miRTarBase - #MIRT449190 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LUC7L3   
Synonyms CRA, CREAP-1, CROP, LUC7A, OA48-18, hLuc7A
Description LUC7 like 3 pre-mRNA splicing factor
Transcript NM_016424   
Other Transcripts NM_006107   
Expression
Putative miRNA Targets on LUC7L3
3'UTR of LUC7L3
(miRNA target sites are highlighted)
>LUC7L3|NM_016424|3'UTR
   1 AACTGATCTGATAAGACCTCAGATCAGACAGAGGTAAGTGTATTGTTTCTCACTTTGATTAGGGCTTTTTGTTACTGTTT
  81 GACAGTGCAGCGTAAGTATGCACAGATGAAGATGGAACTAAGCCGAGTAAGAAGACATACAAAAGCCTCTTCTGAAGGAA
 161 AAGACAGTGTAGTCCTGCAAAACATTTTGAGGTACATTGTTTTGTCTCAGCTATTTTGTAGCAGACTCGTGCCCCCATTA
 241 GTGTGCCTCTTTGGAAATTATCGCCCACATTTGTAATATAGTCGCCATTGAAAAGTTAATTATCCTTTTTTTAGGGATTT
 321 TGATGTCATTTCTTTTTTTTTTTTAATAAAAAGGTTGAACTGTTTTTTTTTTTCTTTTTGGTATTAAGTCCATCTTGTGT
 401 TGGTACATTGGCAGAGACATATGCTTTAAAAACTTAAATATTTCGGAGGCACATGTTGGACTACTTTGTTTTAATTAAAC
 481 TGCTAGTATTTCTTTGTCAAGGATGTTTCTAGTTTTTTGCTTTATTGCCTTGCATTCTAATGCAGTTTGTTCTGTAACTC
 561 GAGAGCCAGTAGCATTGGATTGATGGAAGTGTAGGGTTTATGAATTATTGCAGCTGACTACCATACCTCACACAGCGTTG
 641 GTGTTGTGAGCGGCCCATGAAAAGCCAAATTAAAAATCAAGGATTCAGTCAAACTAAGCAGGTACTCATGCCAGGTACTC
 721 CTTTCTCTACCCACATCCATGTTTGAATGCTATTGCCTGTGATCTTTACGCTTAACTGTTGTGTATCTTTTTTGTTCTTT
 801 ACAAGAAGTGCAGAGGGGTTTTTTGTGTATTGCGTGAAAACTTATAAAACAAATGTTAACAGAATGGAATTTTTTTTCAA
 881 CTGTATGTAGGGCTGCAGTGGTGGCCAGAATTAGATATCTTTAAAGAATTTTAAATACAATAAACACTTCATATTATTCG
 961 CCTTGTTACACTCAATGCAATTCTCAAGTCTATAAGAGGTATGTGCTTAATATTTCCTACTGTGTAGGAGAATTTGCAGT
1041 CAGCCATAGGTATGTAGGAATAGTCACTCACTGGCTGATACATTTAAAGCAGCAGTGTGAATAGCAAGGACAGACACCTT
1121 CAATTTGTGAAATCAAAGAACTGATGCACTATATAGAACGAATTTGGGTTTTTAAAGAAATATTAAAAGTTAGGTACTGT
1201 AAGTGTTCTTAAAACCTGTAAACTTCATTCTGTGGGCTAGTGGTGTGGGACAAAATATTCCTAATGAAAGGAAGTACCAA
1281 TTAGTTGATTTGTTGGTGGCATTCCCCTTTTGGGAAAGCAATGTAAGGTTATGTCTGTGTATGTCATTCACACTTAGGCA
1361 AGCATACACAGGCACATGGCTTTAAGAACCACACTGATGCCTTGATAATTAAAAAGAATACAAGCATTCCATGTACACAT
1441 GTTAATTAGCAGTTAGTGACTGGGCCAACACTTTCTCATAAAAATTGGCCTTTTACATGTTGTCTAATTATCATTTTTCC
1521 CCAAATTTTGCGTTGTAGGACTACTGTTCGAAGATTTTTGGAAGAATACTGAGAACGGCATAAAGTGAAGATCGACATTT
1601 AAAAAATGAGGTGAAAGAAAGCTATAGTGGCATAGAAAAAGTATAAAGCTCAGTTAGTTTTTTTATTATTATTATTATTA
1681 AAAGTTAATTCAGGACTGATGTGACCTACCAGATTTCAGAACATGTGTTAATAGTATATATGCCACTGAAAACTTAGGTC
1761 CTGTATCATACTTTTTTCTTTAAGACTTTTTAAGAAATATTACTTAAACATGTGGCTTGCTCAGTGTTTAATTGCAAGTT
1841 TTCAATCTTGGACTTTGAAAACAGGATTAAACGTTAGTATTCGTGTGAATCAGACTAAGTGGGATTTCATTTTTACAACT
1921 CTGCTCTACTTAGCCTTTGGATTTAGAAGTAAAAATAAAGTATCTCTGACTTTCTGTTACAAAGTTGATTGTCTCTGTCA
2001 TTGAAAAGTTTTAGTATTAATCTTTTTCTAATAAAGTTATTGACTCTGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  ||||| ||| ||| 
Target 5' gtttatgaATTAT-TGCAGCTg 3'
596 - 616 125.00 -7.80
2
miRNA  3' guGUUU-GGUAAUACACGACGAu 5'
            :||: ||||  ||||:|| | 
Target 5' atTAAGTCCATCTTGTGTTGGTa 3'
383 - 405 120.00 -14.50
3
miRNA  3' guGUUUGGUAA-UACACGACGAu 5'
            ||| : :|| || ||:|| | 
Target 5' acCAATTAGTTGATTTGTTGGTg 3'
1276 - 1298 112.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30118004 16 COSMIC
COSM3192958 71 COSMIC
COSM8185310 76 COSMIC
COSN23015180 88 COSMIC
COSN13731626 118 COSMIC
COSN19703946 172 COSMIC
COSN32070590 228 COSMIC
COSN16383396 230 COSMIC
COSN31975327 263 COSMIC
COSN20072269 313 COSMIC
COSN20064180 374 COSMIC
COSN28863721 374 COSMIC
COSN19661625 375 COSMIC
COSN31519765 394 COSMIC
COSN30635131 445 COSMIC
COSN26465608 481 COSMIC
COSN23015181 499 COSMIC
COSN24385807 500 COSMIC
COSN16129499 510 COSMIC
COSN30583767 519 COSMIC
COSN26585568 555 COSMIC
COSN21669339 585 COSMIC
COSN19732486 587 COSMIC
COSN30734672 631 COSMIC
COSN22539372 660 COSMIC
COSN24385808 674 COSMIC
COSN24405679 706 COSMIC
COSN30602908 723 COSMIC
COSN24389458 764 COSMIC
COSN25998225 788 COSMIC
COSN31483194 835 COSMIC
COSN16720078 976 COSMIC
COSN22406809 986 COSMIC
COSN15819287 993 COSMIC
COSN31543558 1018 COSMIC
COSN31607928 1031 COSMIC
COSN216863 1055 COSMIC
COSN6105638 1059 COSMIC
COSN31486435 1565 COSMIC
COSN31513214 1577 COSMIC
COSN20049305 1579 COSMIC
COSN30672146 1663 COSMIC
COSN31563802 1681 COSMIC
COSN1198273 1752 COSMIC
COSN31591566 1778 COSMIC
COSN23486358 1880 COSMIC
COSN31538609 1884 COSMIC
COSN1721266 2039 COSMIC
COSN31528899 2495 COSMIC
COSN21650393 2636 COSMIC
COSN21929176 2638 COSMIC
COSN16365114 2647 COSMIC
COSN26452416 2690 COSMIC
COSN6105639 2712 COSMIC
COSN30176830 2773 COSMIC
COSN14823603 3135 COSMIC
COSN24961752 3459 COSMIC
COSN7437565 3716 COSMIC
COSN17248479 3787 COSMIC
COSN25674701 3995 COSMIC
COSN15319142 4154 COSMIC
COSN25268334 4267 COSMIC
COSN27195007 4537 COSMIC
COSN24562115 4999 COSMIC
COSN7437566 5032 COSMIC
COSN26157603 5183 COSMIC
COSN5417354 5303 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764103161 12 dbSNP
rs774563324 12 dbSNP
rs1336232752 24 dbSNP
rs373603231 28 dbSNP
rs776753780 28 dbSNP
rs1437287841 29 dbSNP
rs1034233703 37 dbSNP
rs959512182 41 dbSNP
rs1234456573 42 dbSNP
rs1368038951 50 dbSNP
rs1276939061 52 dbSNP
