miRTarBase - #MIRT447778 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DMRT2   
Synonyms -
Description doublesex and mab-3 related transcription factor 2
Transcript NM_006557   
Other Transcripts NM_001130865 , NM_181872   
Expression
Putative miRNA Targets on DMRT2
3'UTR of DMRT2
(miRNA target sites are highlighted)
>DMRT2|NM_006557|3'UTR
   1 AAAATAAAAGTGACATCAGCTCTAGGTATAGATATATTTTTTAATAATGAAAAAAGATGACATGGATAATAATAAAACAT
  81 TGATTGATACAAGATAAATAGTCTTGTCTCTTAATGCGTAGGGGGCCTGGGAAGAATATTAAAATTTTAATCAATAAAGT
 161 ATGTCTGTTGAAGCAAGCAAGCAAACAAATCCATAACAACCACAACAAGCAACAAGAACAAGAACAACAACAAGAAGAAG
 241 TTGCAGTATGGATATCTTTCACCCTCCCAGGAAACTCTTTCAAACCTAATCTGTACTTTTGCATCTGTATAAAAATATCA
 321 GTGAGATGGAACTGTAAATAATTGTTCTGCTGATCTGTAGTGTTGCTGTTACCTTCTGGGTTTCCACATTTTTATTCCGT
 401 AGATGTTAATCTCTTTCATGTGCAATCTTTGCTTCTTGTAGGCTATCGCCCCATTCCAGCGGAGACTTATGTAGGAGGGA
 481 CCTTCCCTCTACCTCCCCCAGTTAGTGACAGGATGAGGAAAAGAAGAGCCTTTGCTGATAAAGAGTTGGAGAACATTATG
 561 CTGGAGAGAGAATATAAAGAAAGGGAGATGTTGGAAACTTCTCAAGCTGCTGCTCTGTTTCTGCCCAACCGCATGGTGCC
 641 TGGACCTGACTACAATTCCTACAAAAGTGCCTACAGCCCCAGCCCAGTGGAACCACCAAGCAAGGACTTCTGTAATTTTT
 721 TGCCCACCTGCCTTGATTTAACCATGCAGTATTCAGGGTCTGGGAATATGGAACTAATTTCTTCTAATGTCAGCGTGGCC
 801 ACAACTTATAGACAGTATCCCTTGTCCTCAAGATTTTTAGTTTGGCCCAAGTGTGGCCCCATTAGCGACACCCTCCTCTA
 881 CCAGCAATGCCTGCTAAATGCCACCACCTCAGTTCAAGCCCTGAAGCCTGGGGCCAGCTGGGACTTGAAGGGAGCACGAG
 961 TCCAGGATGGACTCAGTGCAGAGCAGGACATGATGCCATCGAAATTGGAAGGTTCCCTGGTGCTGCCTCACACTCCTGAG
1041 ATCCAGACCACGAGAAGTGACCTTCAGGGTCATCAGGCTGTCCCAGAGAGGTCCGCGTTCTCCCCACCCCGACGGAATTT
1121 CTCTCCCATTGTTGACACGGACTCCCTGGCAGCTCAAGGGCATGTCTTAACGAAGATCAGCAAAGAAAACACCAGGCACC
1201 CTCTGCCACTTAGACATAATCCATTCCACTCATTATTCCAGCAAACACTTACTGACAAATCGGGTCCTGAGTTGAAAACA
1281 CCATTTGTCAAAGAGGCCTTTGAAGAGACCCCTAAGAAACACAGAGAGTGTTTAGTTAAGGACAACCAGAAGTACACATT
1361 TACAATAGATAGATGTGCAAAAGACCTTTTTGTAGCCAAACAAGTTGGAACAAAACTCTCGGTGAATGAACCACTGTCAT
1441 TTTCTGTTGAGTCTATTCTTAAGAGGCCTTCATCTGCCATCACTCGTGTCTCTCAGTGAAAGGCTGCTTAAACAGAAAGC
1521 TGGATTTTCTGCAGTCTTAGAGCATTATAGCCATTTGCTACTTTTTTTAAAAGTTAAGATGTTTGTGTAAAGAAATTTCT
1601 AATGTAAAGATGATGATTTTGAAAAATTTTATATATTCCTAATATGCATGTACTTTTTCTTATCACATATATTTAAACTT
1681 ACAGATGGAAATTGCCCAATGTGCAAATTGTTAAGTACCACACTTTACACAGCATTTCAAAAAGCAATAAAATTGACACT
1761 GTCTTCTCAAAGACCCAATAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUG-GUAAUAC-ACGACGAu 5'
             |||| : | | | ||||||| 
Target 5' tggAAACTTCTCAAGCTGCTGCTc 3'
592 - 615 151.00 -11.40
2
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            ::| |::| :|| |||||:| 
Target 5' gcTGATCTGTAGTGTTGCTGTTa 3'
349 - 371 140.00 -11.70
3
miRNA  3' guGUUUGGUAAUA-C-----ACGACGAu 5'
            :|:| |||||| |     |||| || 
Target 5' ctTAGAGCATTATAGCCATTTGCTACTt 3'
1536 - 1563 128.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
776401 625 ClinVar
708805 629 ClinVar
776402 959 ClinVar
COSN30512587 36 COSMIC
COSN18733756 43 COSMIC
COSN31504926 62 COSMIC
COSN18733942 97 COSMIC
COSN31599391 98 COSMIC
COSN30151530 111 COSMIC
COSN31511891 111 COSMIC
COSN30533569 119 COSMIC
COSN30530111 155 COSMIC
COSN30106953 165 COSMIC
COSN31540691 232 COSMIC
COSN30167578 257 COSMIC
COSN18250594 276 COSMIC
COSN30115269 295 COSMIC
COSN31519342 314 COSMIC
COSN28770090 328 COSMIC
COSN30186961 356 COSMIC
COSN31507695 356 COSMIC
COSN30156198 382 COSMIC
COSN30104627 388 COSMIC
COSN30176004 400 COSMIC
COSN31604347 403 COSMIC
