miRTarBase - #MIRT453754 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CSNK1E   
Synonyms CKIepsilon, HCKIE
Description casein kinase 1 epsilon
Transcript NM_001894   
Other Transcripts NM_152221   
Expression
Putative miRNA Targets on CSNK1E
3'UTR of CSNK1E
(miRNA target sites are highlighted)
>CSNK1E|NM_001894|3'UTR
   1 GGAGAGCCCCCATTGGACCAGTGTTTGCTTAGTGTCTTCACTGTATTTTCTTTAAAAAAAAAAAAAAAAAAAAAAAGGCA
  81 AAAATAAACCACTCAAAAGAACAACAAAAAAACCCAGCACAAAACCGACGATGGAGTTTGTTTCTTTGATTTCTTTGCCA
 161 ATGGCAAGAAGATGAGATGCCCTCAGCACTGAGGATTCTTGCCCCCTTGTGGTGCCCGCTGCCCCCAACCTTCAGGCTGC
 241 CAGATGCTCCCCTGACAACACCAGGCTACAGGAGCCAGACGCCAGGGCCTGCCCGGCCTCCTGTTCCTGCCCCCACCCAC
 321 CACCTGCCTGGAGAGGAACGGGTCGGGTCCGTGTCGGAGAAGTGACAGGTCCCAGAGCCAAAGCCGGCCCTCAAGCATCA
 401 TCAGGGAGTGGTGTAGTCAGTTGAAGGCAGTTCCCACCGAGTTTTCCGAGCCTCAGAATCCAGGAGATACGCACAGCCCC
 481 ACCCACTCTGAGATGACAGTGGCTGACTTCCCGTGCTGGGCTTTTCCATTGTCCCCCTGGCCTCCAGGCTCCTCCTCTGC
 561 CTCTCCATGGAGTGGGTGGGGAGGTGGTGGGGGCCGGCGTCCCCTGCGTGTGTGTGTGTGTGTGTGTGTGTGGATGTATT
 641 GACCTGTGTTTCCCAAGACAGCAGGTGCCACGGCCCGCCCCGCCTGCCAGCCCGAATTCCCGTTCTCCTGTGTCTACTAA
 721 CAAGGACATGGGGGTGGGCGGTGACCTCCGCATCCCTCAGAGCTCAGAGGGTCCTCGCTGCCACCGGTCCCCCCCTAGCC
 801 CGTCATCAGCCGGTGGCAGCTCCATCTTCCATTCCTGGTTTTAGGGCAGAATCCATGGAGACTGCTTCCAGAAGGCATCT
 881 GGCTCTGAGTTATAAATTACTTCCCTGGTCCTGACAGTCACCTGGGGTCCCCCCTCTCCCTGGTTCCACCTTTCTGAGGA
 961 GGAGCCTGGAGTCAGGGCTGGGTTTTGGATTAACCCATCCTTCCTAGTTAACACCTTTTTGTTTTTATTTTATTTTATTT
1041 TTGTTTGTTTTCTCCGTGTGTGTGTTTTCCTAATTTATTTACCTCTGTTTCCCCTTTTTCCTTTTTTTTTTTAATTAAAG
1121 AGCAAAGCTTTTTATTACTTTGTAATTTAAAAAACTGAAAAAAAAAAAACTGAAGAACTTTGGGGGGAATTTTGTACTTT
1201 TTTCCTGTGTAAATATTGGACTTTTTTGAGCTTTATCGTGGTTGTTAATTTGAAGTAATAAAGTAGAAAAGATAAAGTGA
1281 AAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGAcgau 5'
            :::|||| |:| ||||    
Target 5' atTGGACCAGTGTTTGCTtagt 3'
12 - 33 108.00 -10.00
2
miRNA  3' guGUUUGGUAAUACACGACgau 5'
            | :||: |   ||||||   
Target 5' ggCTGACT-TCCCGTGCTGggc 3'
501 - 521 107.00 -10.30
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            | |||| | |   |||||  
Target 5' ccCCAACCTTCAG--GCTGCca 3'
223 - 242 107.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30507435 6 COSMIC
COSN8010559 477 COSMIC
COSN24047764 580 COSMIC
COSN1261851 836 COSMIC
COSN21507284 1010 COSMIC
COSN29917231 1140 COSMIC
COSN8018530 1294 COSMIC
COSN28658854 1295 COSMIC
COSN20093997 1401 COSMIC
COSN20234469 1447 COSMIC
COSN31516711 1469 COSMIC
COSN20117452 1923 COSMIC
COSN23814014 1950 COSMIC
COSN8997385 2108 COSMIC
COSN30538747 2150 COSMIC
COSN8018529 2220 COSMIC
COSN27686507 2280 COSMIC
COSN29461230 2343 COSMIC
COSN26669854 2344 COSMIC
COSN31529455 2368 COSMIC
COSN26481889 2372 COSMIC
COSN26568172 2416 COSMIC
COSN26577854 2417 COSMIC
COSN25840942 2450 COSMIC
COSN25702146 2454 COSMIC
COSN16563779 2458 COSMIC
COSN31535802 2473 COSMIC
