miRTarBase - #MIRT438639 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AXL   
Synonyms ARK, JTK11, Tyro7, UFO
Description AXL receptor tyrosine kinase
Transcript NM_001699   
Other Transcripts NM_021913   
Expression
Putative miRNA Targets on AXL
3'UTR of AXL
(miRNA target sites are highlighted)
>AXL|NM_001699|3'UTR
   1 GACAACCCTCCACCTGGTACTCCCTCTCAGGATCCAAGCTAAGCACTGCCACTGGGGAAAACTCCACCTTCCCACTTTCC
  81 CACCCCACGCCTTATCCCCACTTGCAGCCCTGTCTTCCTACCTATCCCACCTCCATCCCAGACAGGTCCCTCCCCTTCTC
 161 TGTGCAGTAGCATCACCTTGAAAGCAGTAGCATCACCATCTGTAAAAGGAAGGGGTTGGATTGCAATATCTGAAGCCCTC
 241 CCAGGTGTTAACATTCCAAGACTCTAGAGTCCAAGGTTTAAAGAGTCTAGATTCAAAGGTTCTAGGTTTCAAAGATGCTG
 321 TGAGTCTTTGGTTCTAAGGACCTGAAATTCCAAAGTCTCTAATTCTATTAAAGTGCTAAGGTTCTAAGGCCTACTTTTTT
 401 TTTTTTTTTTTTTTTTTTTTTTTTTGCGATAGAGTCTCACTGTGTCACCCAGGCTGGAGTGCAGTGGTGCAATCTCGCCT
 481 CACTGCAACCTTCACCTACCGAGTTCAAGTGATTTTCCTGCCTTGGCCTCCCAAGTAGCTGGGATTACAGGTGTGTGCCA
 561 CCACACCCGGCTAATTTTTATATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGGTCTAAAACTCCTGACCT
 641 CAAGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGAGATTACAGGCATGAGCCACTGCACTCAACCTTAAGACCTACTG
 721 TTCTAAAGCTCTGACATTATGTGGTTTTAGATTTTCTGGTTCTAACATTTTTGATAAAGCCTCAAGGTTTTAGGTTCTAA
 801 AGTTCTAAGATTCTGATTTTAGGAGCTAAGGCTCTATGAGTCTAGATGTTTATTCTTCTAGAGTTCAGAGTCCTTAAAAT
 881 GTAAGATTATAGATTCTAAAGATTCTATAGTTCTAGACATGGAGGTTCTAAGGCCTAGGATTCTAAAATGTGATGTTCTA
 961 AGGCTCTGAGAGTCTAGATTCTCTGGCTGTAAGGCTCTAGATCATAAGGCTTCAAAATGTTATCTTCTCAAGTTCTAAGA
1041 TTCTAATGATGATCAATTATAGTTTCTGAGGCTTTATGATAATAGATTCTCTTGTATAAGATCCTAGATCCTAAGGGTCG
1121 AAAGCTCTAGAATCTGCAATTCAAAAGTTCCAAGAGTCTAAAGATGGAGTTTCTAAGGTCCGGTGTTCTAAGATGTGATA
1201 TTCTAAGACTTACTCTAAGATCTTAGATTCTCTGTGTCTAAGATTCTAGATCAGATGCTCCAAGATTCTAGATGATTAAA
1281 TAAGATTCTAACGGTCTGTTCTGTTTCAAGGCACTCTAGATTCCATTGGTCCAAGATTCCGGATCCTAAGCATCTAAGTT
1361 ATAAGACTCTCACACTCAGTTGTGACTAACTAGACACCAAAGTTCTAATAATTTCTAATGTTGGACACCTTTAGGTTCTT
1441 TGCTGCATTCTGCCTCTCTAGGACCATGGTTAAGAGTCCAAGAATCCACATTTCTAAAATCTTATAGTTCTAGGCACTGT
1521 AGTTCTAAGACTCAAATGTTCTAAGTTTCTAAGATTCTAAAGGTCCACAGGTCTAGACTATTAGGTGCAATTTCAAGGTT
1601 CTAACCCTATACTGTAGTATTCTTTGGGGTGCCCCTCTCCTTCTTAGCTATCATTGCTTCCTCCTCCCCAACTGTGGGGG
1681 TGTGCCCCCTTCAAGCCTGTGCAATGCATTAGGGATGCCTCCTTTCCCGCAGGGGATGGACGATCTCCCACCTTTCGGGC
1761 CATGTTGCCCCCGTGAGCCAATCCCTCACCTTCTGAGTACAGAGTGTGGACTCTGGTGCCTCCAGAGGGGCTCAGGTCAC
1841 ATAAAACTTTGTATATCAACGAGAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGgu 5'
             |:|  | | ||||||||  
Target 5' gttATAAGACTCTCACACTCag 3'
1358 - 1379 139.00 -11.50
2
miRNA  3' guuuguGGU-AACAG-UGUGAGGu 5'