COSN30112918 419 COSMIC
COSN26973602 428 COSMIC
COSN30187897 428 COSMIC
COSN30111077 432 COSMIC
COSM9850064 444 COSMIC
COSM4979638 448 COSMIC
COSM269031 449 COSMIC
COSM5580840 453 COSMIC
COSM3652437 457 COSMIC
COSM3652438 458 COSMIC
COSM3902667 461 COSMIC
COSM4678137 465 COSMIC
COSM8880134 469 COSMIC
COSM3724720 475 COSMIC
COSM6883116 486 COSMIC
COSM6883115 487 COSMIC
COSM5919705 497 COSMIC
COSM4557008 524 COSMIC
COSM6453661 527 COSMIC
COSM9246808 548 COSMIC
COSM8822183 552 COSMIC
COSM5759997 555 COSMIC
COSM5445193 565 COSMIC
COSM8827509 566 COSMIC
COSM1459012 569 COSMIC
COSM3167433 569 COSMIC
COSM4678138 571 COSMIC
COSM7456571 584 COSMIC
COSM7428115 592 COSMIC
COSM7485366 593 COSMIC
COSM6056557 602 COSMIC
COSM9861204 604 COSMIC
COSM9453630 616 COSMIC
COSM4800056 617 COSMIC
COSM3779489 626 COSMIC
COSM3167435 631 COSMIC
COSM3413204 632 COSMIC
COSM752227 641 COSMIC
COSM9107614 642 COSMIC
COSM9379472 659 COSMIC
COSM5990506 675 COSMIC
COSM7625262 678 COSMIC
COSM5503441 683 COSMIC
COSM6114532 685 COSMIC
COSM74383 697 COSMIC
COSM9714267 697 COSMIC
COSM4588304 698 COSMIC
COSM1103406 705 COSMIC
COSM1103407 716 COSMIC
COSM5153037 724 COSMIC
COSM9861396 725 COSMIC
COSM8849808 729 COSMIC
COSM6645676 736 COSMIC
COSM8431420 737 COSMIC
COSM9315189 740 COSMIC
COSM3902668 762 COSMIC
COSM3167438 772 COSMIC
COSM3847217 782 COSMIC
COSM4600709 782 COSMIC
COSM4455976 788 COSMIC
COSM6114531 790 COSMIC
COSM1624371 791 COSMIC
COSM4654411 794 COSMIC
COSM5662337 794 COSMIC
COSM3902669 795 COSMIC
COSM1459013 799 COSMIC
COSM3902670 807 COSMIC
COSM8894412 808 COSMIC
COSM9018430 813 COSMIC
COSM7251315 818 COSMIC
COSM8447186 821 COSMIC
COSM5559334 823 COSMIC
COSM3167439 827 COSMIC
COSM4915634 833 COSMIC
COSM8421646 834 COSMIC
COSM1250271 849 COSMIC
COSM4678139 857 COSMIC
COSM8439758 858 COSMIC
COSM137515 868 COSMIC
COSM7152361 869 COSMIC
COSM9619909 893 COSMIC
COSM383586 894 COSMIC
COSM4600730 913 COSMIC
COSM486847 916 COSMIC
COSM4794039 921 COSMIC
COSM8857549 927 COSMIC
COSM7195036 931 COSMIC
COSM5410069 939 COSMIC
COSM6013354 942 COSMIC
COSM4568400 947 COSMIC
COSM9723566 948 COSMIC
COSM1103408 955 COSMIC
COSM3982647 955 COSMIC
COSM4408833 955 COSMIC
COSM291991 956 COSMIC
COSM9575373 958 COSMIC
COSM7884033 966 COSMIC
COSM7194653 969 COSMIC
COSM230167 992 COSMIC
COSM9064646 994 COSMIC
COSM8594568 997 COSMIC
COSM1176737 1001 COSMIC
COSM9511100 1002 COSMIC
COSM8144824 1008 COSMIC
COSM237296 1026 COSMIC
COSM4803714 1036 COSMIC
COSM9732019 1044 COSMIC
COSM3929704 1050 COSMIC
COSM7364645 1052 COSMIC
COSM8608557 1060 COSMIC
COSM1250267 1067 COSMIC
COSM3652439 1072 COSMIC
COSM7656319 1075 COSMIC
COSM4462959 1083 COSMIC
COSM9619910 1084 COSMIC
COSM5547802 1085 COSMIC
COSM1700784 1087 COSMIC
COSM5410070 1094 COSMIC
COSM5976989 1095 COSMIC
COSM9379474 1095 COSMIC
COSM6051264 1096 COSMIC
COSM351842 1105 COSMIC
COSM5759998 1105 COSMIC
COSM3847218 1107 COSMIC
COSM5522506 1110 COSMIC
COSM5522505 1111 COSMIC
COSM6645679 1111 COSMIC
COSM4588305 1114 COSMIC
COSM1250272 1115 COSMIC
COSM319926 1115 COSMIC
COSM5172366 1119 COSMIC
COSM5606477 1122 COSMIC
COSM5529852 1126 COSMIC
COSM5875258 1135 COSMIC
COSM8505550 1139 COSMIC
COSM302065 1140 COSMIC
COSM1250270 1142 COSMIC
COSM8120436 1145 COSMIC
COSM8963263 1147 COSMIC
COSM8857534 1172 COSMIC
COSM9735242 1173 COSMIC
COSM8742791 1176 COSMIC
COSM9284704 1176 COSMIC
COSM1635946 1183 COSMIC