COSN31532673 2553 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1027941531 4 dbSNP
rs1302082343 7 dbSNP
rs201579666 9 dbSNP
rs767327253 11 dbSNP
rs142283293 12 dbSNP
rs371135313 13 dbSNP
rs55755354 14 dbSNP
rs1212691446 15 dbSNP
rs1013896567 19 dbSNP
rs762304380 22 dbSNP
rs777155984 35 dbSNP
rs769102255 40 dbSNP
rs747423925 41 dbSNP
rs893439075 43 dbSNP
rs1238423052 47 dbSNP
rs775804860 49 dbSNP
rs1386211231 50 dbSNP
rs1049407389 55 dbSNP
rs1483363848 67 dbSNP
rs1208635728 69 dbSNP
rs894106618 70 dbSNP
rs185497677 71 dbSNP
rs1226059098 73 dbSNP
rs1159292384 98 dbSNP
rs1414045212 101 dbSNP
rs1355061015 106 dbSNP
rs922365919 110 dbSNP
rs774399111 114 dbSNP
rs976936065 121 dbSNP
rs1359586766 126 dbSNP
rs1450460251 127 dbSNP
rs904769012 132 dbSNP
rs1350123938 134 dbSNP
rs1246579270 139 dbSNP
rs939816029 144 dbSNP
rs1362745958 149 dbSNP
rs1041940313 150 dbSNP
rs908392593 151 dbSNP
rs542489995 154 dbSNP
rs1435725108 155 dbSNP
rs12484542 156 dbSNP
rs1279773908 157 dbSNP
rs1321524523 159 dbSNP
rs952616736 160 dbSNP
rs563488355 164 dbSNP
rs1390148785 168 dbSNP
rs1182190252 169 dbSNP
rs1482543454 169 dbSNP
rs1028031491 174 dbSNP
rs544426886 175 dbSNP
rs959671517 185 dbSNP
rs1388701226 186 dbSNP
rs193294065 195 dbSNP
rs1415911104 199 dbSNP
rs1166516920 214 dbSNP
rs1003606895 216 dbSNP
rs902667522 217 dbSNP
rs1370113708 219 dbSNP
rs1021086347 227 dbSNP
rs1450493237 228 dbSNP
rs1250390501 230 dbSNP
rs558748028 239 dbSNP
rs532266542 240 dbSNP
rs1348276238 244 dbSNP
rs1436345743 248 dbSNP
rs1276008682 255 dbSNP
rs1370394440 256 dbSNP
rs911241045 261 dbSNP
rs894055481 272 dbSNP
rs1297330393 273 dbSNP
rs1340949896 274 dbSNP
rs1205504829 278 dbSNP
rs1450502678 278 dbSNP
rs1048388982 283 dbSNP
rs1050462255 285 dbSNP
rs932320339 286 dbSNP
rs1478969819 290 dbSNP
rs1186375468 296 dbSNP
rs1389385237 298 dbSNP
rs900856935 300 dbSNP
rs1450316788 306 dbSNP
rs920489428 308 dbSNP
rs573254857 310 dbSNP
rs555338797 316 dbSNP
rs1324323794 328 dbSNP
rs117867125 331 dbSNP
rs1320291607 332 dbSNP
rs939767058 336 dbSNP
rs917011327 346 dbSNP
rs908343542 347 dbSNP
rs1435723563 350 dbSNP
rs1227180387 352 dbSNP
rs992567043 353 dbSNP
rs958462766 354 dbSNP
rs983959265 358 dbSNP
rs1247147774 372 dbSNP
rs999855155 377 dbSNP
rs931176018 379 dbSNP
rs781554835 380 dbSNP
rs1472596602 381 dbSNP
rs1010426953 382 dbSNP
rs1163856073 382 dbSNP
rs901312062 387 dbSNP
rs569399661 402 dbSNP
rs1332613131 407 dbSNP
rs1338275600 413 dbSNP
rs557531910 413 dbSNP
rs749464464 414 dbSNP
rs1336355633 416 dbSNP
rs1226470043 418 dbSNP
rs112589828 425 dbSNP
rs561678912 426 dbSNP
rs1329812398 427 dbSNP
rs1007426585 432 dbSNP
rs751351716 440 dbSNP
rs959383338 442 dbSNP
rs1442049980 443 dbSNP
rs1035451340 445 dbSNP
rs780528496 447 dbSNP
rs1189956473 449 dbSNP
rs1478023713 459 dbSNP
rs1246782491 460 dbSNP
rs966767378 462 dbSNP
rs1481795790 473 dbSNP
