miRTarBase - #MIRT437998 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KLF6   
Synonyms BCD1, CBA1, COPEB, CPBP, GBF, PAC1, ST12, ZF9
Description Kruppel like factor 6
Transcript NM_001160125   
Other Transcripts NM_001160124 , NM_001300   
Expression
Putative miRNA Targets on KLF6
3'UTR of KLF6
(miRNA target sites are highlighted)
>KLF6|NM_001160125|3'UTR
   1 AGAGGCACCTCTGAGGGAGCAGAGAGGTGGATCCTGTAGGCTAAAAGGCTTCCAGGCTGAGAGCCGGCCGTGGAAGGAGG
  81 GATGCGTGTTCCAGCCAAAGCATGCCGTTCTGCACCCTACCCAGTTGCCTCCAGGGCCTCTCCTTGGAAGGTCTTTTGAG
 161 GGCTAAAAAGGTCCTGTAAGAAGCGGCATAGCACCCGTGGTGCATGGTATGTGGGTGACCCTGGACTCGCCACTGGTACC
 241 CGCCCTTCCGAGCGGCGCCTAAGCCTTTGCCGTGAGCATGCACACTGAGAATGCTAATGGTTGGGTTGATTGTATGTTGA
 321 GGATCTATTACTGACCGTATGATGAGGCCAACTTTTTTTCCTTGTGGTTAGCAAGACTGCAAGAGATGGAAAAAAAGTAG
 401 TTTGAATGTTTTGTGTGTAAGGAGTATACCATGAGATGAGATGACCACCAATCATTTCCTTGGGGGGAGGGGGTGTCTGC
 481 ACCTTAGAAAAAAAAAGAAAAATCAAAAAAACAAAAAAACAAAAACAAAAAAAGAAGGAAAATCTTGGAGGGTGGGCGTG
 561 GGAACTCAGGACCCCAGAGTGGCGAGTGGTGTGGGGAGGGAGAGCCTCTCTCCCCCTTTTCTGTGTGAGAGGAACTCTTA
 641 GTGTCTGGTGCAGCTATTAAATGTGCAATGTGTCAAGTAGCTTGTTTTACACGCTACAACATAGCTCATTTGTAACCCAT
 721 TGTATAAGCTGTGTATTTACAAATATAACACAACAATTTAACTTTTCCTTAGAATACAAAAAGTCATGCATGGTCTGGGG
 801 AACTATATGCTTTTCCATTTTTAAGTCAGGACTGCAATACTGATTCCAGTTAATGAGCAGCTAAGATCCAATCTGTCTAA
 881 TACAGTGACCCCCTAGCCATCCGGGCCTGGCAATATACAATTTTTTTTCCCCTCCAAGTTTGTAACACTCCCCTTCCAGA
 961 AAGGCATTGTGCAACACAGGATTATTTTTAAATGATTCTGAATTTGAATTAACTTTTTGGAGAATTCTGTGATGCCCTTA
1041 GAAGAAATTGGACACGTATTGAGTGTCACAAAGCTGGGGCTGGGAATTGCTGGTCTAATGTTTCATTAGACTTAAGAACC
1121 TAAAATTTTTCTCAGTTGGGTGGATAAAACCACTAACGCTTAGAAACTGTTTTCTCATGCAGCTATGTTTCTCTTATTTA
1201 TGCCTTGAGGACTAATTTCTGGTTTTCTAGCTGTTAATGCACTGTTGACCTTCATAATGGTGCCTTACGCAAGCGATCCC
1281 TTCTGTGGGGGTCTCATACAGGGGTGTGGGCGATGCATGCTTTATTAAGGCTCTTGTTTCACCTGGCAGTGTACTGTATC
1361 AACGTATAATACAGAAAAAAAATCTCTTTAAGGTCCTCCTTCACAAAGACATAGAGTGAAACTCCCTTTACATGTCAGTA
1441 TTTGTTCAACACTTTAGGCAACTTGACTGTCAGTGTTAAAATGGAAAACAGGAAAATGGAAAAATCTGACCAATTCTGCC
1521 ACCTTGAGACTTTCATATAGACCTTGCACAACAATTGTATAGATCACACACCGGCTGTATTTAATATGTAACATTTTCAC
1601 ACATATTAAAGATACAGAAGTATTAAAAAACCCCCAATGTTAATGTATTTGCTTAAAAGGCACAAGTTTCACATATCTGT
1681 CTAGCTATCTGTTGGTAATACAGAAAGTATACTACTTTTTTAAAAAAGTGGGCAGAATTCTTGTGTATGTATATTTGTGT
1761 GTACAGTATGTGTATGTGTGTATATATATATATTATATATATAGATAATATATAAATATTTTTTTTAAGGAGAAACTAGA
1841 ATGTTTAGCTAGAAAATTCCACAGCCTGTGAAGAAATATTTCAAAATGGCCATAAAGGAGGTAAAAATGAAAACCATAAC
1921 CTAACTTTTATAGAGGCTTTATCTTTAATTTAACGATGTGCGGAGGACTTTCTTGCTTGAATCTGTTCCGGGCTGTCTGC
2001 TCTGTCCATCAAATGGGCAGGTCTGGAATGGGGCACCTTCGGCCGTTCAGAAGTGGCCTGAACAGAATGCTGGAACCCAG
2081 GCTGGACTCGGACACACTAAGGTTTTGATTTTGAATTTCAGCCTTATTAGAAGATCTAACCTAAGAGTAAGCTAACCACA
2161 GGGATTCTTTTGTAGAACACTTTTTATGCAGATGAAGCTATTTTTTCCAGCAAGTAGATTCTTCCAGTTTTTCCAAGGAG
2241 TAATTTCCCCGAATTGGCATACCACGGCGTGGACAGCTGATATTTCACCCAGCTGCTGGCTTGTGGGTGTGGCTCTTTGC
2321 TTTATATATATATACACACATGTGAGTCTGGCTGGGCTGGTATTTTGTTTGATCTTCCTGGAAATGAGCAGTGACTAACG
2401 CTCACATAACTGGTTTTTTTTTTATCTGGGCTGATGAATACATTTACCTAAGAAACTCATTTCGTTTTACTTAAGAGGGG
2481 AAGTGCAGTTTTCTTTTGGCAGTTCAGAATCCAAGCACTTGATTTGCTGGGTTTGGAAAACTCCTTTTTTGGCCTTCTAT
2561 GTGCTTAGCCATAACAATTCCATTAAGCAAGAAGGTAAGCAAAAGACAAAAAAAAAAAAAGGAAAAAAAAAAACTTGCAC
2641 TGGCTTGTCTCACTTACGAAACATGTCGGAGCTGTTTGCCTGGGTGGGGCTGGGTACCGTACCTGTCAATGCCTGTGATT
2721 TTCATAATTAGCACGTACATAAAGAAGTACATTCTGTTCAGGTGATAACTGAGCCTCAATCAAGCAGAAACTTTTTGCTT
2801 GAAATTAAAAAAAAATTTCTATTAGTGAAATTTCTTTTTTTTTTTTTTTTGGAAGCACCCTGTTATCTAAAGAATCTTTG
2881 TAAGATTTTTGTAAAATTTTGTTTTACAAGATTTTATTTGAAATTGTTTTTTGCAAGATTGTTATATTTCTGTATGAATG
2961 TATTTTTTATTGGAATAACATAAAAGAATTCTTATCAGCATCTTGAGTCTGGTTGTTTTTTTTGGGGGAAGGGGGTTGTT
3041 GGAACAGATTCCTCCTGCATTCATCACCCTGGCTTCCTCCTGGGGGCAAATCTTCATTGAGCAACCCTGAGAACAACTCA
3121 CCGACCTCAGCCCCTTCCTCTTTCCACAGCCTGTCCTGGGAGCTGGAGAGGATGTCAGCGAGCCTGACATTGCCCTCCCT
3201 GAATGCATCAAATACTCTTCTCCAAGGACTGACAAAAACAACCCCCCGGCTGTGGGCACAGTAGGGAACCATGCCGGTTT
3281 GATCTTCCATTGCTCAAGCCAGGGAATGCATTGCAGAGGCACCTGCACAACGACAAACTTGAGTGTTTCCCTGCCACTTC
3361 TGTGCCTCCACAGCCTGCTCCAGTTCCGCAGCTAGAGCTGGGCCTACCTTCCCCAGCCAGCCCTGCCACACACCTGGCTG
3441 AGGCATGTCTGGGAGGGGTGGAGGAGGCAGAGGGACTCCAGGCCAGAGGGCTGTTCTCACAACCTCAGCCCACTCTCAGT
3521 CAAGGAGGGCAGAAAATAAAAGATGACATCACTGCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUA---CACGACGAu 5'
             ||||::|| |    ||| ||| 
Target 5' tagAAACTGTTTTCTCATGCAGCTa 3'
1161 - 1185 127.00 -8.20
2
miRNA  3' guGUUUG-GUAAUACACGACgau 5'
            |||:| | | || |||||   
Target 5' tcCAAGCACTTGATTTGCTGggt 3'
2510 - 2532 124.00 -8.82
3
miRNA  3' gugUUUGGUAAU-----A-CACGACGAu 5'
             :|||: |||     | |||| ||| 
Target 5' gagGAACTCTTAGTGTCTGGTGCAGCTa 3'
629 - 656 123.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
132783 60 ClinVar
132784 76 ClinVar
COSM4014047 5 COSMIC
COSM7798888 5 COSMIC
COSM3437680 11 COSMIC
COSM4825151 11 COSMIC
COSN31486754 22 COSMIC
COSN30110643 56 COSMIC
COSN31501512 69 COSMIC
COSN30476539 77 COSMIC
COSN18735258 85 COSMIC
COSN31959511 91 COSMIC
COSN15659976 184 COSMIC
COSN21836677 383 COSMIC
COSN28649112 418 COSMIC
