP
rs1014099782 1305 dbSNP
rs1161307804 1307 dbSNP
rs1024610779 1311 dbSNP
rs970004586 1312 dbSNP
rs112164706 1316 dbSNP
rs373060253 1317 dbSNP
rs55751242 1317 dbSNP
rs17565631 1318 dbSNP
rs756613169 1318 dbSNP
rs202212878 1320 dbSNP
rs1191669447 1327 dbSNP
rs908647096 1334 dbSNP
rs759084396 1335 dbSNP
rs1222034233 1343 dbSNP
rs554296522 1345 dbSNP
rs550218500 1346 dbSNP
rs1421367386 1351 dbSNP
rs1160534666 1352 dbSNP
rs1344079089 1356 dbSNP
rs371633826 1360 dbSNP
rs940143703 1361 dbSNP
rs1365821212 1363 dbSNP
rs1403966369 1365 dbSNP
rs1290261587 1370 dbSNP
rs1041219014 1372 dbSNP
rs1362682516 1374 dbSNP
rs374126446 1375 dbSNP
rs1434772549 1381 dbSNP
rs1375305147 1383 dbSNP
rs1224246648 1386 dbSNP
rs1198498973 1389 dbSNP
rs1478024445 1408 dbSNP
rs932952175 1414 dbSNP
rs767075390 1415 dbSNP
rs1049847963 1419 dbSNP
rs752328743 1420 dbSNP
rs1424772991 1424 dbSNP
rs1353070076 1425 dbSNP
rs1485597054 1425 dbSNP
rs191846430 1426 dbSNP
rs1283187097 1428 dbSNP
rs1052772532 1435 dbSNP
rs1490584928 1443 dbSNP
rs543086924 1444 dbSNP
rs1380133538 1451 dbSNP
rs1383629751 1458 dbSNP
rs1302861797 1461 dbSNP
rs755433629 1463 dbSNP
rs1358546670 1469 dbSNP
rs564807335 1476 dbSNP
rs1481858784 1478 dbSNP
rs1178278257 1483 dbSNP
rs777434555 1485 dbSNP
rs1374534702 1489 dbSNP
rs1191341749 1495 dbSNP
rs1428073188 1495 dbSNP
rs1256966545 1497 dbSNP
rs891553351 1501 dbSNP
rs1460032583 1502 dbSNP
rs1263102100 1504 dbSNP
rs1380229789 1526 dbSNP
rs1320466358 1527 dbSNP
rs532268513 1529 dbSNP
rs1004478424 1531 dbSNP
rs1249912382 1534 dbSNP
rs1224809437 1535 dbSNP
rs1437213765 1545 dbSNP
rs1164958106 1546 dbSNP
rs1014466218 1547 dbSNP
rs1385427023 1563 dbSNP
rs532741609 1565 dbSNP
rs779269428 1569 dbSNP
rs1423567465 1570 dbSNP
rs1336026517 1571 dbSNP
rs1024183374 1574 dbSNP
rs1321228223 1576 dbSNP
rs1165878730 1579 dbSNP
rs1356047417 1582 dbSNP
rs970373459 1588 dbSNP
rs1001490290 1591 dbSNP
rs1442904388 1596 dbSNP
rs1242556066 1605 dbSNP
rs1033662070 1611 dbSNP
rs1442737659 1612 dbSNP
rs1297482610 1635 dbSNP
rs184023873 1636 dbSNP
rs1238010145 1645 dbSNP
rs559349571 1646 dbSNP
rs1317216861 1651 dbSNP
rs1195658136 1656 dbSNP
rs1357462550 1663 dbSNP
rs984135510 1665 dbSNP
rs367672499 1666 dbSNP
rs187094203 1683 dbSNP
rs1247655879 1687 dbSNP
rs1360322207 1694 dbSNP
rs1313653023 1698 dbSNP
rs1447441696 1700 dbSNP
rs1337526004 1702 dbSNP
rs908588054 1704 dbSNP
rs961522694 1708 dbSNP
rs977316910 1726 dbSNP
rs1165722215 1731 dbSNP
rs1422929121 1736 dbSNP
rs1288074312 1738 dbSNP
rs1439856040 1742 dbSNP
rs922823255 1748 dbSNP
rs1471198957 1751 dbSNP
rs549711109 1752 dbSNP
rs932875182 1760 dbSNP
rs1456847805 1768 dbSNP
rs1181696134 1769 dbSNP
rs1049941189 1770 dbSNP
rs926218984 1783 dbSNP
rs1224257386 1791 dbSNP
rs1290562212 1798 dbSNP
rs935633138 1802 dbSNP
rs1243190918 1807 dbSNP
rs1277751708 1810 dbSNP
rs192263009 1815 dbSNP
rs1331498699 1823 dbSNP
rs371194538 1828 dbSNP
rs1421208983 1839 dbSNP
rs891545379 1841 dbSNP
rs949866895 1842 dbSNP
rs1298999856 1843 dbSNP
rs1402574466 1847 dbSNP
rs775905844 1848 dbSNP
rs1410278361 1853 dbSNP
rs185257859 1859 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |||     :||||||| 
Target 5' ccAAAACC-----UACACUCCa 3'
1 - 17
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000340967.2 | 3UTR | CCAAAACCUACACUCCACUUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*