rs1158550878 480 dbSNP
rs1021034176 481 dbSNP
rs1011022558 484 dbSNP
rs188925297 495 dbSNP
rs1402025685 497 dbSNP
rs1413520426 502 dbSNP
rs1276303983 504 dbSNP
rs1218571360 506 dbSNP
rs1345545422 515 dbSNP
rs117527714 519 dbSNP
rs917106079 520 dbSNP
rs1406793132 523 dbSNP
rs1241171883 525 dbSNP
rs528102139 536 dbSNP
rs543424614 537 dbSNP
rs992615743 537 dbSNP
rs566906807 547 dbSNP
rs1482198982 549 dbSNP
rs1307615920 554 dbSNP
rs1181477136 558 dbSNP
rs1410717834 559 dbSNP
rs1006603288 563 dbSNP
rs1252701318 571 dbSNP
rs1421392940 572 dbSNP
rs997523393 573 dbSNP
rs548905615 574 dbSNP
rs1197418366 576 dbSNP
rs1377398350 577 dbSNP
rs1414267572 583 dbSNP
rs1175948987 587 dbSNP
rs978834486 606 dbSNP
rs900807243 607 dbSNP
rs369360282 608 dbSNP
rs1250482829 612 dbSNP
rs1393034946 628 dbSNP
rs758815024 630 dbSNP
rs750871222 631 dbSNP
rs1020561699 634 dbSNP
rs1235388422 641 dbSNP
rs1209090744 642 dbSNP
rs1442809229 645 dbSNP
rs886856607 646 dbSNP
rs1481685172 649 dbSNP
rs1280597709 659 dbSNP
rs1048210436 660 dbSNP
rs931148912 661 dbSNP
rs1226535972 666 dbSNP
rs965600048 667 dbSNP
rs1287871280 678 dbSNP
rs1447282942 685 dbSNP
rs915754529 686 dbSNP
rs574070479 689 dbSNP
rs765811712 691 dbSNP
rs756717054 693 dbSNP
rs1007025648 698 dbSNP
rs1291319848 699 dbSNP
rs184369352 704 dbSNP
rs927946251 705 dbSNP
rs541901158 710 dbSNP
rs1339232464 711 dbSNP
rs897193312 716 dbSNP
rs1456160825 718 dbSNP
rs1410568949 720 dbSNP
rs1264955080 724 dbSNP
rs1159170805 726 dbSNP
rs1216174982 730 dbSNP
rs1246545436 731 dbSNP
rs775581715 738 dbSNP
rs1261950164 750 dbSNP
rs1411116472 758 dbSNP
rs760249218 759 dbSNP
rs1162073538 760 dbSNP
rs1367451281 775 dbSNP
rs940650370 778 dbSNP
rs1167076058 780 dbSNP
rs1244794237 782 dbSNP
rs895727727 783 dbSNP
rs913972084 788 dbSNP
rs1268700268 791 dbSNP
rs1289233616 793 dbSNP
rs989547036 794 dbSNP
rs775152377 806 dbSNP
rs958208377 807 dbSNP
rs1312093012 820 dbSNP
rs1228003103 823 dbSNP
rs1322452153 823 dbSNP
rs1028921784 827 dbSNP
rs997075469 828 dbSNP
rs545205095 830 dbSNP
rs978505956 836 dbSNP
rs1486639685 837 dbSNP
rs947111084 845 dbSNP
rs1254840683 846 dbSNP
rs912924911 848 dbSNP
rs561019331 852 dbSNP
rs1321831490 854 dbSNP
rs34853198 860 dbSNP
rs1454855089 865 dbSNP
rs966017933 896 dbSNP
rs775842932 897 dbSNP
rs1003874149 901 dbSNP
rs191538982 907 dbSNP
rs1356365289 908 dbSNP
rs965627537 920 dbSNP
rs1286540691 925 dbSNP
rs1019838864 927 dbSNP
rs986051164 928 dbSNP
rs1048156848 931 dbSNP
rs767248938 937 dbSNP
rs1448662417 939 dbSNP
rs1248519421 943 dbSNP
rs1255007948 946 dbSNP
rs894281530 956 dbSNP
rs1056035779 967 dbSNP
rs938565907 968 dbSNP
rs375205999 969 dbSNP
rs1041643311 970 dbSNP
rs1177753078 970 dbSNP
rs1409866908 971 dbSNP
rs945361282 980 dbSNP
rs144337373 981 dbSNP
rs1376220714 988 dbSNP
rs1322624287 990 dbSNP
rs1015580274 992 dbSNP
rs989550906 995 dbSNP
rs565408096 998 dbSNP