rs1346742971 53 dbSNP
rs759890269 67 dbSNP
rs752911161 85 dbSNP
rs756445766 87 dbSNP
rs1167435927 91 dbSNP
rs945393643 92 dbSNP
rs1395522474 93 dbSNP
rs761877367 93 dbSNP
rs575434186 102 dbSNP
rs1246151945 121 dbSNP
rs117020724 123 dbSNP
rs754408701 125 dbSNP
rs757747395 126 dbSNP
rs1477203276 128 dbSNP
rs1042923 130 dbSNP
rs924580611 141 dbSNP
rs779588725 143 dbSNP
rs1412903991 148 dbSNP
rs991847364 170 dbSNP
rs1424970460 189 dbSNP
rs1256231177 205 dbSNP
rs746490432 211 dbSNP
rs1183009042 223 dbSNP
rs551149520 226 dbSNP
rs1387832401 227 dbSNP
rs770247967 229 dbSNP
rs187921221 230 dbSNP
rs1404647709 232 dbSNP
rs1282255528 238 dbSNP
rs1024623182 247 dbSNP
rs754470759 248 dbSNP
rs966347751 250 dbSNP
rs977863940 257 dbSNP
rs1229741890 258 dbSNP
rs1383913522 262 dbSNP
rs1258410277 263 dbSNP
rs899626434 264 dbSNP
rs957598414 265 dbSNP
rs780731628 266 dbSNP
rs1291860874 269 dbSNP
rs1489803053 270 dbSNP
rs1198364342 279 dbSNP
rs1252846781 280 dbSNP
rs1473676197 281 dbSNP
rs1410156092 282 dbSNP
rs932412562 284 dbSNP
rs747779150 285 dbSNP
rs1459106116 286 dbSNP
rs1368586234 288 dbSNP
rs192488446 290 dbSNP
rs1003860221 293 dbSNP
rs1467813866 300 dbSNP
rs547039581 305 dbSNP
rs562378278 306 dbSNP
rs773057350 306 dbSNP
rs940013606 307 dbSNP
rs1207646681 323 dbSNP
rs1184802989 324 dbSNP
rs1389133071 325 dbSNP
rs1424463422 326 dbSNP
rs1314610002 328 dbSNP
rs1251540599 329 dbSNP
rs1322617842 329 dbSNP
rs1244110032 333 dbSNP
rs1319882880 333 dbSNP
rs1448567316 333 dbSNP
rs532977346 333 dbSNP
rs55943930 333 dbSNP
rs1037113227 345 dbSNP
rs1228788421 346 dbSNP
rs1349704257 347 dbSNP
rs753821623 347 dbSNP
rs566853280 354 dbSNP
rs1388189930 356 dbSNP
rs1244266600 359 dbSNP
rs1263768936 360 dbSNP
rs1292454322 361 dbSNP
rs898584297 362 dbSNP
rs11385262 363 dbSNP
rs1180069660 363 dbSNP
rs1268261098 363 dbSNP
rs1435164641 363 dbSNP
rs370019899 363 dbSNP
rs398031051 363 dbSNP
rs995356179 363 dbSNP
rs1015661041 364 dbSNP
rs1355878585 374 dbSNP
rs202178295 375 dbSNP
rs1328347502 379 dbSNP
rs1263148754 381 dbSNP
rs1055332548 382 dbSNP
rs1331340536 383 dbSNP
rs1487590138 384 dbSNP
rs898758662 396 dbSNP
rs535837459 399 dbSNP
rs1300085120 408 dbSNP
rs1190585701 411 dbSNP
rs1390278404 413 dbSNP
rs1320614336 416 dbSNP
rs895081422 418 dbSNP
rs1013944861 419 dbSNP
rs775889149 423 dbSNP
rs1033853807 424 dbSNP
rs959493505 445 dbSNP
rs143971230 446 dbSNP
rs1025102847 447 dbSNP
rs1032095294 498 dbSNP
rs1189250756 501 dbSNP
rs754820413 503 dbSNP
rs1464402774 515 dbSNP
rs1281983566 544 dbSNP
rs1366228361 545 dbSNP
rs769164955 561 dbSNP
rs957991627 576 dbSNP
rs966771501 581 dbSNP
rs1255190254 592 dbSNP
rs1308986789 596 dbSNP
rs1350781335 607 dbSNP
rs1411264161 608 dbSNP
rs749300225 611 dbSNP
rs1487051317 616 dbSNP
rs1334670092 627 dbSNP
rs978131959 638 dbSNP
rs569552945 653 dbSNP
rs1285911170 655 dbSNP
rs1297721393 665 dbSNP
rs1357136532 677 dbSNP
rs1221516467 679 dbSNP
rs1275053840 681 dbSNP
rs1484190983 689 dbSNP
rs1194291619 691 dbSNP
rs750246576 693 dbSNP
rs1424485689 696 dbSNP
rs1189648835 697 dbSNP
rs1365102076 708 dbSNP
rs184535408 719 dbSNP
rs1416637837 723 dbSNP
rs1403411284 727 dbSNP
rs777480332 728 dbSNP
rs1398062295 740 dbSNP
rs558508734 751 dbSNP
rs1433121261 753 dbSNP
rs1304372035 757 dbSNP
rs1379548536 758 dbSNP
rs1169309938 761 dbSNP
rs1448881238 762 dbSNP
rs935936952 765 dbSNP
rs990440368 770 dbSNP
rs1310902534 773 dbSNP
rs1255272206 778 dbSNP
rs546024412 788 dbSNP
rs1343893719 798 dbSNP
rs1274828117 801 dbSNP
rs747917308 804 dbSNP
rs578096789 819 dbSNP
rs534137256 826 dbSNP
rs940064630 828 dbSNP
rs1036954698 834 dbSNP
rs372178620 835 dbSNP
rs761560710 842 dbSNP
rs1050869456 846 dbSNP
rs1429344719 850 dbSNP
rs890902585 851 dbSNP
rs1212787001 852 dbSNP
rs1256976503 854 dbSNP
rs1417508505 856 dbSNP
rs939735141 862 dbSNP
rs1165054195 866 dbSNP
rs1055197061 870 dbSNP
rs895000462 870 dbSNP
rs553784594 872 dbSNP
rs1483879365 881 dbSNP
rs1036716200 884 dbSNP
rs898114286 890 dbSNP
rs1204080349 903 dbSNP
rs1435699557 910 dbSNP
rs1180447935 928 dbSNP
rs190036537 937 dbSNP
rs999197399 938 dbSNP
rs1357681031 941 dbSNP
rs1293154768 945 dbSNP
rs1031979571 955 dbSNP
rs957827817 960 dbSNP
rs542206430 965 dbSNP
rs1034380909 966 dbSNP
rs1308985083 968 dbSNP
rs139907747 976 dbSNP
rs575912735 981 dbSNP
rs954392777 985 dbSNP
rs1013785027 986 dbSNP
rs193046592 993 dbSNP
rs1417798609 999 dbSNP
rs966803911 1000 dbSNP
rs1405957786 1006 dbSNP
rs1178079215 1011 dbSNP
rs1389938016 1022 dbSNP
rs1162774257 1023 dbSNP
rs1359644814 1037 dbSNP
rs999980411 1038 dbSNP
rs1181133885 1046 dbSNP
rs565051300 1059 dbSNP
rs1248030328 1064 dbSNP
rs772917254 1067 dbSNP
rs79829173 1072 dbSNP
rs1270724518 1080 dbSNP
rs527441600 1082 dbSNP
rs1289396419 1083 dbSNP
rs1223536111 1098 dbSNP
rs1371459084 1100 dbSNP
rs919897681 1111 dbSNP
rs1437436908 1115 dbSNP
rs533953292 1117 dbSNP
rs921206258 1119 dbSNP
rs931317167 1123 dbSNP
rs3833148 1124 dbSNP
rs991344958 1126 dbSNP
rs1398682819 1135 dbSNP