COSN26643121 436 COSMIC
COSN26679351 483 COSMIC
COSN26642564 487 COSMIC
COSN25384528 512 COSMIC
COSN24297013 527 COSMIC
COSN1118746 691 COSMIC
COSN1488726 701 COSMIC
COSN20092052 729 COSMIC
COSN22328369 920 COSMIC
COSN1488722 1105 COSMIC
COSN17181989 1364 COSMIC
COSN22433330 1364 COSMIC
COSN27491716 1631 COSMIC
COSN8184988 1780 COSMIC
COSN21681098 1917 COSMIC
COSN22227895 1988 COSMIC
COSN15659975 2031 COSMIC
COSN29443560 2033 COSMIC
COSN6070998 2196 COSMIC
COSN28201888 2517 COSMIC
COSN20092051 2607 COSMIC
COSN28907700 2622 COSMIC
COSN32058775 2734 COSMIC
COSN20106819 2807 COSMIC
COSN27476140 2834 COSMIC
COSN20106817 2835 COSMIC
COSN17075738 3183 COSMIC
COSN20106815 3294 COSMIC
COSN5285697 3428 COSMIC
rs17731 184 GWAS
rs1043003 958 GWAS
rs1043009 2031 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs561085898 8 dbSNP
rs758207310 13 dbSNP
rs201626396 17 dbSNP
rs1487523829 18 dbSNP
rs779031125 19 dbSNP
rs1173857310 20 dbSNP
rs185306584 26 dbSNP
rs753910274 27 dbSNP
rs374854304 31 dbSNP
rs766551899 36 dbSNP
rs761329730 37 dbSNP
rs750969473 43 dbSNP
rs199933548 48 dbSNP
rs1183908286 50 dbSNP
rs1420322290 51 dbSNP
rs1206344155 58 dbSNP
rs1158298791 59 dbSNP
rs483352821 60 dbSNP
rs76765158 61 dbSNP
rs1261452569 62 dbSNP
rs769383213 64 dbSNP
rs759215491 65 dbSNP
rs776194116 66 dbSNP
rs770435208 69 dbSNP
rs746469621 70 dbSNP
rs1316361686 72 dbSNP
rs112418040 76 dbSNP
rs772002140 77 dbSNP
rs747930302 85 dbSNP
rs1436884354 86 dbSNP
rs1385048533 88 dbSNP
rs1195795453 93 dbSNP
rs778745452 95 dbSNP
rs755210104 96 dbSNP
rs754105892 102 dbSNP
rs769193355 106 dbSNP
rs1012906403 107 dbSNP
rs752164105 107 dbSNP
rs56987769 110 dbSNP
rs756276744 110 dbSNP
rs895439398 112 dbSNP
rs750491379 115 dbSNP
rs1447864612 117 dbSNP
rs114266304 118 dbSNP
rs762360575 121 dbSNP
rs751929273 122 dbSNP
rs763163416 123 dbSNP
rs1245951712 124 dbSNP
rs1357704658 130 dbSNP
rs776282311 132 dbSNP
rs1229143526 137 dbSNP
rs770527003 143 dbSNP
rs1317201360 144 dbSNP
rs925627858 151 dbSNP
rs1379986969 162 dbSNP
rs760205895 164 dbSNP
rs772674512 165 dbSNP
rs771950159 169 dbSNP
rs1383147577 170 dbSNP
rs764205702 170 dbSNP
rs748100617 174 dbSNP
rs17731 184 dbSNP
rs945962984 185 dbSNP
rs1372682610 186 dbSNP
rs1191337238 187 dbSNP
rs796325152 188 dbSNP
rs1384364605 191 dbSNP
rs768501536 191 dbSNP
rs749032189 192 dbSNP
rs780444950 193 dbSNP
rs912543964 196 dbSNP
rs147792850 197 dbSNP
rs1196678014 200 dbSNP
rs374579672 202 dbSNP
rs954185770 203 dbSNP
rs552157112 204 dbSNP
rs1346808443 205 dbSNP
rs1468388099 206 dbSNP
rs921836337 208 dbSNP
rs1404240559 209 dbSNP
rs1471358827 211 dbSNP
rs1231583839 213 dbSNP
rs781320145 214 dbSNP
rs11544693 217 dbSNP
rs1443498941 228 dbSNP
rs959863895 229 dbSNP
rs1330852460 230 dbSNP
rs796072578 236 dbSNP
rs1410278491 238 dbSNP
rs1050046 239 dbSNP
rs569733614 241 dbSNP
rs1479167631 242 dbSNP
rs1465102953 247 dbSNP
rs374752713 248 dbSNP
rs547930611 249 dbSNP
rs1479499368 250 dbSNP
rs758787754 253 dbSNP
rs753024057 254 dbSNP
rs143099103 256 dbSNP
rs745398837 257 dbSNP
rs1193710429 258 dbSNP
rs1272345548 259 dbSNP
rs1014732913 261 dbSNP
rs1004575966 268 dbSNP
rs770375415 271 dbSNP
rs1016927624 272 dbSNP
rs772764283 279 dbSNP
rs970537756 282 dbSNP
rs1201065329 283 dbSNP
rs1343124137 284 dbSNP
rs1281193094 289 dbSNP
rs558985686 294 dbSNP
rs1005847425 304 dbSNP
rs1334944135 308 dbSNP
rs778348454 309 dbSNP
rs1424082373 316 dbSNP
rs767047652 317 dbSNP
rs1407020006 318 dbSNP
rs1477342179 319 dbSNP
rs1168476336 321 dbSNP
rs1450501182 325 dbSNP
rs1176015624 327 dbSNP
rs1468252461 332 dbSNP
rs1410320112 335 dbSNP
rs113717453 336 dbSNP
rs540630607 337 dbSNP
rs531985967 339 dbSNP
rs1189979230 342 dbSNP
rs774358231 343 dbSNP
rs768428632 345 dbSNP
rs1402676656 351 dbSNP
rs112295984 360 dbSNP
rs567683914 360 dbSNP
rs1158379964 362 dbSNP
rs1383628797 364 dbSNP
rs564818506 365 dbSNP
rs1285829091 367 dbSNP
rs770474869 370 dbSNP
rs1039887337 374 dbSNP
rs775403785 375 dbSNP
rs1218347635 376 dbSNP
rs1349798175 380 dbSNP
rs1277710846 382 dbSNP
rs1473382661 383 dbSNP
rs1276887713 384 dbSNP
rs1245483746 385 dbSNP
rs1182363657 387 dbSNP
rs1454339166 388 dbSNP
rs1383282056 389 dbSNP
rs1314503637 392 dbSNP
rs149030889 394 dbSNP
rs1255556895 397 dbSNP
rs1336291368 397 dbSNP
rs749227785 404 dbSNP
rs777633907 405 dbSNP
rs746546340 413 dbSNP
rs1264115679 415 dbSNP
rs7634 418 dbSNP
rs1400205217 421 dbSNP
rs1406336167 422 dbSNP
rs1166044512 423 dbSNP
rs1001136930 424 dbSNP
rs781207972 425 dbSNP
rs1361380686 426 dbSNP
rs1373863288 427 dbSNP
rs757374703 431 dbSNP
rs945678960 435 dbSNP
rs1375431407 440 dbSNP
rs557269773 444 dbSNP
rs1182592051 445 dbSNP
rs1158895428 446 dbSNP
rs913151733 447 dbSNP
rs1243505816 450 dbSNP
rs1215803794 451 dbSNP
rs912606693 453 dbSNP
rs1321300687 460 dbSNP
rs1282000406 462 dbSNP
rs758604944 463 dbSNP
rs778379798 464 dbSNP
rs1353323537 466 dbSNP
rs973275497 467 dbSNP
rs1314196952 468 dbSNP
rs1293755298 469 dbSNP
rs963292901 470 dbSNP
rs1244037327 472 dbSNP
rs1364276277 476 dbSNP
rs1289669228 480 dbSNP
rs907706739 482 dbSNP
rs758867341 488 dbSNP
rs1343562138 492 dbSNP