rs540716860 1005 dbSNP
rs1013505638 1018 dbSNP
rs531457910 1019 dbSNP
rs1370071882 1027 dbSNP
rs895737552 1029 dbSNP
rs1057022832 1031 dbSNP
rs958370365 1032 dbSNP
rs1218934385 1038 dbSNP
rs1304640583 1040 dbSNP
rs1348136182 1041 dbSNP
rs573316660 1050 dbSNP
rs921404010 1055 dbSNP
rs975984622 1059 dbSNP
rs555001807 1060 dbSNP
rs1482472705 1062 dbSNP
rs1204638970 1063 dbSNP
rs1234495460 1064 dbSNP
rs1487467727 1065 dbSNP
rs1190355689 1067 dbSNP
rs1395523300 1071 dbSNP
rs1166999891 1072 dbSNP
rs965608898 1074 dbSNP
rs1019865322 1080 dbSNP
rs983057441 1081 dbSNP
rs1364855510 1095 dbSNP
rs1348585765 1104 dbSNP
rs1292499233 1108 dbSNP
rs1436465438 1109 dbSNP
rs1326989583 1110 dbSNP
rs1373701819 1115 dbSNP
rs774155024 1116 dbSNP
rs1294888855 1118 dbSNP
rs542999021 1123 dbSNP
rs759185512 1125 dbSNP
rs1366995067 1126 dbSNP
rs367564536 1134 dbSNP
rs564056739 1134 dbSNP
rs1214577074 1138 dbSNP
rs1274518682 1139 dbSNP
rs995235099 1140 dbSNP
rs894211661 1152 dbSNP
rs1034134977 1157 dbSNP
rs1003104129 1158 dbSNP
rs1253369781 1164 dbSNP
rs1469609214 1170 dbSNP
rs575906192 1175 dbSNP
rs377285543 1176 dbSNP
rs187086051 1180 dbSNP
rs1390604567 1181 dbSNP
rs1411798990 1190 dbSNP
rs571728244 1197 dbSNP
rs1431428524 1209 dbSNP
rs945979393 1212 dbSNP
rs1397355431 1215 dbSNP
rs1433303132 1221 dbSNP
rs562510590 1222 dbSNP
rs545963260 1224 dbSNP
rs892431583 1224 dbSNP
rs1271429303 1231 dbSNP
rs1376399580 1232 dbSNP
rs912952703 1234 dbSNP
rs1273694391 1237 dbSNP
rs552685856 1238 dbSNP
rs1054200622 1243 dbSNP
rs1283365049 1256 dbSNP
rs746647032 1258 dbSNP
rs534405154 1269 dbSNP
rs1252312656 1270 dbSNP
rs1188792670 1274 dbSNP
rs1420574267 1276 dbSNP
rs1230249535 1277 dbSNP
rs1310885723 1281 dbSNP
rs1301207428 1282 dbSNP
rs1386801734 1283 dbSNP
rs1158875447 1293 dbSNP
rs1346884276 1294 dbSNP
rs1348856800 1295 dbSNP
rs1057465 1296 dbSNP
rs1338369187 1297 dbSNP
rs549849173 1297 dbSNP
rs1293382666 1298 dbSNP
rs201969819 1298 dbSNP
rs754030936 1298 dbSNP
rs1226568237 1305 dbSNP
rs1278701439 1306 dbSNP
rs1351198311 1313 dbSNP
rs1169499537 1314 dbSNP
rs1276721779 1333 dbSNP
rs548571823 1333 dbSNP
rs530390909 1340 dbSNP
rs1464362225 1355 dbSNP
rs1485472843 1357 dbSNP
rs1376949143 1361 dbSNP
rs1050526629 1366 dbSNP
rs374843093 1367 dbSNP
rs376205064 1369 dbSNP
rs1259770959 1370 dbSNP
rs1180267930 1371 dbSNP
rs1482889133 1372 dbSNP
rs1251517704 1373 dbSNP
rs1364900221 1383 dbSNP
rs1197861203 1387 dbSNP
rs1471338133 1388 dbSNP
rs1399539661 1391 dbSNP
rs1482496549 1392 dbSNP
rs10560249 1393 dbSNP
rs1240844391 1393 dbSNP
rs1272876713 1393 dbSNP
rs1312949841 1393 dbSNP
rs1328046160 1393 dbSNP
rs1336313149 1393 dbSNP
rs1376785259 1393 dbSNP
rs1407895371 1393 dbSNP
rs1491202049 1393 dbSNP
rs553739129 1393 dbSNP
rs55649369 1393 dbSNP
rs71197105 1393 dbSNP
rs759808676 1393 dbSNP
rs766370421 1393 dbSNP
rs771287480 1393 dbSNP