COSM1103409 1186 COSMIC
COSM3763495 1186 COSMIC
COSM6549902 1197 COSMIC
COSM3847219 1199 COSMIC
COSM1459014 1202 COSMIC
COSM8903609 1214 COSMIC
COSM6044234 1218 COSMIC
COSM36855 1222 COSMIC
COSM1203866 1223 COSMIC
COSM8852565 1225 COSMIC
COSM7669018 1227 COSMIC
COSM9454074 1228 COSMIC
COSM5043771 1244 COSMIC
COSM4466693 1262 COSMIC
COSM7928637 1268 COSMIC
COSM7174616 1270 COSMIC
COSM9379473 1283 COSMIC
COSM7201015 1294 COSMIC
COSM7463080 1299 COSMIC
COSM8540791 1302 COSMIC
COSM1718620 1306 COSMIC
COSM9720069 1311 COSMIC
COSM3652440 1317 COSMIC
COSM8875123 1325 COSMIC
COSM9166573 1343 COSMIC
COSM131400 1346 COSMIC
COSM3716105 1369 COSMIC
COSM3925814 1384 COSMIC
COSM9096467 1391 COSMIC
COSM4678140 1418 COSMIC
COSM3925815 1420 COSMIC
COSM5001260 1421 COSMIC
COSM5045637 1423 COSMIC
COSM7662235 1429 COSMIC
COSM5435271 1431 COSMIC
COSM6645675 1438 COSMIC
COSM5759999 1439 COSMIC
COSM3652441 1445 COSMIC
COSM3779490 1450 COSMIC
COSM1103410 1466 COSMIC
COSM6182184 1467 COSMIC
COSM3902671 1470 COSMIC
COSM1241084 1477 COSMIC
COSM5590564 1486 COSMIC
COSM6488672 1486 COSMIC
COSM5430887 1488 COSMIC
COSN14692149 1545 COSMIC
COSN30505116 1551 COSMIC
COSN18733943 1578 COSMIC
COSN1371062 1670 COSMIC
rs17641078 1186 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs755600953 3 dbSNP
rs779575754 9 dbSNP
rs748931401 11 dbSNP
rs774186247 12 dbSNP
rs747929955 14 dbSNP
rs927269738 15 dbSNP
rs567611497 16 dbSNP
rs1209343726 17 dbSNP
rs1259913669 18 dbSNP
rs773032376 19 dbSNP
rs760615461 20 dbSNP
rs1346426328 23 dbSNP
rs200747181 29 dbSNP
rs1479758473 31 dbSNP
rs775611126 32 dbSNP
rs1288781179 34 dbSNP
rs1216705094 36 dbSNP
rs780075531 36 dbSNP
rs749556839 37 dbSNP
rs763319388 37 dbSNP
rs1403367793 42 dbSNP
rs1056054227 45 dbSNP
rs1415675359 50 dbSNP
rs764399352 50 dbSNP
rs752039179 52 dbSNP
rs1385977702 58 dbSNP
rs6474554 60 dbSNP
rs1358515789 61 dbSNP
rs1464419842 61 dbSNP
rs1170818199 64 dbSNP
rs1411479097 65 dbSNP
rs78320923 73 dbSNP
rs1169490927 78 dbSNP
rs1045531792 79 dbSNP
rs1259005082 80 dbSNP
rs902851404 81 dbSNP
rs1483176780 84 dbSNP
rs1233991267 85 dbSNP
rs1207018032 86 dbSNP
rs998558025 91 dbSNP
rs944286982 93 dbSNP
rs1039963337 94 dbSNP
rs12350001 97 dbSNP
rs1291449756 102 dbSNP
rs1226633114 104 dbSNP
rs1000556180 105 dbSNP
rs1032479709 109 dbSNP
rs533882403 111 dbSNP
rs893379124 118 dbSNP
rs553542064 119 dbSNP
rs1018201341 121 dbSNP
rs1461579177 127 dbSNP
rs1419590286 130 dbSNP
rs966265368 136 dbSNP
rs1162036929 137 dbSNP
rs1422761964 146 dbSNP
rs1408137167 147 dbSNP
rs1179447656 154 dbSNP
rs755166695 155 dbSNP
rs976119024 157 dbSNP
rs1026396885 160 dbSNP
rs950712213 163 dbSNP
rs1214717354 169 dbSNP
rs781339152 175 dbSNP
rs980669935 178 dbSNP
rs1271536021 180 dbSNP
rs1033617798 184 dbSNP
rs909776942 187 dbSNP
rs753089394 188 dbSNP
rs375024785 190 dbSNP
rs1463329974 193 dbSNP
rs1309322079 194 dbSNP
rs57558840 202 dbSNP
rs974114094 203 dbSNP
rs1330360330 205 dbSNP
rs778355444 206 dbSNP
rs1396174779 211 dbSNP
rs1291400796 217 dbSNP
rs1457144272 219 dbSNP
rs1387053686 225 dbSNP
rs915713701 226 dbSNP
rs1438319465 228 dbSNP
rs1194607413 232 dbSNP
rs764103857 232 dbSNP
rs1455830505 234 dbSNP
rs1251572938 244 dbSNP
rs982868346 246 dbSNP
rs1486355696 247 dbSNP
rs949905362 250 dbSNP
rs1213757485 252 dbSNP
rs1351353893 257 dbSNP
rs1308488886 259 dbSNP
rs912718250 261 dbSNP
rs749744094 263 dbSNP
rs867910424 268 dbSNP