rs1178755811 493 dbSNP
rs375375286 497 dbSNP
rs775770396 497 dbSNP
rs1417539628 503 dbSNP
rs1165016875 504 dbSNP
rs1305458528 505 dbSNP
rs1425924697 511 dbSNP
rs1352001947 512 dbSNP
rs878977269 512 dbSNP
rs1024693897 514 dbSNP
rs1293495560 516 dbSNP
rs1139591 519 dbSNP
rs1130878 520 dbSNP
rs1366165543 520 dbSNP
rs1449625734 520 dbSNP
rs1484636180 520 dbSNP
rs1161999734 524 dbSNP
rs1241128695 525 dbSNP
rs1050053 526 dbSNP
rs769923627 526 dbSNP
rs1430672033 527 dbSNP
rs1032036804 530 dbSNP
rs1186762353 532 dbSNP
rs1199176365 534 dbSNP
rs760396251 534 dbSNP
rs927136939 535 dbSNP
rs1474780143 536 dbSNP
rs981288837 542 dbSNP
rs1001107150 544 dbSNP
rs750651984 552 dbSNP
rs969497869 557 dbSNP
rs1219891594 558 dbSNP
rs1021217794 560 dbSNP
rs753105809 569 dbSNP
rs1008359682 574 dbSNP
rs765272922 583 dbSNP
rs761929862 584 dbSNP
rs1444593969 589 dbSNP
rs1214249122 590 dbSNP
rs984130425 591 dbSNP
rs1285339458 593 dbSNP
rs932751174 593 dbSNP
rs1310382953 594 dbSNP
rs754418646 598 dbSNP
rs1360001468 603 dbSNP
rs1405647669 604 dbSNP
rs1365433581 606 dbSNP
rs1301874282 608 dbSNP
rs1269816206 610 dbSNP
rs1463809124 613 dbSNP
rs773022874 614 dbSNP
rs1170665518 615 dbSNP
rs1409073971 616 dbSNP
rs574995312 623 dbSNP
rs764657051 626 dbSNP
rs1478972556 628 dbSNP
rs761127389 631 dbSNP
rs1454488721 637 dbSNP
rs1268044667 638 dbSNP
rs1423482091 641 dbSNP
rs1464488842 642 dbSNP
rs1189455161 649 dbSNP
rs1481475532 653 dbSNP
rs998434789 657 dbSNP
rs1301719862 658 dbSNP
rs775941425 663 dbSNP
rs1316237330 664 dbSNP
rs755828522 666 dbSNP
rs577887487 668 dbSNP
rs1344995480 669 dbSNP
rs1281903218 671 dbSNP
rs907759066 671 dbSNP
rs554565800 674 dbSNP
rs1374500413 681 dbSNP
rs1298018707 683 dbSNP
rs1316042332 685 dbSNP
rs1220864148 687 dbSNP
rs1440484439 690 dbSNP
rs767017825 691 dbSNP
rs541258936 692 dbSNP
rs773694827 693 dbSNP
rs764142249 697 dbSNP
rs949220552 699 dbSNP
rs904287436 700 dbSNP
rs558844110 701 dbSNP
rs1176348615 707 dbSNP
rs1021287845 708 dbSNP
rs762972361 712 dbSNP
rs1009879050 714 dbSNP
rs1262894375 719 dbSNP
rs1191355186 724 dbSNP
rs1474746340 727 dbSNP
rs990568720 742 dbSNP
rs1245149124 745 dbSNP
rs775493829 746 dbSNP
rs1413933164 753 dbSNP
rs1322870778 754 dbSNP
rs1174262351 755 dbSNP
rs891435532 758 dbSNP
rs1266452485 760 dbSNP
rs1221491757 765 dbSNP
rs1338145235 774 dbSNP
rs1438532194 776 dbSNP
rs1275314744 778 dbSNP
rs1366313995 782 dbSNP
rs979051428 783 dbSNP
rs1287496198 786 dbSNP
rs536922929 787 dbSNP
rs1156618270 790 dbSNP
rs1483286858 796 dbSNP
rs1317985610 799 dbSNP
rs1306921135 800 dbSNP
rs1252967082 802 dbSNP
rs1389989874 803 dbSNP
rs754473233 803 dbSNP
rs1202426933 809 dbSNP
rs1385464396 832 dbSNP
rs1285839852 836 dbSNP
rs774027696 837 dbSNP
rs1338260021 840 dbSNP
rs938595373 843 dbSNP
rs1453005475 850 dbSNP
rs1404706357 855 dbSNP
rs1300508320 859 dbSNP
rs144920046 861 dbSNP
rs1364274198 863 dbSNP
rs1021188190 874 dbSNP
rs769718257 875 dbSNP
rs1437571008 880 dbSNP
rs1386900532 883 dbSNP
rs1477971595 885 dbSNP
rs1184432470 887 dbSNP
rs1461080664 888 dbSNP
rs1254348738 889 dbSNP
rs1206904490 891 dbSNP
rs1158208545 894 dbSNP
rs1486252890 894 dbSNP
rs377080627 900 dbSNP
rs1260597145 901 dbSNP
rs1238670970 902 dbSNP
rs1008913326 903 dbSNP
rs1349262650 912 dbSNP
rs1362036642 916 dbSNP
rs1316245148 917 dbSNP
rs1245717518 919 dbSNP
rs1339445151 920 dbSNP
rs1310184208 921 dbSNP
rs1044229178 922 dbSNP
rs1310889263 928 dbSNP
rs891275616 929 dbSNP
rs1238980189 933 dbSNP
rs1383369107 935 dbSNP
rs1306555663 938 dbSNP
rs1385113929 939 dbSNP
rs1438758416 939 dbSNP
rs1349160081 940 dbSNP
rs941825183 941 dbSNP
rs1288188260 944 dbSNP
rs1451596788 944 dbSNP
rs1417855258 947 dbSNP
rs1240111133 948 dbSNP
rs1028938041 949 dbSNP
rs909971318 952 dbSNP
rs1300400946 953 dbSNP
rs898624827 956 dbSNP
rs759349974 957 dbSNP
rs1043003 958 dbSNP
rs1366896462 961 dbSNP
rs771022453 962 dbSNP
rs929988523 967 dbSNP
rs1261212340 969 dbSNP
rs918572275 974 dbSNP
rs747156870 977 dbSNP
rs1490967443 979 dbSNP
rs967447930 986 dbSNP
rs977446239 997 dbSNP
rs777689177 1002 dbSNP
rs1445336319 1008 dbSNP
rs1328652788 1014 dbSNP
rs1222167673 1022 dbSNP
rs887123553 1026 dbSNP
rs1198285225 1029 dbSNP
rs1047618021 1030 dbSNP
rs1356013614 1032 dbSNP
rs949353222 1033 dbSNP
rs917747996 1034 dbSNP
rs1229209639 1036 dbSNP
rs1326500458 1038 dbSNP
rs1277081430 1041 dbSNP
rs965648003 1046 dbSNP
rs1198130287 1048 dbSNP
rs150049929 1055 dbSNP
rs772621432 1056 dbSNP
rs565461522 1059 dbSNP
rs937827921 1063 dbSNP
rs1367681757 1068 dbSNP
rs374965089 1070 dbSNP
rs1474069458 1071 dbSNP
rs1303720843 1073 dbSNP
rs1424297881 1074 dbSNP
rs748646759 1075 dbSNP
rs1388367462 1077 dbSNP
rs1169839393 1079 dbSNP
rs1252424569 1082 dbSNP
rs544426205 1085 dbSNP
rs779323593 1086 dbSNP
rs1191514192 1089 dbSNP
rs1481478264 1092 dbSNP
rs1403716227 1095 dbSNP
rs1396259059 1097 dbSNP
rs755348350 1098 dbSNP
rs1199396182 1104 dbSNP
rs139763780 1105 dbSNP
rs1250787037 1109 dbSNP
rs979187419 1111 dbSNP
rs1021345130 1112 dbSNP
rs1204362754 1118 dbSNP
rs754101160 1119 dbSNP
rs1197164352 1128 dbSNP
rs1339590107 1135 dbSNP