                |||  |||: |||:||| 
Target 5' gccctcCCAGGTGTTAACATTCCa 3'
235 - 258 136.00 -15.90
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             | :|:: | | | ||||| 
Target 5' gccAGGCTGGTCTAAAACTCCt 3'
614 - 635 119.00 -12.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30134918 2 COSMIC
COSN26670121 12 COSMIC
COSN30476603 35 COSMIC
COSN30476548 36 COSMIC
COSN30495032 68 COSMIC
COSN15814776 445 COSMIC
COSN17549528 659 COSMIC
COSN17538979 902 COSMIC
COSN29643843 933 COSMIC
COSN2502673 970 COSMIC
COSN21744760 1101 COSMIC
COSN25074253 1183 COSMIC
COSN31571021 1341 COSMIC
COSN31566922 1383 COSMIC
COSN31568936 1416 COSMIC
COSN31582461 1483 COSMIC
COSN31521164 1623 COSMIC
COSN26552983 1736 COSMIC
COSN24485523 1742 COSMIC
COSN31535766 1791 COSMIC
COSN21648273 1814 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1473557433 3 dbSNP
rs752290869 7 dbSNP
rs1401355628 8 dbSNP
rs1414827812 9 dbSNP
rs756095111 11 dbSNP
rs777892577 12 dbSNP
rs749048998 13 dbSNP
rs1288473203 14 dbSNP
rs1012902482 20 dbSNP
rs1221102732 21 dbSNP
rs1274810041 23 dbSNP
rs1346248618 35 dbSNP
rs757019231 36 dbSNP
rs1021912094 37 dbSNP
rs1271310415 42 dbSNP
rs376391221 50 dbSNP
rs1002593580 54 dbSNP
rs1033950315 55 dbSNP
rs1051126 59 dbSNP
rs560302194 60 dbSNP
rs527521202 61 dbSNP
rs548762687 68 dbSNP
rs142554741 72 dbSNP
rs531489464 83 dbSNP
rs191246496 88 dbSNP
rs571128380 89 dbSNP
rs1303180373 90 dbSNP
rs1395566678 95 dbSNP
rs1444169278 99 dbSNP
rs1389589219 102 dbSNP
rs375138656 106 dbSNP
rs1190893945 113 dbSNP
rs1448120558 122 dbSNP
rs965540368 123 dbSNP
rs1350492262 124 dbSNP
rs538730875 127 dbSNP
rs964426957 130 dbSNP
rs1266652402 138 dbSNP
rs1218746153 140 dbSNP
rs1358208482 148 dbSNP
rs1274974478 150 dbSNP
rs1230326117 161 dbSNP
rs1362831363 161 dbSNP
rs1294616144 178 dbSNP
rs1280932044 189 dbSNP
rs1291802440 200 dbSNP
rs1424162077 201 dbSNP
rs1371397709 205 dbSNP
rs974784783 217 dbSNP
rs1428195118 223 dbSNP
rs1325209558 224 dbSNP
rs1223802721 227 dbSNP
rs925595879 243 dbSNP
rs935926715 245 dbSNP
rs1196627250 248 dbSNP
rs1030080142 249 dbSNP
rs146014126 256 dbSNP
rs878970815 257 dbSNP
rs985748305 263 dbSNP
rs565759778 264 dbSNP
rs1337078937 267 dbSNP
rs1046495398 275 dbSNP
rs869129434 277 dbSNP
rs1233725800 299 dbSNP
rs1313870557 300 dbSNP
rs1299190448 301 dbSNP
rs1404377473 331 dbSNP
rs941973542 343 dbSNP
rs1002282067 352 dbSNP
rs1198827661 368 dbSNP
rs184958911 369 dbSNP
rs1481528158 375 dbSNP
rs1467951031 376 dbSNP
rs919116035 381 dbSNP
rs1177128934 387 dbSNP
rs1372281681 390 dbSNP
rs377466882 392 dbSNP
rs147815427 393 dbSNP