rs869133333 1393 dbSNP
rs1491543911 1394 dbSNP
rs750991411 1394 dbSNP
rs773726685 1394 dbSNP
rs954424707 1394 dbSNP
rs1197183734 1395 dbSNP
rs1027195153 1396 dbSNP
rs372282520 1396 dbSNP
rs974637706 1399 dbSNP
rs878874490 1401 dbSNP
rs1173931663 1405 dbSNP
rs1396533045 1408 dbSNP
rs1459991598 1410 dbSNP
rs1297111438 1415 dbSNP
rs936726107 1415 dbSNP
rs921341221 1418 dbSNP
rs1321339307 1420 dbSNP
rs1370035296 1422 dbSNP
rs1441892056 1423 dbSNP
rs1226702591 1429 dbSNP
rs1305848853 1429 dbSNP
rs1340304763 1429 dbSNP
rs1252020599 1431 dbSNP
rs1342080527 1436 dbSNP
rs975553372 1442 dbSNP
rs77012152 1443 dbSNP
rs912756553 1445 dbSNP
rs1254419289 1446 dbSNP
rs1426383719 1448 dbSNP
rs1169117877 1450 dbSNP
rs1013556437 1460 dbSNP
rs1330493923 1480 dbSNP
rs1463436885 1487 dbSNP
rs983005065 1498 dbSNP
rs551363762 1505 dbSNP
rs1034083431 1510 dbSNP
rs1401279523 1518 dbSNP
rs373407741 1519 dbSNP
rs1327681623 1525 dbSNP
rs1363267206 1531 dbSNP
rs1470947014 1531 dbSNP
rs533185266 1533 dbSNP
rs1242727236 1534 dbSNP
rs1273064347 1536 dbSNP
rs1156944143 1538 dbSNP
rs1336116368 1558 dbSNP
rs1215883249 1571 dbSNP
rs1472311202 1573 dbSNP
rs1364554656 1577 dbSNP
rs1484689144 1578 dbSNP
rs1185616776 1580 dbSNP
rs974137689 1580 dbSNP
rs1261793779 1586 dbSNP
rs1429726602 1591 dbSNP
rs75264209 1596 dbSNP
rs1255964988 1597 dbSNP
rs113908050 1600 dbSNP
rs1166814424 1610 dbSNP
rs1343256612 1611 dbSNP
rs1052827070 1614 dbSNP
rs796943898 1616 dbSNP
rs1289614546 1618 dbSNP
rs1266788845 1620 dbSNP
rs1387453946 1629 dbSNP
rs528596908 1630 dbSNP
rs1207488244 1641 dbSNP
rs1412942792 1641 dbSNP
rs1002645052 1652 dbSNP
rs907016369 1655 dbSNP
rs1020082294 1656 dbSNP
rs561328501 1657 dbSNP
rs912255803 1660 dbSNP
rs1242220702 1661 dbSNP
rs1260909051 1664 dbSNP
rs1486649177 1666 dbSNP
rs1208079875 1667 dbSNP
rs555401105 1671 dbSNP
rs1339639112 1672 dbSNP
rs543026289 1678 dbSNP
rs774922976 1680 dbSNP
rs1454377609 1688 dbSNP
rs1405729316 1689 dbSNP
rs1054414584 1701 dbSNP
rs920136370 1702 dbSNP
rs780418188 1707 dbSNP
rs961499304 1710 dbSNP
rs1456740938 1711 dbSNP
rs1312347390 1714 dbSNP
rs1376189010 1715 dbSNP
rs1385815558 1719 dbSNP
rs36054621 1723 dbSNP
rs1417141786 1724 dbSNP
rs936656195 1727 dbSNP
rs1296909355 1731 dbSNP
rs1373294067 1745 dbSNP
rs1224625884 1749 dbSNP
rs899855908 1754 dbSNP
rs1231670131 1755 dbSNP
rs1278964553 1758 dbSNP
rs1456639114 1759 dbSNP
rs780601627 1763 dbSNP
rs192247907 1764 dbSNP
rs1231035205 1769 dbSNP
rs575523666 1772 dbSNP
rs960759598 1778 dbSNP
rs1033724459 1780 dbSNP
rs1252487708 1781 dbSNP
rs1452776886 1782 dbSNP
rs146002785 1786 dbSNP
rs1436620735 1787 dbSNP
rs970004378 1790 dbSNP
rs912702895 1792 dbSNP
rs28458809 1797 dbSNP
rs1354446759 1813 dbSNP
rs545362798 1828 dbSNP
rs1302591638 1829 dbSNP
rs770271528 1829 dbSNP
rs77655604 1836 dbSNP
rs1447057714 1842 dbSNP
rs188021900 1843 dbSNP
rs1052923622 1849 dbSNP
