miRTarBase - #MIRT461654 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol G6PC   
Synonyms G6PC1, G6PT, G6Pase, GSD1, GSD1a
Description glucose-6-phosphatase catalytic subunit
Transcript NM_000151   
Expression
Putative miRNA Targets on G6PC
3'UTR of G6PC
(miRNA target sites are highlighted)
>G6PC|NM_000151|3'UTR
   1 GAGATGTGGAGTCTTCGGTGTTTAAAGTCAACAACCATGCCAGGGATTGAGGAGGACTACTATTTGAAGCAATGGGCACT
  81 GGTATTTGGAGCAAGTGACATGCCATCCATTCTGCCGTCGTGGAATTAAATCACGGATGGCAGATTGGAGGGTCGCCTGG
 161 CTTATTCCCATGTGTGACTCCAGCCTGCCCTCAGCACAGACTCTTTCAGATGGAGGTGCCATATCACGTACACCATATGC
 241 AAGTTTCCCGCCAGGAGGTCCTCCTCTCTCTACTTGAATACTCTCACAAGTAGGGAGCTCACTCCCACTGGAACAGCCCA
 321 TTTTATCTTTGAATGGTCTTCTGCCAGCCCATTTTGAGGCCAGAGGTGCTGTCAGCTCAGGTGGTCCTCTTTTACAATCC
 401 TAATCATATTGGGTAATGTTTTTGAAAAGCTAATGAAGCTATTGAGAAAGACCTGTTGCTAGAAGTTGGGTTGTTCTGGA
 481 TTTTCCCCTGAAGACTTACTTATTCTTCCGTCACATATACAAAAGCAAGACTTCCAGGTAGGGCCAGCTCACAAGCCCAG
 561 GCTGGAGATCCTAACTGAGAATTTTCTACCTGTGTTCATTCTTACCGAGAAAAGGAGAAAGGAGCTCTGAATCTGATAGG
 641 AAAAGAAGGCTGCCTAAGGAGGAGTTTTTAGTATGTGGCGTATCATGCAAGTGCTATGCCAAGCCATGTCTAAATGGCTT
 721 TAATTATATAGTAATGCACTCTCAGTAATGGGGGACCAGCTTAAGTATAATTAATAGATGGTTAGTGGGGTAATTCTGCT
 801 TCTAGTATTTTTTTTACTGTGCATACATGTTCATCGTATTTCCTTGGATTTCTGAATGGCTGCAGTGACCCAGATATTGC
 881 ACTAGGTCAAAACATTCAGGTATAGCTGACATCTCCTCTATCACATTACATCATCCTCCTTATAAGCCCAGCTCTGCTTT
 961 TTCCAGATTCTTCCACTGGCTCCACATCCACCCCACTGGATCTTCAGAAGGCTAGAGGGCGACTCTGGTGGTGCTTTTGT
1041 ATGTTTCAATTAGGCTCTGAAATCTTGGGCAAAATGACAAGGGGAGGGCCAGGATTCCTCTCTCAGGTCACTCCAGTGTT
1121 ACTTTTAATTCCTAGAGGGTAAATATGACTCCTTTCTCTATCCCAAGCCAACCAAGAGCACATTCTTAAAGGAAAAGTCA
1201 ACATCTTCTCTCTTTTTTTTTTTTTTTGAGACAGGGTCTCACTATGTTGCCCAGGCTGCTCTTGAATTCCTGGGCTCAAG
1281 CAGTCCTCCCACCCTACCACAGCGTCCCGCGTAGCTGGGACTACAGGTGCAAGCCACTATGTCCAGCTAGCCAACTCCTC
1361 CTTGCCTGCTTTTCTTTTTTTTTCTTTTTTTGAGACGGCGCACCTATCACCCAGGCTGGAGTGGAGTGGCACGATCTTGG
1441 CTCACTGCAACCTCTTCCTCCTGGTTCAAGCGATTCTCATGTCTCAGCCTCCTCAGTAGCTAGGACTACCGGCGTGCACC
1521 ACCATGCCAGGCTAATTTTTATATTTTTAGAATTTTAGAAGAGATGGGATTTCATCATGTTGGCCAGGCTGGTCTCGAAC
1601 TCCTGACCTCAAGTGATCCACCTGCCTTGGCCTCCCAAGGTGCTAGGATTACAGGCATGAGCCACCGCACCGGGCCCTCC
1681 TTGCCTGTTTTTCAATCTCATCTGATATGCAGAGTATTTCTGCCCCACCCACCTACCCCCCAAAAAAAGCTGAAGCCTAT
1761 TTATTTGAAAGTCCTTGTTTTTGCTACTAATTATATAGTATACCATACATTATCATTCAAAACAACCATCCTGCTCATAA