rs748752982 1140 dbSNP
rs1319269707 1142 dbSNP
rs1257031668 1143 dbSNP
rs771947874 1148 dbSNP
rs780928278 1151 dbSNP
rs188749834 1157 dbSNP
rs891487982 1158 dbSNP
rs1317835495 1160 dbSNP
rs748054172 1165 dbSNP
rs987057140 1169 dbSNP
rs1201260531 1171 dbSNP
rs754738657 1172 dbSNP
rs778755184 1174 dbSNP
rs1255670719 1175 dbSNP
rs573777981 1176 dbSNP
rs1399785115 1177 dbSNP
rs1035361531 1182 dbSNP
rs1003237825 1185 dbSNP
rs955848487 1186 dbSNP
rs1190853749 1187 dbSNP
rs1176334876 1195 dbSNP
rs1477357973 1197 dbSNP
rs116234421 1201 dbSNP
rs1171671292 1226 dbSNP
rs1044666278 1227 dbSNP
rs1373277169 1236 dbSNP
rs1454087190 1249 dbSNP
rs1403345336 1255 dbSNP
rs1300491888 1259 dbSNP
rs773135301 1268 dbSNP
rs1237136732 1269 dbSNP
rs1196425153 1274 dbSNP
rs1382160768 1275 dbSNP
rs756837619 1283 dbSNP
rs1263294088 1285 dbSNP
rs1218145090 1289 dbSNP
rs1342706886 1290 dbSNP
rs1281246169 1291 dbSNP
rs1239441063 1304 dbSNP
rs1375945785 1311 dbSNP
rs887597357 1312 dbSNP
rs1156699411 1317 dbSNP
rs1454847774 1319 dbSNP
rs191551741 1324 dbSNP
rs1333519636 1329 dbSNP
rs1346064753 1330 dbSNP
rs1412834773 1336 dbSNP
rs962842207 1337 dbSNP
rs1410746341 1350 dbSNP
rs1159672550 1358 dbSNP
rs763693794 1360 dbSNP
rs930042152 1363 dbSNP
rs918624482 1364 dbSNP
rs1269330252 1367 dbSNP
rs1433674159 1380 dbSNP
rs1176390349 1381 dbSNP
rs1004233866 1383 dbSNP
rs554226109 1384 dbSNP
rs1208770571 1386 dbSNP
rs943995667 1389 dbSNP
rs1440220490 1390 dbSNP
rs1286237476 1391 dbSNP
rs1205689846 1394 dbSNP
rs1352716354 1395 dbSNP
rs1306885596 1396 dbSNP
rs1203195367 1403 dbSNP
rs1431020588 1404 dbSNP
rs752697477 1407 dbSNP
rs1383711579 1408 dbSNP
rs1046114693 1411 dbSNP
rs1453434526 1412 dbSNP
rs1287660672 1414 dbSNP
rs911494415 1414 dbSNP
rs1445846134 1417 dbSNP
rs1347086914 1426 dbSNP
rs986089018 1430 dbSNP
rs146838448 1431 dbSNP
rs761220891 1432 dbSNP
rs1302858827 1434 dbSNP
rs759409990 1436 dbSNP
rs1165789380 1439 dbSNP
rs1021731957 1447 dbSNP
rs1242605410 1449 dbSNP
rs1055045812 1451 dbSNP
rs542444294 1452 dbSNP
rs771229410 1455 dbSNP
rs1471507487 1461 dbSNP
rs1213436704 1465 dbSNP
rs1266969692 1469 dbSNP
rs1243414066 1470 dbSNP
rs1193800037 1472 dbSNP
rs879391393 1473 dbSNP
rs1209157472 1474 dbSNP
rs1487890617 1476 dbSNP
rs1283798283 1479 dbSNP
rs1224383425 1483 dbSNP
rs201553148 1504 dbSNP
rs925091660 1506 dbSNP
rs575056741 1507 dbSNP
rs73578377 1511 dbSNP
rs1364166743 1518 dbSNP
rs1157452007 1519 dbSNP
rs1270905166 1522 dbSNP
rs1399484825 1523 dbSNP
rs1339038869 1527 dbSNP
rs1305514379 1529 dbSNP
rs779989869 1532 dbSNP
rs1349707507 1534 dbSNP
rs1163632860 1537 dbSNP
rs1403309488 1542 dbSNP
rs1421227725 1544 dbSNP
rs748062189 1546 dbSNP
rs1193667251 1554 dbSNP
rs1477225149 1555 dbSNP
rs1260871033 1556 dbSNP
rs1449041798 1559 dbSNP
rs1201561404 1560 dbSNP
rs913576842 1563 dbSNP
rs1035814974 1571 dbSNP
rs773405203 1572 dbSNP
rs772141775 1573 dbSNP
rs1232613166 1575 dbSNP
rs1219629355 1581 dbSNP
rs970104973 1588 dbSNP
rs921545884 1592 dbSNP
rs1382390544 1593 dbSNP
rs1458737333 1598 dbSNP
rs1198768749 1600 dbSNP
rs1386655750 1606 dbSNP
rs1274016598 1615 dbSNP
rs1183175137 1617 dbSNP
rs541148255 1620 dbSNP
rs112407993 1631 dbSNP
rs375644559 1631 dbSNP
rs1017033569 1632 dbSNP
rs200387079 1632 dbSNP
rs1316198665 1636 dbSNP
rs201375337 1636 dbSNP
rs779417175 1637 dbSNP
rs1406168206 1645 dbSNP
rs1367333099 1647 dbSNP
rs1292095783 1651 dbSNP
rs1171551809 1659 dbSNP
rs1444825048 1662 dbSNP
rs1355876324 1664 dbSNP
rs1170971188 1665 dbSNP
rs1379650817 1666 dbSNP
rs769110381 1666 dbSNP
rs1442703916 1669 dbSNP
rs887648277 1673 dbSNP
rs749703226 1674 dbSNP
rs1047586692 1677 dbSNP
rs34127934 1677 dbSNP
rs564883875 1677 dbSNP
rs1383413912 1680 dbSNP
rs1433757618 1683 dbSNP
rs951509842 1685 dbSNP
rs1024309547 1686 dbSNP
rs1485124145 1687 dbSNP
rs1014707725 1695 dbSNP
rs1255837177 1703 dbSNP
rs894466154 1709 dbSNP
rs1424390192 1711 dbSNP
rs1055476999 1714 dbSNP
rs1264085359 1715 dbSNP
rs1481505810 1717 dbSNP
rs1178543069 1721 dbSNP
rs558672893 1722 dbSNP
rs1198299180 1725 dbSNP
rs537415431 1730 dbSNP
rs1456499632 1731 dbSNP
rs1434317209 1732 dbSNP
rs1485737661 1738 dbSNP
rs1310906236 1744 dbSNP
rs1292969221 1745 dbSNP
rs757002112 1747 dbSNP
rs751178050 1749 dbSNP
rs897238575 1751 dbSNP
rs781030734 1758 dbSNP
rs944063644 1760 dbSNP
rs945111376 1762 dbSNP
rs892249945 1763 dbSNP
rs1374567165 1764 dbSNP
rs1331566816 1765 dbSNP
rs1327755044 1769 dbSNP
rs1292984854 1770 dbSNP
rs911203298 1775 dbSNP
rs1050857031 1776 dbSNP
rs750773300 1778 dbSNP
rs1338059740 1779 dbSNP
rs1208277586 1780 dbSNP
rs1466107660 1780 dbSNP
rs1217158333 1782 dbSNP
rs777512478 1782 dbSNP
rs1376950803 1785 dbSNP
rs947639473 1787 dbSNP
rs1173926104 1790 dbSNP
rs1395752277 1792 dbSNP
rs1453998869 1793 dbSNP
rs1171947509 1794 dbSNP
rs1420043875 1794 dbSNP
rs200778872 1794 dbSNP
rs757739849 1794 dbSNP
rs914778648 1795 dbSNP
rs975654257 1797 dbSNP
rs1380757126 1800 dbSNP
rs1178246308 1802 dbSNP
rs1231636465 1804 dbSNP
rs1356327803 1804 dbSNP
rs576264654 1804 dbSNP
rs752110682 1804 dbSNP
rs941585615 1804 dbSNP