rs1270346054 1852 dbSNP
rs1306843245 1854 dbSNP
rs758658009 1858 dbSNP
rs974372646 1865 dbSNP
rs139212007 1867 dbSNP
rs1247831434 1868 dbSNP
rs1184849560 1875 dbSNP
rs1418941109 1876 dbSNP
rs1049410810 1883 dbSNP
rs540145665 1884 dbSNP
rs1392956683 1892 dbSNP
rs1461189185 1899 dbSNP
rs1446117869 1900 dbSNP
rs981121511 1902 dbSNP
rs932267719 1906 dbSNP
rs1267864430 1907 dbSNP
rs117771670 1911 dbSNP
rs1327092724 1912 dbSNP
rs1020031819 1914 dbSNP
rs1010017795 1915 dbSNP
rs940263634 1917 dbSNP
rs369074234 1918 dbSNP
rs1453509691 1919 dbSNP
rs375787499 1920 dbSNP
rs1301611750 1923 dbSNP
rs3041793 1924 dbSNP
rs1475759533 1925 dbSNP
rs1188363456 1927 dbSNP
rs1164478389 1928 dbSNP
rs531627015 1929 dbSNP
rs992283938 1930 dbSNP
rs1166100593 1931 dbSNP
rs960855641 1931 dbSNP
rs34007134 1934 dbSNP
rs183841853 1935 dbSNP
rs1344274687 1938 dbSNP
rs1430742304 1939 dbSNP
rs1033324232 1942 dbSNP
rs1279560414 1946 dbSNP
rs1232641957 1949 dbSNP
rs1293652580 1949 dbSNP
rs1353477571 1949 dbSNP
rs1356438950 1949 dbSNP
rs1358137342 1949 dbSNP
rs71324902 1949 dbSNP
rs996128974 1949 dbSNP
rs1168495462 1950 dbSNP
rs1476064917 1953 dbSNP
rs1244335093 1958 dbSNP
rs1196053983 1961 dbSNP
rs1299461642 1964 dbSNP
rs926661511 1966 dbSNP
rs537076502 1968 dbSNP
rs1269101733 1971 dbSNP
rs1039716981 1979 dbSNP
rs980814754 1979 dbSNP
rs1008277664 1980 dbSNP
rs1224307114 1983 dbSNP
rs1278797089 1984 dbSNP
rs574443899 1987 dbSNP
rs1242638607 1988 dbSNP
rs1278256454 1990 dbSNP
rs1022292757 1992 dbSNP
rs1047205658 1993 dbSNP
rs990091816 1997 dbSNP
rs150805728 1998 dbSNP
rs1233854591 2001 dbSNP
rs1341306444 2003 dbSNP
rs1273020994 2006 dbSNP
rs1160027729 2007 dbSNP
rs141143438 2009 dbSNP
rs1038997903 2010 dbSNP
rs754343348 2017 dbSNP
rs781299883 2018 dbSNP
rs1404248052 2026 dbSNP
rs981070603 2031 dbSNP
rs890880496 2033 dbSNP
rs1369090916 2035 dbSNP
rs1328517486 2039 dbSNP
rs1327905590 2050 dbSNP
rs1336181861 2051 dbSNP
rs1028464811 2052 dbSNP
rs377234025 2056 dbSNP
rs1347438189 2058 dbSNP
rs1235043164 2060 dbSNP
rs912971699 2062 dbSNP
rs1171366881 2065 dbSNP
rs988544141 2066 dbSNP
rs1274345269 2072 dbSNP
rs1477392440 2085 dbSNP
rs1429442424 2086 dbSNP
rs539347531 2092 dbSNP
rs1032861186 2093 dbSNP
rs1250689395 2094 dbSNP
rs113536507 2101 dbSNP
rs996464701 2102 dbSNP
rs1250622414 2104 dbSNP
rs964663666 2106 dbSNP
rs887352812 2109 dbSNP
rs1056565571 2110 dbSNP
rs866877656 2111 dbSNP
rs1218625128 2112 dbSNP
rs1370516966 2112 dbSNP
rs926741244 2112 dbSNP
rs981293816 2113 dbSNP
rs1008217111 2117 dbSNP
rs946804707 2118 dbSNP
rs915286136 2121 dbSNP
rs1165445104 2123 dbSNP
rs891153813 2127 dbSNP
rs955950121 2128 dbSNP
rs1269049642 2130 dbSNP
rs547619428 2139 dbSNP
rs529068207 2154 dbSNP
rs561391403 2159 dbSNP
rs1047152181 2163 dbSNP
rs986667494 2166 dbSNP
rs994264312 2171 dbSNP
rs1162528041 2175 dbSNP
rs549189905 2198 dbSNP
rs575675256 2203 dbSNP