rs1251863750 394 dbSNP
rs1473220264 394 dbSNP
rs1183725732 395 dbSNP
rs1187877217 395 dbSNP
rs1202800947 395 dbSNP
rs1222770029 395 dbSNP
rs1236987620 395 dbSNP
rs1240993963 395 dbSNP
rs1290218708 395 dbSNP
rs1329807517 395 dbSNP
rs1335179851 395 dbSNP
rs1335382170 395 dbSNP
rs1336524794 395 dbSNP
rs1362829686 395 dbSNP
rs1398119720 395 dbSNP
rs1400573080 395 dbSNP
rs1404640366 395 dbSNP
rs1414859220 395 dbSNP
rs1425210509 395 dbSNP
rs1458170038 395 dbSNP
rs1468217494 395 dbSNP
rs555979915 396 dbSNP
rs1270000158 397 dbSNP
rs1203459022 399 dbSNP
rs1299752467 400 dbSNP
rs1371107126 402 dbSNP
rs1404303495 403 dbSNP
rs1300726073 404 dbSNP
rs1346913367 405 dbSNP
rs1386990333 406 dbSNP
rs1294417665 410 dbSNP
rs1247217078 416 dbSNP
rs1380867225 416 dbSNP
rs1314734288 421 dbSNP
rs1307221704 426 dbSNP
rs899167231 426 dbSNP
rs1460984027 427 dbSNP
rs1184091833 428 dbSNP
rs1398432942 429 dbSNP
rs1253556747 441 dbSNP
rs995081897 443 dbSNP
rs1343460584 447 dbSNP
rs574401577 450 dbSNP
rs1383015394 461 dbSNP
rs1182736082 468 dbSNP
rs559086096 477 dbSNP
rs868369090 487 dbSNP
rs1490879465 489 dbSNP
rs1191920400 491 dbSNP
rs796378857 501 dbSNP
rs1009456061 502 dbSNP
rs1043097033 510 dbSNP
rs1357538854 523 dbSNP
rs904485420 533 dbSNP
rs964846166 535 dbSNP
rs974500041 539 dbSNP
rs1390616470 551 dbSNP
rs556521389 556 dbSNP
rs1367858046 561 dbSNP
rs577915574 569 dbSNP
rs188947501 570 dbSNP
rs1332184777 577 dbSNP
rs1323576766 581 dbSNP
rs760920812 582 dbSNP
rs1366822819 593 dbSNP
rs956993624 596 dbSNP
rs766779258 598 dbSNP
rs901378328 604 dbSNP
rs1359471209 608 dbSNP
rs1383601503 619 dbSNP
rs1165948850 623 dbSNP
rs998348017 624 dbSNP
rs560426123 634 dbSNP
rs953147474 652 dbSNP
rs1201090760 653 dbSNP
rs1489892182 657 dbSNP
rs1268422546 660 dbSNP
rs985821884 663 dbSNP
rs1015887833 668 dbSNP
rs56066514 679 dbSNP
rs963004827 681 dbSNP
rs972427532 684 dbSNP
rs1214362280 687 dbSNP
rs754192154 688 dbSNP
rs960172810 692 dbSNP
rs56380440 693 dbSNP
rs981712503 695 dbSNP
rs1406210245 698 dbSNP
rs1343148549 701 dbSNP
rs927133417 710 dbSNP
rs1410009636 721 dbSNP
rs1355936550 740 dbSNP
rs992686962 745 dbSNP
rs1168050570 754 dbSNP
rs915723877 763 dbSNP
rs1323515942 765 dbSNP
rs1425749200 795 dbSNP
rs948785271 813 dbSNP
rs938135893 831 dbSNP
rs1055125104 832 dbSNP
rs899177176 837 dbSNP
rs1484125720 844 dbSNP
rs1260318620 849 dbSNP
rs930605353 853 dbSNP
rs572187607 871 dbSNP
rs1047984303 876 dbSNP
rs1043129425 882 dbSNP
rs925978296 884 dbSNP
rs542450782 887 dbSNP
rs1009137388 891 dbSNP
rs560718039 893 dbSNP
rs1375069299 898 dbSNP
rs900666614 898 dbSNP