rs758007601 1808 dbSNP
rs1224725805 1814 dbSNP
rs1283976468 1815 dbSNP
rs61829726 1816 dbSNP
rs956170029 1818 dbSNP
rs1253720920 1819 dbSNP
rs764568209 1819 dbSNP
rs928422980 1820 dbSNP
rs752724587 1827 dbSNP
rs763033269 1827 dbSNP
rs981570495 1828 dbSNP
rs1254743872 1832 dbSNP
rs1218602460 1833 dbSNP
rs1354857985 1835 dbSNP
rs1405521484 1843 dbSNP
rs1407023813 1844 dbSNP
rs765309035 1848 dbSNP
rs759373766 1849 dbSNP
rs369459041 1862 dbSNP
rs1364859182 1865 dbSNP
rs150960581 1879 dbSNP
rs1396086445 1885 dbSNP
rs1400921418 1890 dbSNP
rs1438026231 1895 dbSNP
rs1023050565 1896 dbSNP
rs1301010903 1897 dbSNP
rs1332753044 1900 dbSNP
rs760449615 1907 dbSNP
rs951949921 1920 dbSNP
rs1157760755 1921 dbSNP
rs1417670897 1925 dbSNP
rs1387256635 1926 dbSNP
rs1026195246 1927 dbSNP
rs1188565623 1930 dbSNP
rs1475779971 1936 dbSNP
rs1279407071 1938 dbSNP
rs1423283354 1939 dbSNP
rs1254245530 1941 dbSNP
rs1188786142 1942 dbSNP
rs754770549 1945 dbSNP
rs77837428 1947 dbSNP
rs1477637332 1954 dbSNP
rs565523188 1954 dbSNP
rs1240090116 1955 dbSNP
rs767680205 1957 dbSNP
rs1202013743 1958 dbSNP
rs1008713785 1961 dbSNP
rs889834081 1962 dbSNP
rs1002130914 1965 dbSNP
rs1196946735 1971 dbSNP
rs1459787818 1975 dbSNP
rs1266813340 1976 dbSNP
rs767544849 1981 dbSNP
rs1396586322 1982 dbSNP
rs1245153197 1983 dbSNP
rs572718649 1985 dbSNP
rs1309891379 1989 dbSNP
rs1326390515 1990 dbSNP
rs1372810011 1990 dbSNP
rs1401315009 1997 dbSNP
rs774384200 1999 dbSNP
rs1297535019 2004 dbSNP
rs1226186065 2007 dbSNP
rs1231995928 2010 dbSNP
rs565814544 2012 dbSNP
rs1284854948 2013 dbSNP
rs34504754 2014 dbSNP
rs1367252319 2018 dbSNP
rs1164042220 2026 dbSNP
rs1457644111 2027 dbSNP
rs1043009 2031 dbSNP
rs749754061 2034 dbSNP
rs1444309997 2036 dbSNP
rs934858904 2040 dbSNP
rs928776951 2041 dbSNP
rs981253560 2043 dbSNP
rs1490942176 2044 dbSNP
rs779147376 2045 dbSNP
rs1461009474 2048 dbSNP
rs1051313088 2053 dbSNP
rs770065869 2061 dbSNP
rs915628547 2063 dbSNP
rs1355132244 2064 dbSNP
rs1434937820 2070 dbSNP
rs984457562 2073 dbSNP
rs757312878 2076 dbSNP
rs753904406 2077 dbSNP
rs538353647 2089 dbSNP
rs1277447055 2090 dbSNP
rs1026245811 2092 dbSNP
rs1347471296 2093 dbSNP
rs1211861428 2094 dbSNP
rs1332590608 2096 dbSNP
rs1323900005 2097 dbSNP
rs1386011901 2104 dbSNP
rs1279347463 2115 dbSNP
rs1388794660 2127 dbSNP
rs941616603 2130 dbSNP
rs1300136488 2133 dbSNP
rs1466179870 2134 dbSNP
rs1423091319 2136 dbSNP
rs1169150294 2140 dbSNP
rs971959199 2142 dbSNP
rs1218745768 2145 dbSNP
rs1178940718 2146 dbSNP
rs965931625 2151 dbSNP
rs1481673368 2155 dbSNP
rs1427829680 2157 dbSNP
rs1378727471 2158 dbSNP
rs758089521 2166 dbSNP
rs571260691 2170 dbSNP
rs1450267182 2176 dbSNP
rs1190473517 2180 dbSNP
rs747705208 2182 dbSNP
rs778557971 2194 dbSNP
rs982984683 2201 dbSNP
rs1457816263 2207 dbSNP
rs1256929678 2209 dbSNP
rs1019193783 2214 dbSNP
rs1008346673 2225 dbSNP
rs755012965 2228 dbSNP
rs753727429 2231 dbSNP
rs1172570766 2236 dbSNP
rs538916622 2238 dbSNP
rs1183085456 2239 dbSNP
rs571919202 2250 dbSNP
rs1028325212 2251 dbSNP
rs1329183897 2251 dbSNP
rs1333612654 2257 dbSNP
rs1011552310 2258 dbSNP
rs750180307 2265 dbSNP
rs764319886 2266 dbSNP
rs767768225 2268 dbSNP
rs549518757 2269 dbSNP
rs1345955464 2274 dbSNP
rs531290584 2275 dbSNP
rs187848594 2284 dbSNP
rs1221368301 2287 dbSNP
rs1242118206 2288 dbSNP
rs1477224030 2289 dbSNP
rs1365977621 2290 dbSNP
rs143775944 2293 dbSNP
rs530349823 2300 dbSNP
rs1237188121 2307 dbSNP
rs968698615 2312 dbSNP
rs1192647514 2314 dbSNP
rs200755942 2319 dbSNP
rs1196163444 2322 dbSNP
rs1392918538 2324 dbSNP
rs948875442 2326 dbSNP
rs559962909 2328 dbSNP
rs763029565 2330 dbSNP
rs775881546 2333 dbSNP
rs1342596115 2334 dbSNP
rs759776621 2335 dbSNP
rs765459257 2335 dbSNP
rs775953518 2335 dbSNP
rs770293118 2337 dbSNP
rs1453677869 2340 dbSNP
rs541557967 2341 dbSNP
rs1325278299 2342 dbSNP
rs1240610446 2347 dbSNP
rs185734991 2349 dbSNP
rs1307380007 2352 dbSNP
rs1450266294 2357 dbSNP
rs1341183131 2359 dbSNP
rs899551662 2360 dbSNP
rs776886246 2361 dbSNP
rs565335912 2367 dbSNP
rs1274933345 2371 dbSNP
rs930322135 2372 dbSNP
rs918909538 2373 dbSNP
rs746272411 2375 dbSNP
rs1159560059 2376 dbSNP
rs115621215 2380 dbSNP
rs771904365 2386 dbSNP
rs1159530698 2392 dbSNP
rs1471387524 2396 dbSNP
rs767815084 2399 dbSNP
rs747802943 2400 dbSNP
rs575996183 2406 dbSNP
rs1186241378 2408 dbSNP
rs1178632416 2409 dbSNP
rs1461368403 2410 dbSNP
rs1018830527 2412 dbSNP
rs1462415376 2412 dbSNP
rs532199004 2413 dbSNP
rs1463736184 2414 dbSNP
rs1201311404 2418 dbSNP
rs1288112940 2419 dbSNP
rs754462960 2423 dbSNP
rs1232595613 2424 dbSNP
rs35557366 2424 dbSNP
rs397743470 2424 dbSNP
rs538095251 2424 dbSNP
rs774329702 2424 dbSNP
rs768488009 2425 dbSNP
rs1284106021 2426 dbSNP
rs1225228191 2428 dbSNP
rs770248634 2428 dbSNP
rs1379973253 2430 dbSNP
rs1204804254 2431 dbSNP
rs759926664 2436 dbSNP
rs779889303 2439 dbSNP
rs536121545 2447 dbSNP
rs761621066 2447 dbSNP
rs1299368164 2458 dbSNP
rs756048251 2463 dbSNP
rs927395842 2465 dbSNP
rs1156478330 2470 dbSNP
rs1260048130 2474 dbSNP
rs1406682609 2474 dbSNP
rs1414071520 2476 dbSNP
rs978828601 2478 dbSNP