1841 CATCTTTGAAAAGAAAAATATATATGTGCAGTATTTTATTAAAGCAACATTTTATTTAAGAATAAAGTCTTGTTAATTAC
1921 TATATTTTAGATGCAATGTGATCTGAAGTTTCTAATTCTGGCCCAACTAAATTTCTAGCTCTGTTTCCCTAAACAAATAA
2001 TTTGGTTTCTCTGTGCCTGCATTTTCCCTTTGGAGAAGAAAAGTGCTCTCTCTTGAGTTGACCGAGAGTCCCATTAGGGA
2081 TAGGGAGACTTAAATGCATCCACAGGGGCACAGGCAGAGTTGAGCACATAAACGGAGGCCCAAAATCAGCATAGAACCAG
2161 AAAGATTCAGAGTTGGCCAAGAATGAACATTGGCTACCAGACCACAAGTCAGCATGAGTTGCTCTATGGCATCAAATTGC
2241 AACTTGAGAGTAGATGGGCAGGGTCACTATCAAATTAAGCAATCAGGGCACACAAGTTGCAGTAACACAACAAGACTAGG
2321 CCAGCTCTGGAATCCAGTAACTCAGTGTCAGCAAGGTTTTGGGTTATAGTTCAAGAAAGTCTAAACAGAGCCAGTCACAG
2401 CACCAAGGAATGCTCAAGGGAGCTATTGCAGGTTTCTCTGCTAAGAGATTTATTTCATCCTGGGTGCAGGGTTCGACCTC
2481 CAAAGGCCTCAAATCATCACCGTATCAATGGATTTCCTGAGGGTAAGCTCCGCTATTTCACACCTGAACTCCGGAGTCTG
2561 TATATTCAGGGAAGATTGCATTCTCCTACTGGATTTGGGCTCTCAGAGGGCGTTGTGGGAACCAGGCCCCTCACAGAATC
2641 AAATGGTCCCAACCAGGGAGAAAGAAAATAGTCTTTTTTTTTTTTTTAATAGAGATGGGGGTCTCACTATGCTGCCCAGG
2721 CTGGTCTTGAACTCCTGGGTTCAAGTGATCCTCCTGCCTCAGCCTCCCAAAGTGCTGGGATTACAGTGTGAGCCACTGCG
2801 CTTGGCCAGAAATGGTTTTGATCTGTCTGAACTGAACCCTACTGCTTAGGCATAGCCCCATCCTTGATAATCTATTTGCT
2881 CCCAAGGACCAAGTCCAAGATCCTTACAAGAAAGGTCTGCCAGAAAGTAAATACTGCCCCCACTCCCTGAAGTTTATGAG
2961 GTTGATAAGAAAACATAACAGATAAAGTTTATTGAGTGCTAACTTTAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACA--GUGUGAGGu 5'
            ||:  :|| ||  ::|||||: 
Target 5' ttAATTATATAGTAATGCACTCTc 3'
720 - 743 122.00 -7.70
2
miRNA  3' guUUG--UGGUAACAGUGUGAGGu 5'
            |:|  ||||    ||||:||: 
Target 5' caAGCCAACCAAGAGCACATTCTt 3'
1164 - 1187 122.00 -15.30
3
miRNA  3' guUUGUGGUAAC-AGUGUGAGGu 5'
            ||:||   ||  | |||||| 
Target 5' taAATAC---TGCCCCCACTCCc 3'
2928 - 2947 121.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
212778 4 ClinVar
889515 18 ClinVar
255350 24 ClinVar
323365 25 ClinVar
889516 104 ClinVar
323366 120 ClinVar
323367 121 ClinVar
323368 212 ClinVar
890174 251 ClinVar
890175 252 ClinVar
323369 287 ClinVar
323370 493 ClinVar
323371 557 ClinVar
323372 608 ClinVar
890176 681 ClinVar
323373 704 ClinVar
323374 715 ClinVar
323375 728 ClinVar
323376 746 ClinVar
323377 878 ClinVar
890758 888 ClinVar
323378 987 ClinVar
323379 1013 ClinVar
323380 1040 ClinVar
323381 1211 ClinVar
323382 1213 ClinVar
323383 1295 ClinVar
323384 1305 ClinVar
891991 1312 ClinVar