rs1447712699 1141 dbSNP
rs1394207830 1144 dbSNP
rs1477474863 1150 dbSNP
rs776424685 1152 dbSNP
rs778126864 1153 dbSNP
rs540913419 1154 dbSNP
rs1466663713 1155 dbSNP
rs986606348 1160 dbSNP
rs912369513 1161 dbSNP
rs879388929 1165 dbSNP
rs1037153286 1166 dbSNP
rs1220071254 1180 dbSNP
rs919677366 1180 dbSNP
rs931010963 1184 dbSNP
rs760641731 1186 dbSNP
rs3833147 1188 dbSNP
rs1437289241 1197 dbSNP
rs143401662 1198 dbSNP
rs1013822613 1199 dbSNP
rs1046604859 1200 dbSNP
rs1458815580 1205 dbSNP
rs1198819643 1206 dbSNP
rs1237051996 1209 dbSNP
rs893493734 1216 dbSNP
rs766268229 1217 dbSNP
rs1192411882 1218 dbSNP
rs1433737965 1239 dbSNP
rs902650807 1246 dbSNP
rs999692723 1252 dbSNP
rs1392836518 1254 dbSNP
rs528595523 1259 dbSNP
rs747142649 1275 dbSNP
rs1174000145 1281 dbSNP
rs890173817 1289 dbSNP
rs1466358092 1294 dbSNP
rs1485158870 1297 dbSNP
rs958131724 1298 dbSNP
rs996611525 1301 dbSNP
rs1347440598 1308 dbSNP
rs529400067 1312 dbSNP
rs1028919021 1314 dbSNP
rs1398338124 1316 dbSNP
rs953979989 1324 dbSNP
rs1438762403 1327 dbSNP
rs1019712566 1328 dbSNP
rs986639290 1342 dbSNP
rs912402178 1344 dbSNP
rs961538545 1348 dbSNP
rs1413867273 1353 dbSNP
rs1373252893 1355 dbSNP
rs972589054 1360 dbSNP
rs1217908248 1362 dbSNP
rs1280500862 1366 dbSNP
rs376736935 1368 dbSNP
rs1218890931 1370 dbSNP
rs1027230868 1375 dbSNP
rs952860999 1377 dbSNP
rs1416510247 1379 dbSNP
rs1435708391 1385 dbSNP
rs1189118341 1395 dbSNP
rs1223219079 1413 dbSNP
rs1246716971 1424 dbSNP
rs1207611504 1425 dbSNP
rs990796029 1427 dbSNP
rs1250852556 1432 dbSNP
rs1488125763 1434 dbSNP
rs1225282934 1438 dbSNP
rs1323437084 1439 dbSNP
rs916657942 1439 dbSNP
rs931065447 1443 dbSNP
rs1425547881 1451 dbSNP
rs1054814485 1458 dbSNP
rs1478048851 1460 dbSNP
rs949418336 1467 dbSNP
rs771045452 1478 dbSNP
rs1417708446 1486 dbSNP
rs949625198 1487 dbSNP
rs1046717181 1489 dbSNP
rs1367278262 1490 dbSNP
rs1166376467 1498 dbSNP
rs770974392 1498 dbSNP
rs546654140 1500 dbSNP
rs1444541010 1501 dbSNP
rs1169689372 1505 dbSNP
rs1372794071 1507 dbSNP
rs1184725604 1514 dbSNP
rs774387282 1519 dbSNP
rs1296111294 1523 dbSNP
rs1419930816 1531 dbSNP
rs1395261846 1532 dbSNP
rs76666103 1533 dbSNP
rs893722980 1535 dbSNP
rs1190193452 1542 dbSNP
rs1266103845 1545 dbSNP
rs753848156 1546 dbSNP
rs1380553337 1550 dbSNP
rs767573118 1551 dbSNP
rs1298147835 1557 dbSNP
rs775577006 1562 dbSNP
rs1224892731 1565 dbSNP
rs1269804629 1567 dbSNP
rs569246430 1569 dbSNP
rs1228732861 1572 dbSNP
rs1483684365 1573 dbSNP
rs1202300678 1577 dbSNP
rs764422903 1579 dbSNP
rs1050061546 1583 dbSNP
rs754179594 1584 dbSNP
rs1189783840 1594 dbSNP
rs762346862 1595 dbSNP
rs1157204595 1596 dbSNP
rs1427133143 1598 dbSNP
rs1170142666 1601 dbSNP
rs765765553 1612 dbSNP
rs890217353 1613 dbSNP
rs1304132793 1616 dbSNP
rs1161830476 1619 dbSNP
rs1454578143 1620 dbSNP
rs893897913 1623 dbSNP
rs1363568950 1625 dbSNP
rs996190845 1641 dbSNP
rs1289999857 1644 dbSNP
rs1435093691 1648 dbSNP
rs1253755374 1649 dbSNP
rs1802391 1650 dbSNP
rs1467104937 1651 dbSNP
rs1219582764 1652 dbSNP
rs1205636971 1656 dbSNP
rs1008577858 1658 dbSNP
rs1235023986 1658 dbSNP
rs1258710711 1658 dbSNP
rs1349775805 1658 dbSNP
rs1383263881 1663 dbSNP
rs184854811 1663 dbSNP
rs529275655 1663 dbSNP
rs747600889 1663 dbSNP
rs750852270 1663 dbSNP
rs1384749377 1666 dbSNP
rs1157167672 1668 dbSNP
rs1467792926 1670 dbSNP
rs1265309106 1673 dbSNP
rs1488568948 1677 dbSNP
rs759205841 1692 dbSNP
rs1008844283 1694 dbSNP
rs1027651527 1716 dbSNP
rs1193866133 1718 dbSNP
rs1446337377 1719 dbSNP
rs765033618 1722 dbSNP
rs1259428066 1731 dbSNP
rs1240074435 1737 dbSNP
rs1473904027 1741 dbSNP
rs1485798355 1759 dbSNP
rs552062226 1764 dbSNP
rs1279091884 1777 dbSNP
rs1413201561 1779 dbSNP
rs9398 1779 dbSNP
rs1343761374 1782 dbSNP
rs1270239799 1788 dbSNP
rs1422861362 1790 dbSNP
rs1326303282 1798 dbSNP
rs952957431 1801 dbSNP
rs1398082422 1809 dbSNP
rs1361816477 1815 dbSNP
rs961299311 1816 dbSNP
rs1010677259 1820 dbSNP
rs1802389 1825 dbSNP
rs973005930 1830 dbSNP
rs571848503 1846 dbSNP
rs189752694 1848 dbSNP
rs952572886 1852 dbSNP
rs970696897 1854 dbSNP
rs982223705 1865 dbSNP
rs570273222 1873 dbSNP
rs554112194 1874 dbSNP
rs567340059 1883 dbSNP
rs535973060 1884 dbSNP
rs956567070 1886 dbSNP
rs916326248 1888 dbSNP
rs1256532238 1900 dbSNP
rs1208328739 1918 dbSNP
rs989290940 1919 dbSNP
rs118119048 1920 dbSNP
rs1802392 1925 dbSNP
rs1339308590 1926 dbSNP
rs575600900 1927 dbSNP
rs181005807 1930 dbSNP
rs1054379134 1935 dbSNP
rs1802390 1942 dbSNP
rs769406079 1943 dbSNP
rs893933006 1957 dbSNP
rs1413196784 1963 dbSNP
rs185274202 1963 dbSNP
rs1215732384 1965 dbSNP
rs1281910205 1969 dbSNP
rs3182457 1981 dbSNP
rs1329628362 1990 dbSNP
rs1443887287 1998 dbSNP
rs558809657 2015 dbSNP
rs757529102 2020 dbSNP
rs72839281 2023 dbSNP
rs1164998910 2032 dbSNP
rs369633679 2041 dbSNP
rs944368349 2044 dbSNP
rs1416957439 2048 dbSNP
rs572289174 2050 dbSNP
rs1473384495 2054 dbSNP
rs1443010310 2059 dbSNP
rs1180482263 2074 dbSNP
rs1435642156 2077 dbSNP