rs902944954 269 dbSNP
rs1299006886 275 dbSNP
rs542434676 277 dbSNP
rs115628248 279 dbSNP
rs770540681 282 dbSNP
rs936303512 287 dbSNP
rs1053460848 288 dbSNP
rs879211032 289 dbSNP
rs893357247 292 dbSNP
rs892166636 294 dbSNP
rs576494807 302 dbSNP
rs545363391 304 dbSNP
rs1376280802 306 dbSNP
rs1198608433 311 dbSNP
rs1429284993 322 dbSNP
rs1340058999 324 dbSNP
rs7854435 328 dbSNP
rs761984453 329 dbSNP
rs527977472 330 dbSNP
rs902016911 336 dbSNP
rs1240047538 337 dbSNP
rs777527976 342 dbSNP
rs997673023 344 dbSNP
rs1281192842 348 dbSNP
rs1284416163 350 dbSNP
rs1211500097 357 dbSNP
rs1349967736 358 dbSNP
rs541703034 362 dbSNP
rs1253964964 363 dbSNP
rs1353300712 366 dbSNP
rs139750292 367 dbSNP
rs530290818 381 dbSNP
rs1002054081 382 dbSNP
rs1397800700 384 dbSNP
rs566760422 396 dbSNP
rs73639841 399 dbSNP
rs200344245 400 dbSNP
rs368061891 403 dbSNP
rs1352431143 404 dbSNP
rs371620803 406 dbSNP
rs1303543763 414 dbSNP
rs756612843 415 dbSNP
rs779477815 418 dbSNP
rs1016665785 420 dbSNP
rs1462842653 423 dbSNP
rs374105107 424 dbSNP
rs1362538654 427 dbSNP
rs959425855 428 dbSNP
rs1294887676 431 dbSNP
rs1305998551 433 dbSNP
rs754689364 436 dbSNP
rs778539981 437 dbSNP
rs747736710 438 dbSNP
rs991813721 439 dbSNP
rs147915017 446 dbSNP
rs771880057 448 dbSNP
rs140044845 449 dbSNP
rs1416690948 451 dbSNP
rs949833304 454 dbSNP
rs1425041322 457 dbSNP
rs551354184 458 dbSNP
rs150037258 461 dbSNP
rs750152971 462 dbSNP
rs774728680 463 dbSNP
rs762086031 465 dbSNP
rs1429870526 467 dbSNP
rs145393386 471 dbSNP
rs750776434 472 dbSNP
rs1054238168 473 dbSNP
rs117442751 477 dbSNP
rs1316053446 479 dbSNP
rs143412065 480 dbSNP
rs1260007650 481 dbSNP
rs754273874 483 dbSNP
rs567238365 484 dbSNP
rs1271483498 485 dbSNP
rs778341971 487 dbSNP
rs752382017 488 dbSNP
rs1240855843 489 dbSNP
rs1462307770 490 dbSNP
rs777480829 493 dbSNP
rs371109443 494 dbSNP
rs1418874738 496 dbSNP
rs1442344296 498 dbSNP
rs536429516 499 dbSNP
rs781196289 500 dbSNP
rs755176631 507 dbSNP
rs1316205338 509 dbSNP
rs745742270 511 dbSNP
rs768880682 516 dbSNP
rs1047898804 518 dbSNP
rs774540660 522 dbSNP
rs151137458 528 dbSNP
rs772322958 531 dbSNP
rs140260278 535 dbSNP
rs1438390558 537 dbSNP
rs1281640003 539 dbSNP
rs773514965 540 dbSNP
rs144231415 541 dbSNP
rs145305702 546 dbSNP
rs577840890 549 dbSNP
rs137937636 554 dbSNP
rs759993378 555 dbSNP
rs764770254 558 dbSNP
rs1229716476 561 dbSNP
rs1353619421 562 dbSNP
rs199884471 563 dbSNP
rs776693164 564 dbSNP
rs1240301978 565 dbSNP
rs758048987 568 dbSNP
rs1233084659 569 dbSNP
rs763801083 570 dbSNP
rs1159018712 571 dbSNP
rs1156560555 573 dbSNP
rs201385986 575 dbSNP
rs1470208530 576 dbSNP
rs1446547583 577 dbSNP
rs757088485 580 dbSNP
rs1405352937 582 dbSNP
rs781086682 588 dbSNP
rs745840162 590 dbSNP
rs756097043 599 dbSNP
rs1351744887 604 dbSNP
rs1403868554 605 dbSNP
rs1390099709 607 dbSNP
rs142530282 610 dbSNP
rs1470440376 612 dbSNP
rs779191867 613 dbSNP
rs1278102396 614 dbSNP
rs748253953 616 dbSNP
rs576477121 618 dbSNP
rs1405767972 619 dbSNP
rs538794732 621 dbSNP
rs1320872951 622 dbSNP
rs747148906 624 dbSNP
rs72703236 625 dbSNP
rs776953319 626 dbSNP
rs1449583264 627 dbSNP
rs138608089 629 dbSNP
rs775052048 631 dbSNP
rs541457019 632 dbSNP
rs751249241 634 dbSNP
rs149317681 639 dbSNP
rs202082191 640 dbSNP
rs756821292 645 dbSNP
rs1225239229 646 dbSNP
rs199974594 647 dbSNP
rs146546123 651 dbSNP
rs994756718 655 dbSNP
rs756187071 656 dbSNP