rs567398721 2479 dbSNP
rs1473950945 2485 dbSNP
rs1265214107 2490 dbSNP
rs1194347729 2495 dbSNP
rs1338819370 2496 dbSNP
rs1415802535 2498 dbSNP
rs1450655854 2498 dbSNP
rs1358775654 2516 dbSNP
rs1430346634 2517 dbSNP
rs75254297 2522 dbSNP
rs1375834720 2523 dbSNP
rs988475124 2526 dbSNP
rs1223517131 2533 dbSNP
rs1314561613 2535 dbSNP
rs7005 2536 dbSNP
rs111991786 2542 dbSNP
rs1291307901 2544 dbSNP
rs998832246 2550 dbSNP
rs998066683 2551 dbSNP
rs756979026 2554 dbSNP
rs1386517211 2555 dbSNP
rs1181192248 2557 dbSNP
rs79041010 2559 dbSNP
rs1242334432 2561 dbSNP
rs1217573602 2563 dbSNP
rs1339111574 2565 dbSNP
rs1282925284 2569 dbSNP
rs61829725 2577 dbSNP
rs1285055242 2584 dbSNP
rs1236271042 2587 dbSNP
rs1437666134 2588 dbSNP
rs1350057269 2589 dbSNP
rs1322530718 2591 dbSNP
rs1459382757 2594 dbSNP
rs1425226400 2595 dbSNP
rs1171289100 2596 dbSNP
rs1477423766 2597 dbSNP
rs762971250 2599 dbSNP
rs752788311 2600 dbSNP
rs748762605 2601 dbSNP
rs760102907 2605 dbSNP
rs1043087 2606 dbSNP
rs1488698809 2606 dbSNP
rs777207846 2607 dbSNP
rs779457556 2608 dbSNP
rs79141908 2608 dbSNP
rs1212100991 2609 dbSNP
rs948911547 2609 dbSNP
rs549819942 2610 dbSNP
rs888127359 2611 dbSNP
rs71744758 2616 dbSNP
rs1404229333 2618 dbSNP
rs1431383347 2620 dbSNP
rs1046695620 2621 dbSNP
rs751886217 2621 dbSNP
rs765983947 2621 dbSNP
rs778277607 2621 dbSNP
rs199534432 2622 dbSNP
rs1346661929 2623 dbSNP
rs1491105434 2623 dbSNP
rs771430310 2623 dbSNP
rs1491259559 2624 dbSNP
rs1474241901 2631 dbSNP
rs1217052701 2634 dbSNP
rs1241612423 2634 dbSNP
rs752773994 2634 dbSNP
rs755089147 2634 dbSNP
rs765278743 2634 dbSNP
rs1253911369 2635 dbSNP
rs1316549674 2636 dbSNP
rs761066184 2638 dbSNP
rs754053308 2639 dbSNP
rs994830839 2639 dbSNP
rs1367391412 2644 dbSNP
rs1273872872 2645 dbSNP
rs78897618 2647 dbSNP
rs1409803532 2650 dbSNP
rs1199849302 2652 dbSNP
rs894632215 2657 dbSNP
rs1057502781 2658 dbSNP
rs1442511640 2658 dbSNP
rs1402043778 2662 dbSNP
rs1331355461 2664 dbSNP
rs937522199 2665 dbSNP
rs927426785 2667 dbSNP
rs768309634 2668 dbSNP
rs886173884 2670 dbSNP
rs537456844 2672 dbSNP
rs1216506458 2674 dbSNP
rs567253177 2677 dbSNP
rs972149990 2683 dbSNP
rs944350799 2689 dbSNP
rs1338739569 2693 dbSNP
rs1327662197 2694 dbSNP
rs114433167 2698 dbSNP
rs1441705289 2699 dbSNP
rs1239050365 2702 dbSNP
rs1198033375 2704 dbSNP
rs1405931416 2706 dbSNP
rs530412295 2709 dbSNP
rs986037733 2713 dbSNP
rs1258249456 2724 dbSNP
rs1301775094 2727 dbSNP
rs572130106 2734 dbSNP
rs915058627 2735 dbSNP
rs1276881634 2739 dbSNP
rs1242777255 2750 dbSNP
rs1378609469 2756 dbSNP
rs977058656 2756 dbSNP
rs1443438821 2759 dbSNP
rs560049025 2760 dbSNP
rs1445376859 2763 dbSNP
rs990227533 2765 dbSNP
rs1349245377 2769 dbSNP
rs1354576107 2775 dbSNP
rs1304510112 2779 dbSNP
rs547678626 2787 dbSNP
rs957459013 2790 dbSNP
rs1334184813 2793 dbSNP
rs1031676817 2807 dbSNP
rs1358511448 2815 dbSNP
rs71764563 2816 dbSNP
rs766644142 2816 dbSNP
rs1171479576 2819 dbSNP
rs1421309976 2821 dbSNP
rs1381124638 2824 dbSNP
rs1178300160 2825 dbSNP
rs1417395068 2827 dbSNP
rs1258418743 2828 dbSNP
rs1476151156 2832 dbSNP
rs1182530716 2833 dbSNP
rs201861556 2834 dbSNP
rs774017803 2835 dbSNP
rs1219188769 2836 dbSNP
rs1407766256 2837 dbSNP
rs1354936256 2838 dbSNP
rs1396829426 2839 dbSNP
rs1018036969 2845 dbSNP
rs1237965997 2847 dbSNP
rs80122565 2849 dbSNP
rs1422429097 2850 dbSNP
rs1253555637 2851 dbSNP
rs1340397487 2851 dbSNP
rs1417183812 2851 dbSNP
rs35554797 2851 dbSNP
rs397746022 2851 dbSNP
rs762781926 2851 dbSNP
rs769426691 2851 dbSNP
rs775541602 2851 dbSNP
rs776366127 2851 dbSNP
rs1314600646 2852 dbSNP
rs1195381339 2853 dbSNP
rs1176790660 2859 dbSNP
rs1486503247 2864 dbSNP
rs932997779 2865 dbSNP
rs562840329 2866 dbSNP
rs1314173460 2867 dbSNP
rs1211551955 2875 dbSNP
rs1396136595 2875 dbSNP
rs1378286998 2878 dbSNP
rs1190483121 2879 dbSNP
rs1311042673 2886 dbSNP
rs1440608036 2891 dbSNP
rs1401582552 2898 dbSNP
rs999279810 2899 dbSNP
rs1194772361 2901 dbSNP
rs1005268409 2905 dbSNP
rs952427352 2906 dbSNP
rs1361001620 2909 dbSNP
rs971392241 2923 dbSNP
rs1233477618 2924 dbSNP
rs1437010856 2926 dbSNP
rs1313843710 2929 dbSNP
rs1451819119 2933 dbSNP
rs1402185344 2934 dbSNP
rs1206679667 2952 dbSNP
rs1025814065 2959 dbSNP
rs1370424883 2963 dbSNP
rs1165527597 2965 dbSNP
rs1320378446 2974 dbSNP
rs1423346328 2976 dbSNP
rs1256002543 2977 dbSNP
rs1224371116 2980 dbSNP
rs1295631917 2982 dbSNP
rs1196521398 2983 dbSNP
rs745809976 2986 dbSNP
rs1025005192 2987 dbSNP
rs1203771347 2994 dbSNP
rs1484665669 2995 dbSNP
rs1266865539 2996 dbSNP
rs895459544 2998 dbSNP
rs1445875773 3003 dbSNP
rs1333568587 3006 dbSNP
rs1186086994 3007 dbSNP
rs1035970272 3010 dbSNP
rs781049275 3012 dbSNP
rs769288004 3014 dbSNP
rs1174726879 3016 dbSNP
rs770712885 3016 dbSNP
rs1377355162 3017 dbSNP
rs1049253186 3019 dbSNP
rs532715241 3023 dbSNP
rs1300458635 3024 dbSNP
rs747359259 3024 dbSNP
rs1317287523 3027 dbSNP
rs1443927593 3028 dbSNP
rs1380349744 3031 dbSNP
rs1393089610 3033 dbSNP
rs776608594 3034 dbSNP
rs1294393021 3035 dbSNP
rs1373540560 3036 dbSNP
rs1441911624 3041 dbSNP
rs1300339170 3042 dbSNP