rs541201293 2082 dbSNP
rs1216154726 2085 dbSNP
rs756246590 2091 dbSNP
rs1272980831 2098 dbSNP
rs1008875532 2100 dbSNP
rs1014913029 2102 dbSNP
rs1419651295 2103 dbSNP
rs189632270 2107 dbSNP
rs1327980714 2112 dbSNP
rs763183405 2120 dbSNP
rs1404943203 2125 dbSNP
rs1415451968 2127 dbSNP
rs994060230 2131 dbSNP
rs1162529158 2144 dbSNP
rs1458563896 2151 dbSNP
rs994751295 2153 dbSNP
rs1027242643 2154 dbSNP
rs952611264 2162 dbSNP
rs1404984482 2163 dbSNP
rs990650828 2167 dbSNP
rs1193675392 2171 dbSNP
rs1023414626 2173 dbSNP
rs1252856512 2176 dbSNP
rs1212355087 2178 dbSNP
rs1319177683 2183 dbSNP
rs1310828929 2187 dbSNP
rs1285352033 2189 dbSNP
rs970454696 2192 dbSNP
rs1012523123 2193 dbSNP
rs1305755091 2201 dbSNP
rs1441636433 2202 dbSNP
rs1370169592 2212 dbSNP
rs1323871095 2223 dbSNP
rs1432774823 2224 dbSNP
rs1277739324 2227 dbSNP
rs770265614 2231 dbSNP
rs1347005129 2235 dbSNP
rs1398630135 2237 dbSNP
rs117103929 2240 dbSNP
rs1200894010 2241 dbSNP
rs1277575355 2244 dbSNP
rs981788588 2246 dbSNP
rs1173732677 2248 dbSNP
rs923609926 2249 dbSNP
rs1023879023 2251 dbSNP
rs1266961210 2256 dbSNP
rs935581979 2257 dbSNP
rs989712973 2258 dbSNP
rs1487123138 2260 dbSNP
rs970754048 2265 dbSNP
rs749815762 2270 dbSNP
rs915469890 2287 dbSNP
rs34727143 2294 dbSNP
rs74682526 2294 dbSNP
rs67262603 2295 dbSNP
rs1282661913 2298 dbSNP
rs932189625 2301 dbSNP
rs1050534870 2302 dbSNP
rs890569090 2305 dbSNP
rs1347327692 2307 dbSNP
rs944764059 2307 dbSNP
rs1379941095 2311 dbSNP
rs1003543733 2313 dbSNP
rs1204424963 2318 dbSNP
rs1478640507 2321 dbSNP
rs769074951 2323 dbSNP
rs1288082291 2324 dbSNP
rs1036790348 2328 dbSNP
rs897792075 2329 dbSNP
rs1377035906 2340 dbSNP
rs543109151 2344 dbSNP
rs1313186109 2348 dbSNP
rs1427565983 2361 dbSNP
rs1031097509 2366 dbSNP
rs1430842044 2366 dbSNP
rs562979692 2368 dbSNP
rs1186307509 2371 dbSNP
rs1474662942 2377 dbSNP
rs1260042630 2386 dbSNP
rs1400530445 2391 dbSNP
rs1211930315 2393 dbSNP
rs1485441272 2395 dbSNP
rs1278328999 2397 dbSNP
rs1206635961 2408 dbSNP
rs1048344751 2415 dbSNP
rs1294843818 2417 dbSNP
rs1212733238 2418 dbSNP
rs1326261154 2421 dbSNP
rs888344881 2422 dbSNP
rs116776936 2428 dbSNP
rs915055928 2429 dbSNP
rs1282424788 2439 dbSNP
rs1299389309 2441 dbSNP
rs1263308673 2444 dbSNP
rs1461995969 2444 dbSNP
rs1353397543 2445 dbSNP
rs1420505253 2450 dbSNP
rs1464490077 2450 dbSNP
rs779487360 2451 dbSNP
rs1475007895 2452 dbSNP
rs1220208332 2454 dbSNP
rs1481039149 2457 dbSNP
rs970481105 2460 dbSNP
rs1250802325 2462 dbSNP
rs74328601 2462 dbSNP
rs771902229 2465 dbSNP
rs1031094729 2469 dbSNP
rs1232381751 2475 dbSNP
rs944378114 2494 dbSNP
rs956434705 2495 dbSNP
rs1391604519 2497 dbSNP
rs1372029701 2503 dbSNP
rs1457475312 2507 dbSNP
rs571900869 2509 dbSNP
rs1445261771 2512 dbSNP
rs1397245462 2513 dbSNP
rs528010986 2517 dbSNP
rs1166124678 2518 dbSNP
rs547949346 2519 dbSNP
rs567734539 2523 dbSNP
rs1367083940 2524 dbSNP
rs1161608486 2527 dbSNP
rs8064977 2528 dbSNP
rs1249936409 2543 dbSNP
rs760066685 2556 dbSNP
rs770499633 2557 dbSNP
rs953618535 2561 dbSNP
rs986276156 2562 dbSNP
rs912038018 2564 dbSNP
rs1479029029 2568 dbSNP
rs555801469 2569 dbSNP
rs1171800647 2571 dbSNP
rs1212971189 2571 dbSNP
rs78286645 2573 dbSNP
rs1239378949 2577 dbSNP
rs1315922131 2598 dbSNP
rs553077089 2599 dbSNP
rs919332580 2604 dbSNP
rs948214290 2616 dbSNP
rs28475492 2621 dbSNP
rs755100411 2625 dbSNP
rs139418517 2635 dbSNP
rs1389089751 2638 dbSNP
rs1290951708 2641 dbSNP
rs1049517372 2643 dbSNP
rs888375961 2651 dbSNP
rs1012145322 2653 dbSNP
rs1455681319 2657 dbSNP
rs1044920614 2658 dbSNP
rs1030978719 2661 dbSNP
rs892564241 2663 dbSNP
rs1449770265 2666 dbSNP
rs1387315433 2668 dbSNP
rs1263626126 2670 dbSNP
rs906333753 2679 dbSNP
rs1485350030 2684 dbSNP
rs1283516733 2687 dbSNP
rs574564068 2691 dbSNP
rs1401675733 2694 dbSNP
rs1278602678 2709 dbSNP
rs1022790259 2728 dbSNP
rs1307139819 2730 dbSNP
rs117475868 2736 dbSNP
rs752533471 2744 dbSNP
rs1267323680 2745 dbSNP
rs1298191067 2750 dbSNP
rs1383071275 2751 dbSNP
rs1384683635 2757 dbSNP
rs956642500 2758 dbSNP
rs1010601442 2760 dbSNP
rs1436780702 2761 dbSNP
rs1021887913 2780 dbSNP
rs1376191212 2788 dbSNP
rs953650031 2789 dbSNP
rs1477003825 2791 dbSNP
rs1018824930 2792 dbSNP
rs1193792964 2793 dbSNP
rs1260730923 2795 dbSNP
rs554864982 2797 dbSNP
rs965904777 2802 dbSNP
rs1221799185 2803 dbSNP
rs1343506371 2805 dbSNP
rs1272484077 2812 dbSNP
rs761990284 2816 dbSNP
rs767684366 2819 dbSNP
rs1194926501 2820 dbSNP
rs1416877638 2820 dbSNP
rs1356265202 2824 dbSNP
rs1312367659 2825 dbSNP
rs1412897892 2826 dbSNP
rs1398721738 2830 dbSNP
rs181931744 2840 dbSNP
rs1421241074 2844 dbSNP
rs1461404768 2844 dbSNP
rs1262853360 2850 dbSNP
rs1189755210 2859 dbSNP
rs1475331826 2861 dbSNP
rs912138577 2865 dbSNP
rs1439110623 2881 dbSNP
rs1273061277 2882 dbSNP
rs1190529134 2885 dbSNP
rs1317791786 2893 dbSNP
rs556991518 2897 dbSNP
rs1369810527 2899 dbSNP
rs1235465168 2901 dbSNP
rs1335895666 2904 dbSNP
rs1453716564 2910 dbSNP
rs984588944 2914 dbSNP