rs955880067 657 dbSNP
rs1306569931 661 dbSNP
rs1367923533 662 dbSNP
rs1452982808 667 dbSNP
rs780144126 669 dbSNP
rs749118381 670 dbSNP
rs777672832 671 dbSNP
rs747291755 676 dbSNP
rs368560020 677 dbSNP
rs1026674641 678 dbSNP
rs1476808379 679 dbSNP
rs771122278 680 dbSNP
rs777041286 682 dbSNP
rs372851397 685 dbSNP
rs1221423734 689 dbSNP
rs770081495 693 dbSNP
rs1430188675 694 dbSNP
rs914360965 695 dbSNP
rs377059611 696 dbSNP
rs763320879 697 dbSNP
rs144648877 698 dbSNP
rs773704993 701 dbSNP
rs1488969301 702 dbSNP
rs371164792 704 dbSNP
rs1425730983 705 dbSNP
rs1302882621 707 dbSNP
rs750029316 708 dbSNP
rs563777846 711 dbSNP
rs766223609 713 dbSNP
rs1038715336 714 dbSNP
rs1174896929 724 dbSNP
rs1325411950 725 dbSNP
rs753842208 726 dbSNP
rs754836991 727 dbSNP
rs1359663475 729 dbSNP
rs777960815 731 dbSNP
rs1421462755 732 dbSNP
rs1429043596 733 dbSNP
rs757702014 735 dbSNP
rs140701396 743 dbSNP
rs16928356 744 dbSNP
rs746033739 745 dbSNP
rs770167252 746 dbSNP
rs1412512028 747 dbSNP
rs780242958 751 dbSNP
rs1424262601 752 dbSNP
rs749842545 757 dbSNP
rs147471809 759 dbSNP
rs1445410381 760 dbSNP
rs758428225 761 dbSNP
rs1163354125 762 dbSNP
rs1160200048 772 dbSNP
rs564642993 773 dbSNP
rs527258854 774 dbSNP
rs141302557 775 dbSNP
rs773977303 782 dbSNP
rs112701754 786 dbSNP
rs761412181 788 dbSNP
rs182646996 789 dbSNP
rs773017461 792 dbSNP
rs760360224 794 dbSNP
rs371344054 795 dbSNP
rs140004479 796 dbSNP
rs1208693338 797 dbSNP
rs142906421 799 dbSNP
rs376262081 806 dbSNP
rs199502026 809 dbSNP
rs781201005 810 dbSNP
rs750675828 815 dbSNP
rs151086071 817 dbSNP
rs1006425526 828 dbSNP
rs780517526 832 dbSNP
rs1461943479 844 dbSNP
rs749610895 851 dbSNP
rs779299775 852 dbSNP
rs748613087 853 dbSNP
rs1234008473 857 dbSNP
rs1381478071 858 dbSNP
rs1214897873 861 dbSNP
rs200683258 862 dbSNP
rs772814583 863 dbSNP
rs1358356736 866 dbSNP
rs113748895 867 dbSNP
rs770480487 868 dbSNP
rs1406258869 870 dbSNP
rs759258940 871 dbSNP
rs765028262 872 dbSNP
rs564464685 873 dbSNP
rs775428927 874 dbSNP
rs1475232006 877 dbSNP
rs762838054 880 dbSNP
rs944994027 881 dbSNP
rs1203340466 882 dbSNP
rs1483249607 888 dbSNP
rs767625504 890 dbSNP
rs750482012 891 dbSNP
rs139912017 902 dbSNP
rs756393184 903 dbSNP
rs1046103823 905 dbSNP
rs1263673490 906 dbSNP
rs752860436 907 dbSNP
rs754033173 911 dbSNP
rs755320432 917 dbSNP
rs1481714601 920 dbSNP
rs1178155730 922 dbSNP
rs779292473 926 dbSNP
rs371929280 927 dbSNP
rs375071878 928 dbSNP
rs777481724 930 dbSNP
rs746515910 931 dbSNP
rs1323565511 933 dbSNP
rs369891962 934 dbSNP
rs895237252 936 dbSNP
rs776165447 938 dbSNP
rs745479643 944 dbSNP
rs1462126006 945 dbSNP
rs769507886 946 dbSNP
rs202027041 951 dbSNP
rs762928577 953 dbSNP
rs3824419 955 dbSNP
rs760681935 958 dbSNP
rs72703237 959 dbSNP
rs1299214211 963 dbSNP
rs1309491782 969 dbSNP
rs765743642 970 dbSNP
rs753096035 976 dbSNP
rs1482307636 977 dbSNP
rs191456726 978 dbSNP
rs759044350 982 dbSNP
rs778431616 986 dbSNP
rs1031631742 988 dbSNP
rs375812912 990 dbSNP
rs756745369 996 dbSNP
rs1428587897 997 dbSNP
rs142308383 1001 dbSNP
rs150989542 1002 dbSNP
rs769466615 1004 dbSNP
rs779154249 1004 dbSNP
rs575076415 1006 dbSNP
rs749085023 1009 dbSNP
rs1364902520 1013 dbSNP
rs521525 1014 dbSNP
rs1438193635 1016 dbSNP
rs543802092 1020 dbSNP
rs774294154 1023 dbSNP
rs761770101 1025 dbSNP
rs536600958 1026 dbSNP
rs776746176 1027 dbSNP
rs1340255024 1028 dbSNP
rs140844621 1030 dbSNP