323385 1314 ClinVar
323386 1325 ClinVar
891992 1401 ClinVar
323387 1455 ClinVar
889572 1459 ClinVar
889573 1467 ClinVar
323388 1514 ClinVar
889574 1515 ClinVar
889575 1528 ClinVar
323389 1545 ClinVar
889576 1551 ClinVar
323390 1553 ClinVar
889577 1641 ClinVar
323391 1653 ClinVar
890228 1672 ClinVar
890229 1902 ClinVar
323392 1971 ClinVar
323393 1982 ClinVar
323394 1987 ClinVar
890230 2082 ClinVar
323395 2089 ClinVar
323396 2096 ClinVar
323397 2134 ClinVar
323398 2135 ClinVar
890794 2185 ClinVar
323399 2312 ClinVar
890795 2419 ClinVar
890796 2475 ClinVar
323400 2502 ClinVar
323401 2520 ClinVar
323402 2533 ClinVar
323403 2612 ClinVar
323404 2674 ClinVar
892038 2724 ClinVar
323405 2801 ClinVar
323406 2848 ClinVar
892039 2858 ClinVar
888571 2976 ClinVar
888572 2981 ClinVar
323407 2982 ClinVar
COSN30457812 2 COSMIC
COSN13723443 17 COSMIC
COSN30530794 17 COSMIC
COSN30506512 20 COSMIC
COSN15661244 24 COSMIC
COSN31599508 54 COSMIC
COSN31597209 60 COSMIC
COSN31614015 77 COSMIC
COSN31518938 100 COSMIC
COSN18740678 101 COSMIC
COSN30485795 108 COSMIC
COSN28749344 109 COSMIC
COSN30112356 116 COSMIC
COSN30508633 136 COSMIC
COSN30107740 171 COSMIC
COSN29223845 237 COSMIC
COSN15829827 502 COSMIC
COSN29659214 816 COSMIC
COSN16449288 828 COSMIC
COSN17423720 1029 COSMIC
COSN23862660 1114 COSMIC
COSN20113957 1228 COSMIC
COSN1196996 1229 COSMIC
COSN17838026 1305 COSMIC
COSN17882198 1320 COSMIC
COSN15863770 1433 COSMIC
COSN15085993 1684 COSMIC
COSN20907449 1700 COSMIC
COSN22445510 1809 COSMIC
COSN16274547 1870 COSMIC
COSN17290331 1910 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1398370649 2 dbSNP
rs191399793 4 dbSNP
rs566247950 10 dbSNP
rs1369980935 11 dbSNP
rs775267643 12 dbSNP
rs762140129 14 dbSNP
rs767908090 17 dbSNP
rs34537381 18 dbSNP
rs1241099625 19 dbSNP
rs2229611 24 dbSNP
rs377739870 25 dbSNP
rs372909414 27 dbSNP
rs1273525090 30 dbSNP
rs755143616 33 dbSNP
rs765355094 35 dbSNP
rs1256766238 36 dbSNP
rs753012050 37 dbSNP
rs758232327 38 dbSNP
rs1212238430 45 dbSNP
rs537055293 46 dbSNP
rs775240201 49 dbSNP
rs746889750 53 dbSNP
rs1455092796 65 dbSNP
rs1172503341 71 dbSNP
rs761973914 74 dbSNP
rs184246813 83 dbSNP
rs1001961594 96 dbSNP
rs1447790159 102 dbSNP
rs577036654 103 dbSNP
rs1032152255 104 dbSNP
rs1464728696 105 dbSNP
rs957762177 117 dbSNP
rs987892731 118 dbSNP