rs1329088359 3045 dbSNP
rs751314068 3048 dbSNP
rs1241136166 3050 dbSNP
rs1261279974 3051 dbSNP
rs1415859276 3051 dbSNP
rs565253363 3052 dbSNP
rs768358910 3054 dbSNP
rs1478402047 3061 dbSNP
rs78616463 3063 dbSNP
rs1191421786 3065 dbSNP
rs911548569 3067 dbSNP
rs1274497200 3068 dbSNP
rs1268981613 3070 dbSNP
rs1210133176 3072 dbSNP
rs1467626814 3073 dbSNP
rs1270665788 3074 dbSNP
rs193255599 3077 dbSNP
rs758621118 3079 dbSNP
rs1269548782 3082 dbSNP
rs1431765469 3084 dbSNP
rs560945478 3085 dbSNP
rs1224941449 3090 dbSNP
rs1332654724 3096 dbSNP
rs1457166510 3097 dbSNP
rs1050796970 3102 dbSNP
rs1302241556 3106 dbSNP
rs1440520230 3113 dbSNP
rs1053602547 3114 dbSNP
rs1293118864 3115 dbSNP
rs1392572148 3117 dbSNP
rs1333372072 3121 dbSNP
rs931892051 3122 dbSNP
rs542555078 3123 dbSNP
rs1166702088 3127 dbSNP
rs1349865734 3128 dbSNP
rs1226425909 3130 dbSNP
rs933363055 3133 dbSNP
rs572017047 3135 dbSNP
rs1378632367 3136 dbSNP
rs1198611491 3143 dbSNP
rs976652558 3144 dbSNP
rs765351278 3145 dbSNP
rs911059059 3147 dbSNP
rs1250782091 3148 dbSNP
rs1251685525 3150 dbSNP
rs1179920549 3151 dbSNP
rs779008831 3154 dbSNP
rs956514515 3156 dbSNP
rs983959593 3161 dbSNP
rs1420153313 3171 dbSNP
rs779865258 3172 dbSNP
rs1346845593 3173 dbSNP
rs1164143144 3177 dbSNP
rs778021547 3177 dbSNP
rs1233299273 3178 dbSNP
rs141915340 3179 dbSNP
rs971824728 3180 dbSNP
rs1447568419 3184 dbSNP
rs1335315945 3188 dbSNP
rs754414185 3190 dbSNP
rs1416596768 3194 dbSNP
rs529138425 3197 dbSNP
rs1375423285 3201 dbSNP
rs1173355824 3203 dbSNP
rs544897511 3204 dbSNP
rs1433276478 3205 dbSNP
rs1392858735 3208 dbSNP
rs1160129192 3210 dbSNP
rs1439770722 3213 dbSNP
rs1309940131 3215 dbSNP
rs1315178593 3215 dbSNP
rs1231871541 3217 dbSNP
rs959751438 3218 dbSNP
rs1035735020 3219 dbSNP
rs1275817073 3224 dbSNP
rs1454204421 3225 dbSNP
rs1013622218 3228 dbSNP
rs1256817217 3231 dbSNP
rs766947164 3239 dbSNP
rs1001793902 3242 dbSNP
rs773597282 3247 dbSNP
rs1011784328 3248 dbSNP
rs2129439 3248 dbSNP
rs758845863 3248 dbSNP
rs1346759789 3249 dbSNP
rs891942915 3250 dbSNP
rs1241221970 3255 dbSNP
rs1350241813 3265 dbSNP
rs1277777801 3271 dbSNP
rs1450332495 3272 dbSNP
rs556017019 3275 dbSNP
rs1382458865 3276 dbSNP
rs778069392 3277 dbSNP
rs537914963 3284 dbSNP
rs1339605546 3285 dbSNP
rs1184265470 3287 dbSNP
rs1053229949 3288 dbSNP
rs897968007 3289 dbSNP
rs3214993 3296 dbSNP
rs397788659 3296 dbSNP
rs58249756 3296 dbSNP
rs1313297622 3297 dbSNP
rs1209957184 3298 dbSNP
rs1362927104 3299 dbSNP
rs1160075407 3301 dbSNP
rs1486868550 3303 dbSNP
rs779462032 3303 dbSNP
rs1189266279 3305 dbSNP
rs755035697 3307 dbSNP
rs1036550069 3308 dbSNP
rs1156266467 3309 dbSNP
rs1008629819 3315 dbSNP
rs768244412 3316 dbSNP
rs762654746 3320 dbSNP
rs1187215113 3322 dbSNP
rs1486362219 3325 dbSNP
rs774930465 3330 dbSNP
rs148495338 3331 dbSNP
rs745332258 3332 dbSNP
rs1453911142 3341 dbSNP
rs1446595110 3344 dbSNP
rs781137028 3347 dbSNP
rs1282445923 3348 dbSNP
rs1230076104 3356 dbSNP
rs555390169 3358 dbSNP
rs1362668614 3361 dbSNP
rs983990781 3364 dbSNP
rs1232067296 3367 dbSNP
rs746825942 3370 dbSNP
rs1306096580 3378 dbSNP
rs756234243 3380 dbSNP
rs1247493244 3381 dbSNP
rs1338250323 3382 dbSNP
rs1299113532 3386 dbSNP
rs1430505212 3387 dbSNP
rs1050102006 3388 dbSNP
rs753310422 3398 dbSNP
rs1039370083 3410 dbSNP
rs1363769473 3411 dbSNP
rs753925446 3411 dbSNP
rs1163598774 3412 dbSNP
rs1474144929 3413 dbSNP
rs867790170 3414 dbSNP
rs1425723617 3415 dbSNP
rs1418924974 3419 dbSNP
rs931186247 3420 dbSNP
rs1195670416 3422 dbSNP
rs1474987131 3423 dbSNP
rs1247092495 3426 dbSNP
rs1240547994 3431 dbSNP
rs758611091 3432 dbSNP
rs1452243294 3433 dbSNP
rs188211173 3434 dbSNP
rs768023547 3437 dbSNP
rs12778047 3438 dbSNP
rs1320571732 3440 dbSNP
rs1279414728 3444 dbSNP
rs766519239 3449 dbSNP
rs1462707749 3452 dbSNP
rs1360397166 3455 dbSNP
rs1268030097 3460 dbSNP
rs1438094893 3467 dbSNP
rs1371284248 3468 dbSNP
rs199611594 3472 dbSNP
rs752972329 3473 dbSNP
rs960023799 3481 dbSNP
rs183735686 3483 dbSNP
rs865966868 3484 dbSNP
rs1171102780 3493 dbSNP
rs1409153889 3495 dbSNP
rs931609129 3496 dbSNP
rs1376252561 3499 dbSNP
rs1035356338 3501 dbSNP
rs979802623 3502 dbSNP
rs1327105156 3503 dbSNP
rs1454824261 3506 dbSNP
rs1252644379 3507 dbSNP
rs1191776153 3510 dbSNP
rs755298093 3513 dbSNP
rs1459185166 3515 dbSNP
rs1252399728 3518 dbSNP
rs969703308 3519 dbSNP
rs778947680 3522 dbSNP
rs1281085093 3524 dbSNP
rs1220204607 3529 dbSNP
rs1371209362 3535 dbSNP
rs1302295602 3536 dbSNP
rs1234328176 3539 dbSNP
rs751889783 3545 dbSNP
rs566399637 3546 dbSNP
rs150493899 3547 dbSNP
rs548039556 3547 dbSNP
rs1163313896 3551 dbSNP
rs144682904 3554 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HUVEC
Disease diabetes
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Using real time PCR analysis, we found that the expression level of KLF6 was significantly up-regulated in a diabetic-like environment (Figure 4). KLF9 and KLF10 were also upregulated, but not significantly. The addition of calcitriol significantly down-regulated KLF6, KLF9 and KLF10 mRNA expression (Figure 4). ...