rs1458236990 2209 dbSNP
rs1356680847 2210 dbSNP
rs898625740 2219 dbSNP
rs1381657817 2226 dbSNP
rs113994298 2231 dbSNP
rs1406173434 2232 dbSNP
rs1342931540 2236 dbSNP
rs1177890308 2237 dbSNP
rs1232042600 2245 dbSNP
rs937544319 2246 dbSNP
rs1028142313 2247 dbSNP
rs1335850242 2250 dbSNP
rs1471332294 2251 dbSNP
rs752318710 2252 dbSNP
rs997022387 2254 dbSNP
rs1484698421 2255 dbSNP
rs1045993348 2256 dbSNP
rs372926674 2257 dbSNP
rs912918042 2262 dbSNP
rs988493431 2270 dbSNP
rs1185642745 2271 dbSNP
rs898240630 2275 dbSNP
rs1177460253 2278 dbSNP
rs1424105214 2280 dbSNP
rs539222889 2281 dbSNP
rs558815023 2281 dbSNP
rs770917823 2283 dbSNP
rs138691385 2284 dbSNP
rs1362590281 2286 dbSNP
rs558741181 2292 dbSNP
rs1235581019 2297 dbSNP
rs887378833 2304 dbSNP
rs1209329705 2315 dbSNP
rs935775913 2319 dbSNP
rs1056613120 2336 dbSNP
rs925740266 2338 dbSNP
rs1398094059 2348 dbSNP
rs867282997 2351 dbSNP
rs1054207 2353 dbSNP
rs939607558 2353 dbSNP
rs974602428 2354 dbSNP
rs1045235380 2358 dbSNP
rs1237935516 2358 dbSNP
rs11548925 2359 dbSNP
rs946826447 2359 dbSNP
rs777442184 2367 dbSNP
rs1467974351 2371 dbSNP
rs915297445 2372 dbSNP
rs1483568918 2378 dbSNP
rs778083850 2382 dbSNP
rs1359290489 2393 dbSNP
rs1224595167 2399 dbSNP
rs1382433784 2403 dbSNP
rs1432869395 2403 dbSNP
rs1173109442 2404 dbSNP
rs1450906460 2410 dbSNP
rs935293603 2412 dbSNP
rs1375970149 2414 dbSNP
rs1448020023 2416 dbSNP
rs1309443075 2417 dbSNP
rs1378669741 2418 dbSNP
rs6001086 2427 dbSNP
rs1282868703 2428 dbSNP
rs113188643 2429 dbSNP
rs1249568426 2429 dbSNP
rs1277382183 2429 dbSNP
rs1452381579 2430 dbSNP
rs1384106368 2433 dbSNP
rs1339295897 2434 dbSNP
rs1193084476 2438 dbSNP
rs77316284 2441 dbSNP
rs577920523 2443 dbSNP
rs1354464769 2444 dbSNP
rs1159361800 2450 dbSNP
rs1466411195 2450 dbSNP
rs1402015806 2453 dbSNP
rs1438307701 2454 dbSNP
rs955298301 2458 dbSNP
rs9607526 2459 dbSNP
rs559578184 2460 dbSNP
rs1182688978 2465 dbSNP
rs1293272523 2471 dbSNP
rs1445038104 2471 dbSNP
rs1244848896 2472 dbSNP
rs1186635829 2473 dbSNP
rs1259829779 2474 dbSNP
rs1484920006 2474 dbSNP
rs1260279934 2476 dbSNP
rs1467288391 2478 dbSNP
rs541249071 2480 dbSNP
rs573873476 2483 dbSNP
rs962443607 2484 dbSNP
rs555472705 2485 dbSNP
rs1003847361 2486 dbSNP
rs1203996201 2486 dbSNP
rs1322420946 2486 dbSNP
rs1350114821 2486 dbSNP
rs951080697 2492 dbSNP
rs1339755803 2499 dbSNP
rs1279838003 2505 dbSNP
rs1227566533 2510 dbSNP
rs964929322 2513 dbSNP
rs1453594671 2526 dbSNP
rs1213724949 2532 dbSNP
rs1018853872 2535 dbSNP
rs1488889761 2543 dbSNP
rs1196407770 2544 dbSNP
rs1416374335 2553 dbSNP
rs1475046439 2568 dbSNP
rs566996251 2579 dbSNP
rs1414052949 2581 dbSNP
rs1293297441 2593 dbSNP
rs987401345 2596 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | | |||     ||||||| 
Target 5' cuCCACCCA----CUGCUGCUg 3'
6 - 23
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000405675.3 | 3UTR | caccucuccacccacugcugcug