rs1292886057 1032 dbSNP
rs765548746 1033 dbSNP
rs922923589 1036 dbSNP
rs372603448 1037 dbSNP
rs1244323136 1044 dbSNP
rs763426492 1047 dbSNP
rs556954799 1048 dbSNP
rs1242291361 1049 dbSNP
rs149054600 1052 dbSNP
rs752041820 1053 dbSNP
rs757751363 1057 dbSNP
rs1369305585 1069 dbSNP
rs1163989362 1071 dbSNP
rs1384454829 1075 dbSNP
rs780616964 1078 dbSNP
rs143092642 1079 dbSNP
rs755790680 1080 dbSNP
rs1456937834 1081 dbSNP
rs779693419 1083 dbSNP
rs748889790 1085 dbSNP
rs1363301109 1086 dbSNP
rs377182125 1090 dbSNP
rs148245031 1091 dbSNP
rs140337454 1095 dbSNP
rs772030456 1096 dbSNP
rs41311430 1097 dbSNP
rs138207989 1098 dbSNP
rs775881772 1101 dbSNP
rs879139735 1103 dbSNP
rs113111105 1104 dbSNP
rs748491009 1105 dbSNP
rs764593509 1106 dbSNP
rs762285885 1109 dbSNP
rs370513290 1111 dbSNP
rs750836199 1112 dbSNP
rs1233739511 1113 dbSNP
rs147461872 1114 dbSNP
rs754599241 1115 dbSNP
rs778628435 1122 dbSNP
rs747967718 1123 dbSNP
rs758059465 1124 dbSNP
rs779378470 1126 dbSNP
rs777782068 1127 dbSNP
rs746875160 1129 dbSNP
rs770028960 1137 dbSNP
rs749570805 1139 dbSNP
rs768987240 1140 dbSNP
rs762245772 1141 dbSNP
rs1325134771 1145 dbSNP
rs767723063 1146 dbSNP
rs1011796825 1147 dbSNP
rs374194584 1151 dbSNP
rs1440293321 1152 dbSNP
rs1175612918 1153 dbSNP
rs1021446037 1154 dbSNP
rs776272323 1159 dbSNP
rs761138365 1160 dbSNP
rs1233175304 1161 dbSNP
rs1040299694 1162 dbSNP
rs765923425 1164 dbSNP
rs549760271 1172 dbSNP
rs545209212 1173 dbSNP
rs1201012794 1176 dbSNP
rs764944158 1177 dbSNP
rs752235879 1179 dbSNP
rs758237833 1180 dbSNP
rs777395007 1185 dbSNP
rs17641078 1186 dbSNP
rs1254091349 1190 dbSNP
rs1231983365 1193 dbSNP
rs149583126 1194 dbSNP
rs780340349 1198 dbSNP
rs150135765 1200 dbSNP
rs138967351 1202 dbSNP
rs1011034650 1203 dbSNP
rs774653993 1204 dbSNP
rs966902183 1206 dbSNP
rs566158765 1207 dbSNP
rs144310366 1209 dbSNP
rs773423016 1212 dbSNP
rs761228142 1215 dbSNP
rs1270995543 1216 dbSNP
rs777055521 1217 dbSNP
rs267602063 1222 dbSNP
rs1035290328 1227 dbSNP
rs942307099 1228 dbSNP
rs759059175 1230 dbSNP
rs1320190098 1232 dbSNP
rs764604885 1232 dbSNP
rs554993616 1236 dbSNP
rs757957177 1237 dbSNP
rs1390990741 1239 dbSNP
rs1429553863 1240 dbSNP
rs763998352 1242 dbSNP
rs1368017491 1243 dbSNP
rs1425487042 1247 dbSNP
rs772694365 1249 dbSNP
rs751391192 1253 dbSNP
rs1434037688 1257 dbSNP
rs781283086 1257 dbSNP
rs1328908859 1260 dbSNP
rs376933173 1262 dbSNP
rs531076387 1263 dbSNP
rs755113123 1264 dbSNP
rs916734285 1265 dbSNP
rs1196426488 1268 dbSNP
rs778824742 1273 dbSNP
rs373556245 1274 dbSNP
rs772166978 1276 dbSNP
rs568323734 1279 dbSNP
rs1265160639 1280 dbSNP
rs1243285536 1282 dbSNP
rs773069864 1283 dbSNP
rs368056380 1284 dbSNP
rs141434125 1288 dbSNP
rs1313828043 1289 dbSNP
rs769386836 1294 dbSNP
rs774840680 1296 dbSNP
rs371521290 1298 dbSNP
rs763653228 1306 dbSNP
rs751193192 1310 dbSNP
rs1163237745 1312 dbSNP
rs761716276 1313 dbSNP
rs767378535 1317 dbSNP
rs1320578263 1322 dbSNP
rs537457583 1323 dbSNP
rs779103375 1326 dbSNP
rs752714481 1327 dbSNP
rs1316711428 1328 dbSNP
rs758436447 1329 dbSNP
rs1448026805 1334 dbSNP
rs376847583 1340 dbSNP
rs1263648069 1341 dbSNP
rs41298155 1343 dbSNP
rs771318177 1344 dbSNP
rs1268778618 1346 dbSNP
rs142405639 1347 dbSNP
rs1414116987 1349 dbSNP
rs1186970700 1350 dbSNP
rs1459333542 1351 dbSNP
rs746436667 1354 dbSNP
rs770188466 1355 dbSNP
rs775136507 1356 dbSNP
rs762377818 1357 dbSNP