rs753262309 2915 dbSNP
rs1458014795 2919 dbSNP
rs867776428 2920 dbSNP
rs972622163 2921 dbSNP
rs1337666061 2923 dbSNP
rs1329571065 2935 dbSNP
rs948251321 2939 dbSNP
rs1397944451 2949 dbSNP
rs1166842973 2977 dbSNP
rs543643857 2979 dbSNP
rs1416886360 2980 dbSNP
rs1298597622 2984 dbSNP
rs930691189 2991 dbSNP
rs1232973822 2992 dbSNP
rs1049075789 2993 dbSNP
rs939560592 2998 dbSNP
rs1360952977 3003 dbSNP
rs1236945899 3006 dbSNP
rs1216093450 3009 dbSNP
rs1335968379 3010 dbSNP
rs1289593983 3013 dbSNP
rs915872885 3035 dbSNP
rs947962545 3036 dbSNP
rs1239440189 3044 dbSNP
rs1327917650 3054 dbSNP
rs1374741416 3054 dbSNP
rs1441501720 3056 dbSNP
rs1052669964 3064 dbSNP
rs1321282333 3076 dbSNP
rs1045039707 3088 dbSNP
rs1408174968 3092 dbSNP
rs1157621272 3094 dbSNP
rs1341268628 3095 dbSNP
rs1289896763 3097 dbSNP
rs1437353543 3104 dbSNP
rs1245405577 3106 dbSNP
rs1196109360 3118 dbSNP
rs906447987 3129 dbSNP
rs1469268948 3136 dbSNP
rs1246526619 3138 dbSNP
rs1219741148 3139 dbSNP
rs1448972439 3140 dbSNP
rs939224671 3143 dbSNP
rs1216155678 3147 dbSNP
rs1351646912 3154 dbSNP
rs1022380216 3155 dbSNP
rs1289674337 3156 dbSNP
rs375903336 3156 dbSNP
rs1052686623 3157 dbSNP
rs1366770986 3158 dbSNP
rs1356488742 3159 dbSNP
rs1217935902 3160 dbSNP
rs892229401 3161 dbSNP
rs1297242573 3164 dbSNP
rs1011049609 3169 dbSNP
rs1376773595 3169 dbSNP
rs575496827 3176 dbSNP
rs889163772 3178 dbSNP
rs1455091130 3179 dbSNP
rs1425014893 3180 dbSNP
rs1485122090 3190 dbSNP
rs1476629703 3197 dbSNP
rs186301893 3203 dbSNP
rs1362555800 3204 dbSNP
rs1243020546 3208 dbSNP
rs1413076716 3208 dbSNP
rs1021918994 3213 dbSNP
rs750680267 3218 dbSNP
rs576651295 3220 dbSNP
rs1211601794 3233 dbSNP
rs756088341 3238 dbSNP
rs1311544836 3241 dbSNP
rs1019177911 3248 dbSNP
rs545739061 3249 dbSNP
rs545371495 3253 dbSNP
rs951786150 3261 dbSNP
rs7916 3263 dbSNP
rs755600634 3268 dbSNP
rs915674037 3277 dbSNP
rs1312976249 3282 dbSNP
rs1465161345 3284 dbSNP
rs948448422 3288 dbSNP
rs779398341 3295 dbSNP
rs952164547 3297 dbSNP
rs984836569 3301 dbSNP
rs1344501940 3302 dbSNP
rs553078330 3306 dbSNP
rs948741476 3317 dbSNP
rs748565788 3321 dbSNP
rs939488560 3322 dbSNP
rs527710440 3325 dbSNP
rs1476966645 3331 dbSNP
rs1259801136 3332 dbSNP
rs1451415782 3343 dbSNP
rs1482991202 3348 dbSNP
rs1235785510 3349 dbSNP
rs927896971 3351 dbSNP
rs939237578 3354 dbSNP
rs1257199320 3355 dbSNP
rs1403259721 3358 dbSNP
rs1452101809 3360 dbSNP
rs1052294589 3362 dbSNP
rs892255003 3384 dbSNP
rs1052721999 3387 dbSNP
rs765257825 3390 dbSNP
rs572920707 3393 dbSNP
rs1043495614 3400 dbSNP
rs888846593 3402 dbSNP
rs1376397060 3403 dbSNP
rs1007208224 3407 dbSNP
rs1018534519 3408 dbSNP
rs1401576919 3409 dbSNP
rs914099917 3412 dbSNP
rs946744434 3421 dbSNP
rs1315645620 3422 dbSNP
rs1420435759 3426 dbSNP
rs1165814554 3429 dbSNP
rs1044089110 3437 dbSNP
rs1411761405 3446 dbSNP
rs1212765306 3451 dbSNP
rs902109333 3452 dbSNP
rs1458172180 3454 dbSNP
rs752597149 3461 dbSNP
rs1237557472 3465 dbSNP
rs777244531 3468 dbSNP
rs1040420796 3469 dbSNP
rs1273554313 3471 dbSNP
rs1243633960 3475 dbSNP
rs1319505916 3476 dbSNP
rs746690139 3478 dbSNP
rs901717372 3482 dbSNP
rs952348847 3493 dbSNP
rs1223798962 3496 dbSNP
rs372886497 3502 dbSNP
rs1375501143 3520 dbSNP
rs1331336320 3527 dbSNP
rs993287049 3529 dbSNP
rs1397170328 3533 dbSNP
rs1026235793 3541 dbSNP
rs1457601550 3543 dbSNP
rs1366882381 3544 dbSNP
rs1161540534 3551 dbSNP
rs952023638 3552 dbSNP
rs1379732980 3557 dbSNP
rs1461502543 3559 dbSNP
rs1202586533 3564 dbSNP
rs1267825822 3571 dbSNP
rs1240758684 3574 dbSNP
rs1208948089 3576 dbSNP
rs1238649181 3576 dbSNP
rs1306396875 3576 dbSNP
rs1373745965 3576 dbSNP
rs1491051200 3576 dbSNP
rs397857021 3576 dbSNP
rs533743895 3576 dbSNP
rs5820832 3576 dbSNP
rs796534620 3576 dbSNP
rs201947625 3577 dbSNP
rs984956085 3582 dbSNP
rs1005900840 3586 dbSNP
rs201013444 3587 dbSNP
rs547741456 3587 dbSNP
rs540014829 3588 dbSNP
rs1156882174 3590 dbSNP
rs981216995 3590 dbSNP
rs1417231760 3594 dbSNP
rs1378075253 3603 dbSNP
rs1198064216 3605 dbSNP
rs1431294039 3610 dbSNP
rs1263546642 3614 dbSNP
rs1193965625 3616 dbSNP
rs1487736086 3617 dbSNP
rs1283268226 3619 dbSNP
rs981454906 3628 dbSNP
rs1212338021 3643 dbSNP
rs1177968686 3644 dbSNP
rs928603253 3644 dbSNP
rs1257168763 3653 dbSNP
rs1233127132 3658 dbSNP
rs928362193 3661 dbSNP
rs1298117505 3662 dbSNP
rs1377941803 3667 dbSNP
rs1469513195 3671 dbSNP
rs1335023293 3677 dbSNP
rs777664301 3677 dbSNP
rs960904969 3680 dbSNP
rs1296434651 3682 dbSNP
rs1436723813 3682 dbSNP
rs939285481 3683 dbSNP
rs988429559 3687 dbSNP
rs561258165 3688 dbSNP
rs1374616500 3689 dbSNP
rs1171044579 3696 dbSNP
rs375589364 3698 dbSNP
rs946575072 3708 dbSNP
rs879371136 3710 dbSNP
rs1371820753 3712 dbSNP
rs1489221770 3714 dbSNP
rs776275424 3721 dbSNP
rs1302437114 3730 dbSNP
rs943097567 3740 dbSNP
rs1343437922 3750 dbSNP
rs943364269 3763 dbSNP
rs1040473183 3771 dbSNP
rs1040017421 3774 dbSNP
rs745779458 3775 dbSNP
rs1416821416 3776 dbSNP
rs993168886 3777 dbSNP