rs886052957 120 dbSNP
rs150477898 121 dbSNP
rs1182684573 135 dbSNP
rs138332426 136 dbSNP
rs1234207596 138 dbSNP
rs1202045165 139 dbSNP
rs1436693611 142 dbSNP
rs903334977 155 dbSNP
rs1314970749 156 dbSNP
rs1413343029 156 dbSNP
rs910765808 160 dbSNP
rs867584902 166 dbSNP
rs1280424998 171 dbSNP
rs1296624306 172 dbSNP
rs1008371805 173 dbSNP
rs1019808706 175 dbSNP
rs1318875952 181 dbSNP
rs1305110920 184 dbSNP
rs964292539 191 dbSNP
rs1256300514 198 dbSNP
rs1347188614 202 dbSNP
rs367967732 210 dbSNP
rs886052958 212 dbSNP
rs1175097478 217 dbSNP
rs1469361441 225 dbSNP
rs952489742 228 dbSNP
rs1223983484 229 dbSNP
rs1489645722 232 dbSNP
rs1291624214 243 dbSNP
rs973539002 250 dbSNP
rs143802152 251 dbSNP
rs753206089 252 dbSNP
rs929482911 254 dbSNP
rs765390240 257 dbSNP
rs1305389945 258 dbSNP
rs1195596560 259 dbSNP
rs1223429374 264 dbSNP
rs1368497494 268 dbSNP
rs1285449267 277 dbSNP
rs886052959 287 dbSNP
rs541803451 288 dbSNP
rs1403129234 298 dbSNP
rs970530104 303 dbSNP
rs1302439367 305 dbSNP
rs563588003 311 dbSNP
rs1454294477 312 dbSNP
rs371213492 317 dbSNP
rs1346730240 319 dbSNP
rs1263551714 335 dbSNP
rs1477331388 338 dbSNP
rs1168080751 346 dbSNP
rs1201156001 356 dbSNP
rs1479145406 363 dbSNP
rs750508510 368 dbSNP
rs530674636 369 dbSNP
rs1187588617 372 dbSNP
rs1487177186 375 dbSNP
rs1466080239 388 dbSNP
rs1215449031 390 dbSNP
rs543413807 392 dbSNP
rs758748813 396 dbSNP
rs895921511 400 dbSNP
rs1221957800 401 dbSNP
rs950075458 408 dbSNP
rs1044792089 428 dbSNP
rs564906976 450 dbSNP
rs1002097557 459 dbSNP
rs1278982668 469 dbSNP
rs1382704690 482 dbSNP
rs532485841 493 dbSNP
rs1363904191 494 dbSNP
rs981970081 504 dbSNP
rs1341504997 510 dbSNP
rs547464411 511 dbSNP
rs1406579351 527 dbSNP
rs937952224 528 dbSNP
rs893629138 529 dbSNP
rs1009849048 540 dbSNP
rs1333011223 541 dbSNP
rs1467950089 548 dbSNP
rs1234083914 551 dbSNP
rs1255430885 554 dbSNP
rs533491939 557 dbSNP
rs1260203648 571 dbSNP
rs914545441 571 dbSNP
rs1186478427 576 dbSNP
rs1462023370 590 dbSNP
rs1218703513 591 dbSNP
rs750061113 593 dbSNP
rs954617725 601 dbSNP
rs755684225 604 dbSNP
rs1201997175 605 dbSNP
rs947388396 607 dbSNP
rs886052960 608 dbSNP
rs146600876 618 dbSNP
rs1008529838 640 dbSNP
rs1191119853 649 dbSNP
rs758483700 659 dbSNP
rs1269043906 660 dbSNP
rs1305860138 662 dbSNP
rs530307111 666 dbSNP