rs1296137215 901 dbSNP
rs531525361 902 dbSNP
rs1441182235 904 dbSNP
rs996337393 914 dbSNP
rs754308641 916 dbSNP
rs1443787024 924 dbSNP
rs1181617821 938 dbSNP
rs1468107303 939 dbSNP
rs998818354 945 dbSNP
rs1159983663 946 dbSNP
rs575539065 950 dbSNP
rs1406022933 951 dbSNP
rs957045710 953 dbSNP
rs1405402967 956 dbSNP
rs1473260468 959 dbSNP
rs1157696643 968 dbSNP
rs1342974419 973 dbSNP
rs1239533460 976 dbSNP
rs988448102 978 dbSNP
rs1461256719 979 dbSNP
rs564907178 987 dbSNP
rs1007295176 1005 dbSNP
rs1019950286 1006 dbSNP
rs577485180 1009 dbSNP
rs1304261251 1010 dbSNP
rs532052164 1013 dbSNP
rs1222810235 1029 dbSNP
rs369429180 1047 dbSNP
rs1389756914 1048 dbSNP
rs1450255502 1051 dbSNP
rs1381938487 1058 dbSNP
rs927151120 1060 dbSNP
rs1455388830 1071 dbSNP
rs1343456732 1079 dbSNP
rs937153397 1084 dbSNP
rs1406097811 1089 dbSNP
rs963055328 1090 dbSNP
rs1387382813 1092 dbSNP
rs867588654 1095 dbSNP
rs993172294 1098 dbSNP
rs193253238 1105 dbSNP
rs1313488683 1110 dbSNP
rs1188755958 1115 dbSNP
rs1249168971 1115 dbSNP
rs565813754 1120 dbSNP
rs1229447830 1121 dbSNP
rs1214476301 1125 dbSNP
rs1321933379 1129 dbSNP
rs1306373280 1136 dbSNP
rs930657772 1138 dbSNP
rs185294486 1140 dbSNP
rs1210755862 1148 dbSNP
rs1381831188 1149 dbSNP
rs1047748181 1152 dbSNP
rs1298085336 1152 dbSNP
rs1347785630 1161 dbSNP
rs1359782965 1164 dbSNP
rs73045231 1170 dbSNP
rs1437366230 1171 dbSNP
rs139571243 1174 dbSNP
rs969865553 1176 dbSNP
rs149681827 1182 dbSNP
rs10691 1196 dbSNP
rs926024158 1199 dbSNP
rs934690919 1203 dbSNP
rs900671890 1212 dbSNP
rs996322590 1216 dbSNP
rs1427199651 1222 dbSNP
rs1053131729 1226 dbSNP
rs1185425131 1229 dbSNP
rs922553584 1230 dbSNP
rs144503779 1235 dbSNP
rs1270567301 1243 dbSNP
rs578192336 1293 dbSNP
rs1020002851 1294 dbSNP
rs1229354933 1299 dbSNP
rs757795450 1308 dbSNP
rs1003208693 1321 dbSNP
rs889977702 1324 dbSNP
rs1005674345 1327 dbSNP
rs958802925 1331 dbSNP
rs538683037 1342 dbSNP
rs1219870230 1343 dbSNP
rs1347421870 1363 dbSNP
rs777510183 1367 dbSNP
rs1404493047 1369 dbSNP
rs1371417379 1374 dbSNP
rs898924048 1377 dbSNP
rs1300253083 1388 dbSNP
rs752407980 1389 dbSNP
rs1460848458 1392 dbSNP
rs1372974525 1400 dbSNP
rs973847100 1406 dbSNP
rs1481717710 1417 dbSNP
rs1430736165 1420 dbSNP
rs368319814 1427 dbSNP
rs993614941 1430 dbSNP
rs1335100332 1438 dbSNP
rs1490067111 1439 dbSNP
rs1361325101 1444 dbSNP
rs1197304643 1447 dbSNP
rs1025998743 1453 dbSNP
rs190095433 1467 dbSNP
rs1298111786 1468 dbSNP
rs1325593991 1477 dbSNP
rs959945632 1478 dbSNP
rs1223045616 1482 dbSNP
rs1051008 1487 dbSNP
rs907900770 1492 dbSNP
rs777653131 1500 dbSNP