rs1333545096 3783 dbSNP
rs1394223992 3783 dbSNP
rs1398474762 3788 dbSNP
rs1048492171 3789 dbSNP
rs530187050 3791 dbSNP
rs191679696 3793 dbSNP
rs993300308 3800 dbSNP
rs569394780 3801 dbSNP
rs1421173269 3803 dbSNP
rs1319537451 3812 dbSNP
rs1472892421 3815 dbSNP
rs538371775 3820 dbSNP
rs888019559 3826 dbSNP
rs1367410977 3830 dbSNP
rs62061872 3832 dbSNP
rs1441203704 3833 dbSNP
rs1240634627 3835 dbSNP
rs1231748282 3838 dbSNP
rs1457631849 3839 dbSNP
rs887721047 3841 dbSNP
rs1230273372 3842 dbSNP
rs1357240518 3849 dbSNP
rs1283690742 3854 dbSNP
rs1192812232 3856 dbSNP
rs775434988 3858 dbSNP
rs1332007702 3859 dbSNP
rs565505303 3862 dbSNP
rs1445931169 3865 dbSNP
rs16949232 3866 dbSNP
rs969746182 3869 dbSNP
rs1405595349 3876 dbSNP
rs1389489965 3888 dbSNP
rs1173975553 3889 dbSNP
rs1161079788 3895 dbSNP
rs1470915610 3909 dbSNP
rs1380341766 3935 dbSNP
rs1002538289 3936 dbSNP
rs1002920115 3939 dbSNP
rs1236738042 3941 dbSNP
rs955745428 3946 dbSNP
rs1169846995 3948 dbSNP
rs1289519048 3949 dbSNP
rs1208258950 3950 dbSNP
rs1352788444 3954 dbSNP
rs988345573 3955 dbSNP
rs1374477954 3959 dbSNP
rs1276407862 3962 dbSNP
rs914079244 3964 dbSNP
rs1035702936 3967 dbSNP
rs1439258106 3977 dbSNP
rs980124591 3982 dbSNP
rs1421116675 3985 dbSNP
rs910800335 3985 dbSNP
rs943374198 3986 dbSNP
rs956269748 3986 dbSNP
rs976022864 3986 dbSNP
rs12603677 3987 dbSNP
rs913836578 3992 dbSNP
rs574830623 3995 dbSNP
rs746351944 3995 dbSNP
rs979250909 3998 dbSNP
rs1047791080 4001 dbSNP
rs544247694 4005 dbSNP
rs887635684 4010 dbSNP
rs1197058691 4012 dbSNP
rs1489373076 4014 dbSNP
rs1214732157 4024 dbSNP
rs910345309 4027 dbSNP
rs943128556 4029 dbSNP
rs1286827179 4040 dbSNP
rs1040559482 4043 dbSNP
rs1305300460 4044 dbSNP
rs1044747407 4046 dbSNP
rs1280730332 4046 dbSNP
rs923045172 4063 dbSNP
rs1272808443 4074 dbSNP
rs1401495433 4076 dbSNP
rs181738653 4076 dbSNP
rs1340685921 4083 dbSNP
rs9904353 4090 dbSNP
rs1490165060 4092 dbSNP
rs1178933956 4102 dbSNP
rs1415501659 4103 dbSNP
rs763961518 4104 dbSNP
rs1035329761 4108 dbSNP
rs1478930264 4115 dbSNP
rs377560262 4117 dbSNP
rs761024104 4123 dbSNP
rs1487371460 4124 dbSNP
rs1010430726 4133 dbSNP
rs1021364273 4135 dbSNP
rs1311493914 4135 dbSNP
rs1276262228 4141 dbSNP
rs1044588346 4144 dbSNP
rs1220300119 4146 dbSNP
rs1318332773 4148 dbSNP
rs1277225941 4151 dbSNP
rs1216390410 4153 dbSNP
rs968658262 4153 dbSNP
rs1475878129 4156 dbSNP
rs1302880795 4158 dbSNP
rs533690756 4159 dbSNP
rs1359028557 4162 dbSNP
rs1335296642 4164 dbSNP
rs1467572465 4166 dbSNP
rs1424745340 4174 dbSNP
rs1417595484 4196 dbSNP
rs1407201241 4197 dbSNP
rs1164278357 4200 dbSNP
rs555702150 4213 dbSNP
rs1365575478 4220 dbSNP
rs1423213101 4243 dbSNP
rs1482959398 4245 dbSNP
rs1235732647 4246 dbSNP
rs1017821843 4249 dbSNP
rs1300445626 4253 dbSNP
rs369289904 4255 dbSNP
rs1341463346 4258 dbSNP
rs1458086652 4268 dbSNP
rs1430427770 4269 dbSNP
rs905997145 4270 dbSNP
rs964905717 4271 dbSNP
rs576584302 4273 dbSNP
rs1323082728 4275 dbSNP
rs1269284628 4276 dbSNP
rs1312821476 4278 dbSNP
rs1227295959 4282 dbSNP
rs545143537 4285 dbSNP
rs1313601279 4287 dbSNP
rs976074927 4291 dbSNP
rs186499574 4294 dbSNP
rs191388468 4296 dbSNP
rs923300116 4302 dbSNP
rs1229605069 4305 dbSNP
rs929310279 4321 dbSNP
rs1315058416 4322 dbSNP
rs144177608 4323 dbSNP
rs1440197099 4330 dbSNP
rs909297410 4334 dbSNP
rs1193804508 4350 dbSNP
rs766356190 4353 dbSNP
rs1447403736 4360 dbSNP
rs1220331451 4364 dbSNP
rs956135455 4364 dbSNP
rs1319450934 4369 dbSNP
rs1287477696 4370 dbSNP
rs753998678 4371 dbSNP
rs1010664933 4373 dbSNP
rs1378211580 4373 dbSNP
rs1309004720 4379 dbSNP
rs142339675 4379 dbSNP
rs551756666 4382 dbSNP
rs905796031 4383 dbSNP
rs1457553416 4386 dbSNP
rs1363827856 4388 dbSNP
rs967938776 4389 dbSNP
rs182360338 4394 dbSNP
rs910459653 4403 dbSNP
rs1379674033 4404 dbSNP
rs1179564709 4413 dbSNP
rs6504682 4416 dbSNP
rs891498973 4417 dbSNP
rs1489696266 4424 dbSNP
rs1443348662 4425 dbSNP
rs1216627259 4431 dbSNP
rs1009900734 4437 dbSNP
rs975924434 4440 dbSNP
rs758779969 4445 dbSNP
rs1285979836 4450 dbSNP
rs1161018802 4451 dbSNP
rs1386287515 4457 dbSNP
rs1021793775 4458 dbSNP
rs1400555604 4458 dbSNP
rs904237150 4460 dbSNP
rs778208139 4462 dbSNP
rs1300269178 4468 dbSNP
rs1017705458 4474 dbSNP
rs964832692 4475 dbSNP
rs1156790559 4478 dbSNP
rs1467475683 4494 dbSNP
rs563508823 4498 dbSNP
rs549584519 4504 dbSNP
rs1479259404 4509 dbSNP
rs1264957110 4520 dbSNP
rs1193895431 4521 dbSNP
rs778631222 4524 dbSNP
rs1030532124 4526 dbSNP
rs1256970634 4526 dbSNP
rs1433370562 4526 dbSNP
rs909296803 4526 dbSNP
rs950817366 4526 dbSNP
rs983433469 4526 dbSNP
rs1343078078 4535 dbSNP
rs983543049 4538 dbSNP
rs1454196649 4543 dbSNP
rs746640179 4552 dbSNP
rs1381354454 4554 dbSNP
rs1219458949 4555 dbSNP
rs1339971253 4556 dbSNP
rs942268699 4558 dbSNP
rs1316266599 4559 dbSNP
rs1044703247 4561 dbSNP
rs1311431776 4562 dbSNP
rs906111849 4565 dbSNP
rs781383493 4567 dbSNP
rs532753302 4570 dbSNP
rs938876799 4576 dbSNP
rs1057271799 4578 dbSNP