rs146385338 1358 dbSNP
rs1446814343 1359 dbSNP
rs774172074 1359 dbSNP
rs761523956 1360 dbSNP
rs767466352 1361 dbSNP
rs139766473 1364 dbSNP
rs760728698 1366 dbSNP
rs1436867496 1367 dbSNP
rs1289901021 1368 dbSNP
rs766231319 1371 dbSNP
rs1395267343 1372 dbSNP
rs753750991 1375 dbSNP
rs1337469927 1376 dbSNP
rs758427884 1378 dbSNP
rs764120857 1379 dbSNP
rs751821481 1382 dbSNP
rs369760437 1383 dbSNP
rs781594613 1384 dbSNP
rs1040242825 1387 dbSNP
rs746218872 1391 dbSNP
rs201072097 1392 dbSNP
rs767572237 1393 dbSNP
rs780441362 1394 dbSNP
rs900438112 1398 dbSNP
rs932633102 1403 dbSNP
rs749756591 1405 dbSNP
rs144543184 1406 dbSNP
rs773972613 1407 dbSNP
rs747858040 1408 dbSNP
rs1471342698 1411 dbSNP
rs137867694 1412 dbSNP
rs1359395368 1415 dbSNP
rs772853895 1417 dbSNP
rs200441986 1421 dbSNP
rs146415672 1422 dbSNP
rs1410186556 1423 dbSNP
rs776463369 1425 dbSNP
rs1307381213 1428 dbSNP
rs4741029 1431 dbSNP
rs1478589200 1433 dbSNP
rs764208861 1434 dbSNP
rs13296834 1439 dbSNP
rs13297428 1440 dbSNP
rs751627154 1444 dbSNP
rs757543051 1447 dbSNP
rs1232893517 1448 dbSNP
rs767735578 1450 dbSNP
rs1484265507 1452 dbSNP
rs750605221 1454 dbSNP
rs1251757841 1462 dbSNP
rs756460105 1468 dbSNP
rs1200969390 1469 dbSNP
rs780429301 1473 dbSNP
rs1021078808 1474 dbSNP
rs749806998 1476 dbSNP
rs371831083 1477 dbSNP
rs755526203 1479 dbSNP
rs778629637 1480 dbSNP
rs556197778 1483 dbSNP
rs771650790 1484 dbSNP
rs764328228 1486 dbSNP
rs770673047 1487 dbSNP
rs772480908 1487 dbSNP
rs773732202 1489 dbSNP
rs1330594430 1493 dbSNP
rs776466458 1494 dbSNP
rs928010438 1497 dbSNP
rs1298890724 1501 dbSNP
rs202045027 1504 dbSNP
rs759527693 1506 dbSNP
rs765155889 1507 dbSNP
rs1362402492 1513 dbSNP
rs775343120 1514 dbSNP
rs761898433 1518 dbSNP
rs1333029120 1520 dbSNP
rs72703239 1521 dbSNP
rs374340988 1524 dbSNP
rs760926881 1530 dbSNP
rs766709953 1532 dbSNP
rs754221398 1533 dbSNP
rs368404730 1534 dbSNP
rs1278316105 1536 dbSNP
rs747488837 1537 dbSNP
rs779575171 1544 dbSNP
rs9140 1545 dbSNP
rs1261615418 1546 dbSNP
rs758011765 1548 dbSNP
rs777304682 1549 dbSNP
rs1349191242 1550 dbSNP
rs543418900 1551 dbSNP
rs563421536 1552 dbSNP
rs1281252067 1553 dbSNP
rs41265270 1554 dbSNP
rs149488494 1558 dbSNP
rs921810793 1562 dbSNP
rs931888410 1562 dbSNP
rs995944842 1569 dbSNP
rs1338575195 1574 dbSNP
rs4741030 1578 dbSNP
rs1299749577 1581 dbSNP
rs371495993 1586 dbSNP
rs890313791 1587 dbSNP
rs1004569305 1588 dbSNP
rs1015124645 1593 dbSNP
rs963067437 1596 dbSNP
rs1412349648 1610 dbSNP
rs1373806937 1611 dbSNP
rs902608185 1614 dbSNP
rs1281647414 1618 dbSNP
rs994917649 1626 dbSNP
rs1186440322 1627 dbSNP
rs1473415313 1639 dbSNP
rs1239519882 1645 dbSNP
rs1325884208 1647 dbSNP
rs1023849312 1651 dbSNP
rs1461008718 1655 dbSNP
rs1272357443 1657 dbSNP
rs1160479301 1663 dbSNP
rs1003674743 1664 dbSNP
rs1295034025 1669 dbSNP
rs1056643564 1670 dbSNP
rs1207247417 1675 dbSNP
rs969648107 1677 dbSNP
rs1233907164 1678 dbSNP
rs895352897 1680 dbSNP
rs548656327 1686 dbSNP
rs143937759 1687 dbSNP
rs1331591404 1689 dbSNP
rs951780013 1690 dbSNP
rs1352195338 1695 dbSNP
rs928098878 1696 dbSNP
rs1406412486 1700 dbSNP
rs1176615422 1701 dbSNP
rs1014590830 1702 dbSNP
rs1444377504 1704 dbSNP
rs1407660453 1705 dbSNP
rs369790915 1708 dbSNP
rs1239236225 1710 dbSNP
rs965768637 1711 dbSNP
rs74491476 1713 dbSNP
rs1456618626 1714 dbSNP
rs1250779469 1715 dbSNP
rs988234484 1721 dbSNP
rs72703240 1724 dbSNP