- Zitman-Gal T; Green J; Pasmanik-Chor M; et al., 2014, Cardiovascular diabetology.

Article - Zitman-Gal T; Green J; Pasmanik-Chor M; et al.
- Cardiovascular diabetology, 2014
BACKGROUND: High blood and tissue concentrations of glucose and advanced glycation end-products are believed to play an important role in the development of vascular complications in patients with diabetes mellitus (DM) and chronic kidney disease. MicroRNAs (miRNA) are non-coding RNAs that regulate gene expression in a sequence specific manner. MiRNA are involved in various biological processes and become novel biomarkers, modulators and therapeutic targets for diseases such as cancer, atherosclerosis, and DM. Calcitriol (the active form of vitamin D) may inhibit endothelial proliferation, blunt angiogenesis, and be a cardioprotective agent. Calcitriol deficiency is a risk factor for DM and hypertension. The aim of this project was to study the miRNA microarray expression changes in human umbilical vein endothelial cells (HUVEC) treated in a diabetic-like environment with the addition of calcitriol. METHODS: HUVEC were treated for 24 h with 200 mug/ml human serum albumin (HSA) and 100 mg/dl glucose (control group) or 200 mug/ml AGE-HSA, and 250 mg/dl glucose (diabetic-like environment), and physiological concentrations (10-10 mol/l) of calcitriol. miRNA microarray analysis and real time PCR to validate the miRNA expression profile and mRNA target gene expression were carried out. RESULTS: Compared to control, 31 mature human miRNA were differentially expressed in the presence of a diabetic-like environment. Addition of physiological concentrations of calcitriol revealed 39 differentially expressed mature human miRNA. MiR-181c, miR-15a, miR-20b, miR-411, miR-659, miR-126 and miR-510 were selected for further analysis because they are known to be modified in DM and in other biological disorders. The predicted targets of these miRNA (such as KLF6, KLF9, KLF10, TXNIP and IL8) correspond to molecular and biological processes such as immune and defense responses, signal transduction and regulation of RNA. CONCLUSION: This study identified novel miRNA in the field of diabetic vasculopathy and might provide new information about the effect of vitamin D on gene regulation induced by a diabetic-like environment. New gene targets that are part of the molecular mechanism and the therapeutic treatment in diabetic vasculopathy are highlighted.
LinkOut: [PMID: 24397367]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells 0.505 5.9e-3 0.528 4.0e-3 24 Click to see details
GSE17498 Multiple myeloma -0.225 8.1e-2 -0.093 2.8e-1 40 Click to see details
GSE19536 Breast cancer -0.12 1.2e-1 -0.091 1.8e-1 100 Click to see details
GSE28260 Renal cortex and medulla 0.337 1.3e-1 0.456 5.9e-2 13 Click to see details
GSE21687 Ependynoma primary tumors -0.128 1.6e-1 -0.090 2.4e-1 64 Click to see details
GSE38226 Liver fibrosis -0.228 1.6e-1 -0.487 1.3e-2 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.206 1.6e-1 0.247 1.2e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.261 1.6e-1 -0.226 2.0e-1 16 Click to see details
GSE42095 Differentiated embryonic stem cells 0.208 1.7e-1 0.329 6.3e-2 23 Click to see details
GSE14794 Lymphoblastoid cells 0.091 2.0e-1 0.171 5.4e-2 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.151 2.4e-1 -0.023 4.6e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.115 2.7e-1 -0.031 4.3e-1 32 Click to see details
GSE21849 B cell lymphoma -0.12 2.7e-1 -0.100 3.0e-1 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.127 3.0e-1 -0.250 1.4e-1 20 Click to see details
GSE28544 Breast cancer 0.088 3.4e-1 0.052 4.0e-1 24 Click to see details
GSE21032 Prostate cancer 0.04 3.6e-1 0.027 4.0e-1 83 Click to see details
GSE17306 Multiple myeloma 0.041 3.9e-1 0.092 2.6e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer -0.04 4.3e-1 0.021 4.6e-1 20 Click to see details
GSE19783 ER- ER- breast cancer -0.017 4.4e-1 -0.050 3.3e-1 79 Click to see details
GSE19350 CNS germ cell tumors 0.037 4.5e-1 0.098 3.8e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.037 4.5e-1 0.098 3.8e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.215 0.04 0.257 0.02 68 Click to see details
PAAD -0.909 0.05 -1.000 0.5 4 Click to see details
HNSC 0.208 0.09 0.251 0.05 42 Click to see details
LIHC -0.186 0.1 -0.258 0.04 49 Click to see details
LUAD 0.393 0.1 0.287 0.18 12 Click to see details
BLCA 0.253 0.16 0.278 0.13 18 Click to see details
CESC 0.874 0.16 0.500 0.33 3 Click to see details
UCEC 0.223 0.18 0.128 0.3 19 Click to see details
PCPG 0.621 0.29 0.500 0.33 3 Click to see details
CHOL 0.211 0.29 0.200 0.3 9 Click to see details
BRCA 0.06 0.29 0.059 0.3 84 Click to see details
KICH -0.108 0.3 -0.208 0.16 25 Click to see details
LUSC -0.085 0.31 -0.149 0.19 38 Click to see details
STAD 0.082 0.33 0.083 0.33 32 Click to see details
THCA -0.036 0.39 -0.037 0.39 59 Click to see details
ESCA 0.09 0.4 -0.064 0.43 11 Click to see details
PRAD -0.018 0.45 0.043 0.38 50 Click to see details
KIRP -0.014 0.47 -0.066 0.36 32 Click to see details
COAD -0.023 0.48 -0.167 0.35 8 Click to see details
COAD -0.023 0.48 -0.167 0.35 8 Click to see details
COAD -0.023 0.48 -0.167 0.35 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1