rs756979588 4585 dbSNP
rs551944437 4590 dbSNP
rs1444354585 4609 dbSNP
rs1204491725 4611 dbSNP
rs1477267494 4613 dbSNP
rs1370846352 4615 dbSNP
rs1057109020 4616 dbSNP
rs891892226 4618 dbSNP
rs1257561880 4621 dbSNP
rs1203559926 4622 dbSNP
rs945710125 4632 dbSNP
rs1010281210 4637 dbSNP
rs1042702078 4639 dbSNP
rs565770047 4640 dbSNP
rs1022051590 4645 dbSNP
rs1338910394 4652 dbSNP
rs904291967 4657 dbSNP
rs1460078004 4658 dbSNP
rs568202967 4662 dbSNP
rs1341136831 4663 dbSNP
rs1364951339 4663 dbSNP
rs1311982996 4664 dbSNP
rs368339246 4665 dbSNP
rs1017500429 4669 dbSNP
rs1039417982 4672 dbSNP
rs186669965 4678 dbSNP
rs976335726 4682 dbSNP
rs1331709664 4684 dbSNP
rs1030143695 4686 dbSNP
rs1164629322 4691 dbSNP
rs950523434 4695 dbSNP
rs745904792 4696 dbSNP
rs769312677 4700 dbSNP
rs950963199 4701 dbSNP
rs568347836 4702 dbSNP
rs1240419901 4706 dbSNP
rs537373033 4709 dbSNP
rs963695123 4719 dbSNP
rs1404870493 4727 dbSNP
rs941716807 4737 dbSNP
rs1357170096 4743 dbSNP
rs979751734 4745 dbSNP
rs1291079642 4750 dbSNP
rs980217017 4754 dbSNP
rs1449904073 4762 dbSNP
rs1378942343 4768 dbSNP
rs927543691 4768 dbSNP
rs1336282368 4773 dbSNP
rs959861554 4777 dbSNP
rs1441312889 4784 dbSNP
rs938921751 4788 dbSNP
rs557314503 4793 dbSNP
rs1325178729 4794 dbSNP
rs1405545795 4796 dbSNP
rs1161060882 4803 dbSNP
rs913152548 4803 dbSNP
rs945964087 4817 dbSNP
rs1382764181 4820 dbSNP
rs1159779991 4823 dbSNP
rs1043349642 4835 dbSNP
rs925672281 4836 dbSNP
rs577079191 4838 dbSNP
rs1452332798 4839 dbSNP
rs1268285411 4842 dbSNP
rs1220424524 4847 dbSNP
rs891927216 4852 dbSNP
rs770353445 4853 dbSNP
rs946197461 4853 dbSNP
rs189565935 4854 dbSNP
rs183341512 4856 dbSNP
rs1043159646 4870 dbSNP
rs1348311601 4872 dbSNP
rs1039467852 4874 dbSNP
rs904595687 4874 dbSNP
rs1436759962 4875 dbSNP
rs1006877720 4879 dbSNP
rs1300891320 4881 dbSNP
rs1251264211 4889 dbSNP
rs749226159 4893 dbSNP
rs1051911553 4898 dbSNP
rs1018204976 4903 dbSNP
rs886587410 4904 dbSNP
rs1005162538 4906 dbSNP
rs1406244640 4907 dbSNP
rs188933073 4914 dbSNP
rs1478552113 4921 dbSNP
rs997406158 4924 dbSNP
rs1197493534 4926 dbSNP
rs541048536 4927 dbSNP
rs1263941069 4930 dbSNP
rs768332258 4934 dbSNP
rs963449590 4935 dbSNP
rs950614405 4938 dbSNP
rs1034439674 4939 dbSNP
rs983688238 4940 dbSNP
rs1428248153 4941 dbSNP
rs1281023749 4944 dbSNP
rs1016045864 4949 dbSNP
rs1220063806 4951 dbSNP
rs780529830 4960 dbSNP
rs1287710279 4963 dbSNP
rs1430659240 4966 dbSNP
rs1344005870 4970 dbSNP
rs1336710930 4972 dbSNP
rs1169152228 4978 dbSNP
rs1396526928 4988 dbSNP
rs774259979 4991 dbSNP
rs760787069 4992 dbSNP
rs76270717 4993 dbSNP
rs192952551 4996 dbSNP
rs1424438610 5006 dbSNP
rs1185948425 5007 dbSNP
rs1474460973 5008 dbSNP
rs979782853 5018 dbSNP
rs926906041 5022 dbSNP
rs1210691325 5025 dbSNP
rs1460744358 5027 dbSNP
rs960576838 5028 dbSNP
rs1200147219 5032 dbSNP
rs993127926 5033 dbSNP
rs913469913 5034 dbSNP
rs1343892699 5035 dbSNP
rs1212355613 5041 dbSNP
rs1229824691 5049 dbSNP
rs946256907 5050 dbSNP
rs774542361 5051 dbSNP
rs1043195470 5057 dbSNP
rs1292712174 5059 dbSNP
rs1490654688 5060 dbSNP
rs1467395928 5062 dbSNP
rs933765126 5072 dbSNP
rs1170003435 5073 dbSNP
rs926054661 5073 dbSNP
rs942766249 5074 dbSNP
rs1241055249 5075 dbSNP
rs1267141078 5080 dbSNP
rs777026339 5083 dbSNP
rs899380475 5084 dbSNP
rs1250450610 5088 dbSNP
rs556924242 5094 dbSNP
rs1323018602 5108 dbSNP
rs1001548468 5110 dbSNP
rs1247357591 5111 dbSNP
rs1382620027 5114 dbSNP
rs1313543684 5115 dbSNP
rs998586415 5120 dbSNP
rs1034326575 5121 dbSNP
rs376615164 5126 dbSNP
rs895803530 5126 dbSNP
rs1051724430 5127 dbSNP
rs1461086066 5129 dbSNP
rs1165649797 5135 dbSNP
rs1020779910 5140 dbSNP
rs185215330 5141 dbSNP
rs765424718 5142 dbSNP
rs1016081843 5145 dbSNP
rs978965350 5146 dbSNP
rs963125115 5150 dbSNP
rs1001249676 5152 dbSNP
rs963902833 5154 dbSNP
rs1489221254 5161 dbSNP
rs563648234 5167 dbSNP
rs1221170821 5169 dbSNP
rs80141491 5174 dbSNP
rs557793092 5177 dbSNP
rs933648746 5178 dbSNP
rs913511368 5180 dbSNP
rs908246482 5197 dbSNP
rs940876804 5210 dbSNP
rs79716688 5211 dbSNP
rs151035677 5212 dbSNP
rs978920319 5215 dbSNP
rs926087131 5223 dbSNP
rs1303976137 5225 dbSNP
rs9910992 5237 dbSNP
rs548187635 5238 dbSNP
rs1290078635 5239 dbSNP
rs1363762809 5242 dbSNP
rs937599048 5248 dbSNP
rs568034554 5258 dbSNP
rs540074984 5264 dbSNP
rs530537385 5269 dbSNP
rs1190419912 5272 dbSNP
rs1386512780 5273 dbSNP
rs1445198601 5275 dbSNP
rs1162899306 5276 dbSNP
rs761196923 5276 dbSNP
rs895854508 5281 dbSNP
rs934032442 5290 dbSNP
rs1047494268 5296 dbSNP
rs550856003 5299 dbSNP
rs1014668533 5300 dbSNP
rs1455208051 5301 dbSNP
rs1289224261 5307 dbSNP
rs1020372882 5309 dbSNP
rs1380686619 5310 dbSNP
rs1338806266 5311 dbSNP
rs903234745 5317 dbSNP
rs367555575 5318 dbSNP
rs878938913 5321 dbSNP
rs1383558789 5323 dbSNP
rs1223078782 5328 dbSNP
rs1004762220 5338 dbSNP
rs1037546834 5340 dbSNP
rs1343750571 5345 dbSNP
rs370901962 5350 dbSNP
rs1313612315 5351 dbSNP
rs9913744 5352 dbSNP
rs751991632 5354 dbSNP