rs1041044275 1501 dbSNP
rs772326604 1517 dbSNP
rs1471201879 1520 dbSNP
rs969918111 1538 dbSNP
rs1289179382 1539 dbSNP
rs1173613343 1545 dbSNP
rs560752294 1547 dbSNP
rs1032810771 1551 dbSNP
rs956149654 1553 dbSNP
rs1416976214 1565 dbSNP
rs893309081 1569 dbSNP
rs1221968654 1575 dbSNP
rs1462587533 1578 dbSNP
rs1280457048 1580 dbSNP
rs1261256420 1585 dbSNP
rs751403022 1606 dbSNP
rs922638950 1608 dbSNP
rs1335400077 1609 dbSNP
rs1313804135 1611 dbSNP
rs922427764 1623 dbSNP
rs1051034 1627 dbSNP
rs1231117718 1628 dbSNP
rs906863254 1630 dbSNP
rs1458252558 1634 dbSNP
rs1002517601 1640 dbSNP
rs1051040 1644 dbSNP
rs181260271 1651 dbSNP
rs1034691672 1652 dbSNP
rs1159803005 1667 dbSNP
rs1428031200 1671 dbSNP
rs183807314 1672 dbSNP
rs1362921273 1676 dbSNP
rs530122571 1679 dbSNP
rs1026814536 1681 dbSNP
rs1241171058 1686 dbSNP
rs778014034 1688 dbSNP
rs9429 1693 dbSNP
rs985717221 1695 dbSNP
rs1447545661 1698 dbSNP
rs781191098 1707 dbSNP
rs911468730 1729 dbSNP
rs1203476858 1730 dbSNP
rs1350208669 1731 dbSNP
rs1292860332 1734 dbSNP
rs1415419356 1735 dbSNP
rs1248600255 1740 dbSNP
rs1170302713 1741 dbSNP
rs907929749 1742 dbSNP
rs747246943 1743 dbSNP
rs966454553 1757 dbSNP
rs976139131 1758 dbSNP
rs1412270149 1762 dbSNP
rs1380095996 1764 dbSNP
rs771014520 1767 dbSNP
rs1383756899 1768 dbSNP
rs565082093 1769 dbSNP
rs1038505898 1773 dbSNP
rs532419122 1779 dbSNP
rs1051100 1794 dbSNP
rs1162700273 1817 dbSNP
rs1345028897 1826 dbSNP
rs897292870 1831 dbSNP
rs547092313 1840 dbSNP
rs1475665138 1842 dbSNP
rs932262502 1847 dbSNP
rs1054707101 1855 dbSNP
rs914753989 1856 dbSNP
rs1269725790 1857 dbSNP
rs1276833227 1861 dbSNP
rs929084476 1862 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hepa
Disease Hepatobiliary Cyst//Hepatocellular Carcinoma
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Additionally, LKO livers were more fi brotic and vascular, and developed larger microscopic tumors, possibly due to elevation of the Axl oncogene, a receptor tyrosine kinase as a novel target of miR-122, and several protumorigenic miR-122 targets. At 35 weeks following DEN exposure, LKO mice exhibited a higher incidence of macroscopic liver tumors (71%) and cysts (86%) compared to a 21.4% and 0% incidence of tumors and cysts, respectively, in control mice. ...

- Hsu SH; Wang B; Kutay H; Bid H; Shreve J; et al., 2013, The American journal of pathology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuuGUGGUAA--CAGUGUGAGGu 5'
              | ||| |  ||  |||||| 
Target 5' acccCCCCACUCCGU--CACUCCa 3'
3 - 24
Article - Hsu SH; Wang B; Kutay H; Bid H; Shreve J; et al.