rs193099404 1727 dbSNP
rs946698444 1728 dbSNP
rs1040126326 1731 dbSNP
rs1243758552 1732 dbSNP
rs953265783 1743 dbSNP
rs1309719583 1744 dbSNP
rs990454824 1745 dbSNP
rs1393169166 1748 dbSNP
rs921820761 1751 dbSNP
rs773116483 1752 dbSNP
rs10959119 1755 dbSNP
rs746703928 1758 dbSNP
rs1337545649 1759 dbSNP
rs1351168825 1760 dbSNP
rs10959120 1767 dbSNP
rs1004708607 1770 dbSNP
rs923978468 1776 dbSNP
rs1036079369 1777 dbSNP
rs939410135 1779 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAUAC-ACGACGAu 5'
                   | | | ||||||| 
Target 5' ---------UCAAGCUGCUGCUc 3'
1 - 14
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000259622.6 | 3UTR | ucaagcugcugcucug
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000259622.6 | 3UTR | ucaagcugcugcucug
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.298 1.3e-3 -0.254 5.4e-3 100 Click to see details
GSE19783 ER- ER- breast cancer -0.199 3.9e-2 -0.210 3.2e-2 79 Click to see details
GSE21032 Prostate cancer -0.18 5.2e-2 -0.122 1.4e-1 83 Click to see details
GSE17306 Multiple myeloma -0.234 5.3e-2 -0.267 3.2e-2 49 Click to see details
GSE38226 Liver fibrosis -0.353 5.8e-2 -0.326 7.5e-2 21 Click to see details
GSE19350 CNS germ cell tumors 0.407 9.5e-2 0.650 1.1e-2 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.185 2.2e-1 -0.006 4.9e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.135 2.3e-1 0.085 3.2e-1 32 Click to see details
GSE21849 B cell lymphoma -0.116 2.7e-1 -0.014 4.7e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.126 3.4e-1 0.374 1.0e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.078 3.6e-1 -0.171 2.1e-1 25 Click to see details
GSE28544 Breast cancer -0.07 3.7e-1 -0.371 3.7e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.061 3.9e-1 -0.165 2.2e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.026 4.0e-1 0.117 1.4e-1 90 Click to see details
GSE27834 Pluripotent stem cells -0.056 4.2e-1 -0.015 4.8e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.02 4.4e-1 0.042 3.7e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.025 4.5e-1 0.025 4.5e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.027 4.6e-1 -0.134 2.9e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.027 4.6e-1 -0.134 2.9e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.228 0.02 0.238 0.01 84 Click to see details
HNSC -0.308 0.02 -0.325 0.02 42 Click to see details
LIHC -0.248 0.04 -0.096 0.26 49 Click to see details
CESC 0.976 0.07 1.000 0.5 3 Click to see details
KIRC -0.174 0.08 -0.123 0.16 68 Click to see details
STAD -0.165 0.18 -0.173 0.17 32 Click to see details
CHOL 0.324 0.2 0.163 0.34 9 Click to see details
PRAD -0.122 0.2 -0.148 0.15 50 Click to see details
PAAD -0.542 0.23 -0.200 0.4 4 Click to see details
ESCA -0.188 0.29 -0.082 0.41 11 Click to see details
LUAD 0.122 0.35 0.028 0.47 12 Click to see details
THCA -0.043 0.37 -0.016 0.45 59 Click to see details
KICH 0.065 0.38 -0.140 0.25 25 Click to see details
COAD 0.099 0.41 0.310 0.23 8 Click to see details
UCEC -0.057 0.41 -0.218 0.18 19 Click to see details
BLCA -0.054 0.42 0.096 0.35 18 Click to see details
LUSC -0.016 0.46 -0.052 0.38 38 Click to see details
KIRP -0.006 0.49 0.098 0.3 32 Click to see details
PCPG 1 0.5 1.000 0.5 3 Click to see details
PCPG 1 0.5 1.000 0.5 3 Click to see details
PCPG 1 0.5 1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 ki