rs1319234290 5355 dbSNP
rs1287046517 5356 dbSNP
rs757589375 5357 dbSNP
rs555138871 5366 dbSNP
rs1175296208 5367 dbSNP
rs188133012 5372 dbSNP
rs960044151 5377 dbSNP
rs996751785 5380 dbSNP
rs1427404951 5382 dbSNP
rs1261688497 5384 dbSNP
rs1013936113 5392 dbSNP
rs780846346 5393 dbSNP
rs1264095828 5396 dbSNP
rs1203274651 5399 dbSNP
rs982821304 5400 dbSNP
rs1253282678 5407 dbSNP
rs1244570734 5410 dbSNP
rs1228334688 5411 dbSNP
rs1461420005 5412 dbSNP
rs1325903484 5413 dbSNP
rs908299785 5417 dbSNP
rs1020348025 5422 dbSNP
rs1383299061 5423 dbSNP
rs1335764658 5424 dbSNP
rs145941492 5426 dbSNP
rs1383376924 5427 dbSNP
rs1491453590 5427 dbSNP
rs1370790330 5431 dbSNP
rs866205106 5431 dbSNP
rs1191699830 5435 dbSNP
rs1159576683 5437 dbSNP
rs978951407 5449 dbSNP
rs1033217408 5452 dbSNP
rs964219369 5453 dbSNP
rs553175715 5454 dbSNP
rs1451936108 5455 dbSNP
rs1275434372 5460 dbSNP
rs139949010 5466 dbSNP
rs975535173 5466 dbSNP
rs745530237 5467 dbSNP
rs920793234 5468 dbSNP
rs1452080641 5472 dbSNP
rs755554231 5473 dbSNP
rs937485981 5475 dbSNP
rs1450231471 5479 dbSNP
rs1376184311 5481 dbSNP
rs55643513 5482 dbSNP
rs1390418805 5484 dbSNP
rs922739791 5487 dbSNP
rs1056099203 5490 dbSNP
rs1386483540 5491 dbSNP
rs191768284 5491 dbSNP
rs1306775878 5493 dbSNP
rs779604961 5493 dbSNP
rs1234914414 5496 dbSNP
rs908504797 5503 dbSNP
rs1437394030 5509 dbSNP
rs1315552560 5510 dbSNP
rs941334347 5513 dbSNP
rs1224906070 5514 dbSNP
rs1264684061 5514 dbSNP
rs1291009844 5516 dbSNP
rs1490524771 5516 dbSNP
rs534764933 5520 dbSNP
rs1037658908 5521 dbSNP
rs1000712748 5523 dbSNP
rs899061699 5536 dbSNP
rs1202485385 5538 dbSNP
rs201586140 5541 dbSNP
rs1304580421 5542 dbSNP
rs554656173 5542 dbSNP
rs1405074441 5543 dbSNP
rs1481586566 5547 dbSNP
rs374182085 5549 dbSNP
rs543413850 5552 dbSNP
rs1159452441 5553 dbSNP
rs1362320072 5553 dbSNP
rs1469937010 5553 dbSNP
rs375955604 5553 dbSNP
rs398031052 5553 dbSNP
rs71149308 5553 dbSNP
rs1014382816 5555 dbSNP
rs1490540730 5556 dbSNP
rs1268220835 5559 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796037. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796037
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000505658.1 | 3UTR | UCAAGACAUCCUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.668 2.5e-4 -0.597 1.3e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.601 2.5e-3 0.681 4.7e-4 20 Click to see details
GSE14794 Lymphoblastoid cells -0.246 9.7e-3 -0.167 5.8e-2 90 Click to see details
GSE21032 Prostate cancer 0.174 5.8e-2 0.159 7.6e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.307 9.4e-2 0.295 1.0e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.272 9.4e-2 0.233 1.3e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.303 1.3e-1 -0.282 1.4e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.18 1.9e-1 0.207 1.6e-1 25 Click to see details
GSE17306 Multiple myeloma 0.117 2.1e-1 0.180 1.1e-1 49 Click to see details
GSE28260 Renal cortex and medulla -0.23 2.2e-1 -0.253 2.0e-1 13 Click to see details
GSE17498 Multiple myeloma 0.111 2.5e-1 0.170 1.5e-1 40 Click to see details
GSE28544 Breast cancer -0.144 2.5e-1 -0.370 3.8e-2 24 Click to see details
GSE19536 Breast cancer 0.064 2.6e-1 0.139 8.4e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.05 3.3e-1 0.044 3.5e-1 79 Click to see details
GSE19350 CNS germ cell tumors 0.117 3.6e-1 -0.406 9.5e-2 12 Click to see details
GSE21849 B cell lymphoma -0.057 3.8e-1 0.032 4.3e-1 29 Click to see details
GSE38226 Liver fibrosis 0.068 3.8e-1 0.134 2.8e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.025 4.2e-1 0.043 3.7e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.019 4.6e-1 -0.079 3.3e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.011 4.8e-1 -0.027 4.5e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.011 4.8e-1 -0.027 4.5e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.436 0 0.476 0 42 Click to see details
PRAD 0.342 0.01 0.337 0.01 50 Click to see details
PAAD 0.952 0.02 0.400 0.3 4 Click to see details
BRCA -0.209 0.03 -0.196 0.04 84 Click to see details
BLCA 0.292 0.12 0.263 0.15 18 Click to see details
KIRP 0.194 0.14 0.233 0.1 32 Click to see details
KIRC 0.117 0.17 0.137 0.13 68 Click to see details
PCPG -0.812 0.2 -1.000 0.5 3 Click to see details
LIHC 0.118 0.21 0.106 0.23 49 Click to see details
UCEC 0.173 0.24 0.211 0.19 19 Click to see details
LUAD 0.196 0.27 0.168 0.3 12 Click to see details
THCA 0.08 0.27 0.059 0.33 59 Click to see details
ESCA -0.2 0.28 -0.209 0.27 11 Click to see details
KICH 0.065 0.38 0.148 0.24 25 Click to see details
CHOL 0.114 0.39 0.467 0.1 9 Click to see details
LUSC 0.042 0.4 0.060 0.36 38 Click to see details
STAD 0.032 0.43 0.028 0.44 32 Click to see details
COAD -0.061 0.44 -0.452 0.13 8 Click to see details
CESC 0.059 0.48 0.500 0.33 3 Click to see details
CESC 0.059 0.48 0.500 0.33 3 Click to see details
CESC 0.059 0.48 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1