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.568 4.5e-3 -0.603 2.4e-3 20 Click to see details
GSE17498 Multiple myeloma -0.324 2.1e-2 -0.302 2.9e-2 40 Click to see details
GSE27834 Pluripotent stem cells 0.465 3.5e-2 0.344 9.6e-2 16 Click to see details
GSE42095 Differentiated embryonic stem cells -0.344 5.4e-2 -0.419 2.3e-2 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.328 5.5e-2 -0.310 6.6e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.328 5.9e-2 0.295 8.1e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.28 6.0e-2 -0.170 1.8e-1 32 Click to see details
GSE38226 Liver fibrosis -0.342 6.5e-2 -0.449 2.1e-2 21 Click to see details
GSE14794 Lymphoblastoid cells 0.146 8.5e-2 0.180 4.5e-2 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.301 9.9e-2 -0.373 5.3e-2 20 Click to see details
GSE21032 Prostate cancer -0.131 1.2e-1 -0.020 4.3e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.22 1.5e-1 0.073 3.6e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.316 1.6e-1 -0.545 3.3e-2 12 Click to see details
GSE17306 Multiple myeloma -0.143 1.6e-1 -0.042 3.9e-1 49 Click to see details
GSE28260 Renal cortex and medulla -0.24 2.1e-1 -0.132 3.3e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.057 3.1e-1 0.079 2.4e-1 79 Click to see details
GSE21687 Ependynoma primary tumors 0.033 4.0e-1 0.101 2.1e-1 64 Click to see details
GSE19536 Breast cancer 0.022 4.1e-1 -0.009 4.6e-1 100 Click to see details
GSE28544 Breast cancer -0.043 4.2e-1 -0.054 4.0e-1 24 Click to see details
GSE21849 B cell lymphoma -0.013 4.7e-1 0.466 5.4e-3 29 Click to see details
GSE21849 B cell lymphoma -0.013 4.7e-1 0.466 5.4e-3 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.537 0 -0.599 0 32 Click to see details
THCA 0.279 0.02 0.234 0.04 59 Click to see details
BRCA -0.197 0.04 -0.215 0.02 84 Click to see details
BLCA 0.424 0.04 0.544 0.01 18 Click to see details
PCPG 0.943 0.11 0.500 0.33 3 Click to see details
PRAD 0.176 0.11 0.175 0.11 50 Click to see details
CHOL 0.424 0.13 0.233 0.27 9 Click to see details
COAD 0.354 0.19 0.667 0.04 8 Click to see details
LUSC 0.135 0.21 0.113 0.25 38 Click to see details
KIRP -0.141 0.22 -0.061 0.37 32 Click to see details
KIRC 0.076 0.27 0.078 0.26 68 Click to see details
HNSC -0.089 0.29 -0.115 0.23 42 Click to see details
ESCA 0.171 0.31 0.218 0.26 11 Click to see details
PAAD -0.353 0.32 -0.600 0.2 4 Click to see details
CESC 0.451 0.35 0.500 0.33 3 Click to see details
LUAD 0.114 0.36 0.091 0.39 12 Click to see details
LIHC -0.025 0.43 0.009 0.48 49 Click to see details
UCEC -0.034 0.45 -0.058 0.41 19 Click to see details
KICH -0.01 0.48 -0.059 0.39 25 Click to see details
KICH -0.01 0.48 -0.059 0.39 25 Click to see details
KICH -0.01 0.48 -0.059 0.39 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*