- The American journal of pathology, 2013
Loss of miR-122 causes chronic steatohepatitis and spontaneous hepatocellular carcinoma. However, the consequence of miR-122 deficiency on genotoxic stress-induced liver pathogenesis is poorly understood. Here, we investigated the impact of miR-122 depletion on liver pathobiology by treating liver-specific miR-122 knockout (LKO) mice with the hepatocarcinogen diethylnitrosamine (DEN). At 25 weeks post-DEN injection, all LKO mice developed CK-19-positive hepatobiliary cysts, which correlated with DEN-induced transcriptional activation of Cdc25a mediated through E2f1. Additionally, LKO livers were more fibrotic and vascular, and developed larger microscopic tumors, possibly due to elevation of the Axl oncogene, a receptor tyrosine kinase as a novel target of miR-122, and several protumorigenic miR-122 targets. At 35 weeks following DEN exposure, LKO mice exhibited a higher incidence of macroscopic liver tumors (71%) and cysts (86%) compared to a 21.4% and 0% incidence of tumors and cysts, respectively, in control mice. The tumors in LKO mice were bigger (ninefold, P = 0.015) and predominantly hepatocellular carcinoma, whereas control mice mostly developed hepatocellular adenoma. DEN treatment also reduced survival of LKO mice compared to control mice (P = 0.03). Interestingly, induction of oxidative stress and proinflammatory cytokines in LKO liver shortly after DEN exposure indicates predisposition of a pro-tumorigenic microenvironment. Collectively, miR-122 depletion facilitates cystogenesis and hepatocarcinogenesis in mice on DEN challenge by up-regulating several genes involved in proliferation, growth factor signaling, neovascularization, and metastasis.
LinkOut: [PMID: 24113455]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.814 6.5e-7 -0.775 4.4e-6 24 Click to see details
GSE28260 Renal cortex and medulla 0.808 4.2e-4 0.791 6.4e-4 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.597 1.3e-3 0.577 2.0e-3 23 Click to see details
GSE17306 Multiple myeloma 0.276 2.7e-2 0.322 1.2e-2 49 Click to see details
GSE21687 Ependynoma primary tumors -0.211 4.7e-2 -0.166 9.5e-2 64 Click to see details
GSE14794 Lymphoblastoid cells 0.146 8.5e-2 -0.004 4.9e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.306 9.5e-2 0.098 3.4e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.214 1.2e-1 -0.213 1.2e-1 32 Click to see details
GSE17498 Multiple myeloma 0.141 1.9e-1 0.409 4.4e-3 40 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.147 2.4e-1 0.201 1.7e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.132 2.6e-1 0.075 3.6e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.145 3.0e-1 0.162 2.7e-1 16 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.253 3.1e-1 -0.029 4.8e-1 6 Click to see details
GSE38226 Liver fibrosis 0.095 3.4e-1 -0.008 4.9e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.104 3.7e-1 0.262 2.1e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.023 4.6e-1 0.042 4.2e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.023 4.6e-1 0.042 4.2e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.653 0 -0.606 0 49 Click to see details
STAD -0.571 0.07 -0.667 0.04 8 Click to see details
HNSC 0.953 0.1 1.000 0.5 3 Click to see details
KIRP 0.386 0.15 -0.067 0.43 9 Click to see details
THCA -0.492 0.2 -0.600 0.14 5 Click to see details
KICH 0.32 0.22 0.095 0.41 8 Click to see details
KIRC 0.105 0.29 -0.073 0.35 29 Click to see details
CHOL 0.089 0.41 0.150 0.35 9 Click to see details
ESCA 0.051 0.47 -0.300 0.31 5 Click to see details
ESCA 0.051 0.47 -0.300 0.31 5 Click to see details
ESCA 0.051 0.47 -0.300 0.31 5 Click to see details
ESCA 0.051 0.47 -0.300 0.31 5 Click to see details
ESCA 0.051 0.47 -0.300 0.31 5 Click to see details
ESCA 0.051 0.47 -0.300 0.31 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*