rs1293298575 673 dbSNP
rs1017294910 674 dbSNP
rs964935345 676 dbSNP
rs1383226646 678 dbSNP
rs1338522487 679 dbSNP
rs1041783258 680 dbSNP
rs973632286 681 dbSNP
rs779780631 684 dbSNP
rs950852305 686 dbSNP
rs748752168 688 dbSNP
rs1041232911 695 dbSNP
rs1387471321 696 dbSNP
rs375295552 704 dbSNP
rs139091543 705 dbSNP
rs1160947532 707 dbSNP
rs754543282 713 dbSNP
rs886052961 715 dbSNP
rs80193931 728 dbSNP
rs1287437492 730 dbSNP
rs1227553043 739 dbSNP
rs1360153699 741 dbSNP
rs1393164721 744 dbSNP
rs116897758 746 dbSNP
rs1339692663 768 dbSNP
rs1329082512 769 dbSNP
rs1392822798 775 dbSNP
rs1300758054 776 dbSNP
rs1297171877 797 dbSNP
rs552220012 798 dbSNP
rs1424748732 800 dbSNP
rs1015330191 808 dbSNP
rs936033810 808 dbSNP
rs970498839 808 dbSNP
rs1053624013 814 dbSNP
rs1368862651 816 dbSNP
rs570444384 818 dbSNP
rs1364775057 819 dbSNP
rs981937619 827 dbSNP
rs1417614465 828 dbSNP
rs149299573 830 dbSNP
rs1223246044 835 dbSNP
rs1309855475 836 dbSNP
rs72826982 878 dbSNP
rs959201611 879 dbSNP
rs1355349601 886 dbSNP
rs1279982991 887 dbSNP
rs777466548 890 dbSNP
rs746849569 891 dbSNP
rs754827320 894 dbSNP
rs1042622036 898 dbSNP
rs1333558844 912 dbSNP
rs890182205 914 dbSNP
rs1442601255 915 dbSNP
rs574584322 931 dbSNP
rs766279304 946 dbSNP
rs1404974855 979 dbSNP
rs1346878043 980 dbSNP
rs370935410 987 dbSNP
rs1488639762 988 dbSNP
rs947393062 992 dbSNP
rs1017388299 996 dbSNP
rs1208855117 999 dbSNP
rs1452086734 1005 dbSNP
rs537108675 1012 dbSNP
rs75063448 1013 dbSNP
rs1481442101 1015 dbSNP
rs944084696 1019 dbSNP
rs776851181 1021 dbSNP
rs994536456 1022 dbSNP
rs1284879909 1028 dbSNP
rs1178671294 1029 dbSNP
rs1381500845 1030 dbSNP
rs529429768 1031 dbSNP
rs549474805 1040 dbSNP
rs983602613 1044 dbSNP
rs1048622043 1048 dbSNP
rs917426226 1052 dbSNP
rs556830972 1054 dbSNP
rs1458659092 1060 dbSNP
rs1293139885 1074 dbSNP
rs971614652 1085 dbSNP
rs980145615 1086 dbSNP
rs1392430430 1089 dbSNP
rs1436380632 1092 dbSNP
rs927418828 1097 dbSNP
rs936001112 1103 dbSNP
rs1320881597 1104 dbSNP
rs1380848188 1108 dbSNP
rs1365320494 1110 dbSNP
rs1177391290 1117 dbSNP
rs575186130 1127 dbSNP
rs1015306638 1135 dbSNP
rs915127199 1149 dbSNP
rs945300183 1153 dbSNP
rs1475791681 1162 dbSNP
rs1242578838 1170 dbSNP
rs1195272652 1183 dbSNP
rs1376063925 1188 dbSNP
rs1445032851 1204 dbSNP
rs545658086 1206 dbSNP
rs201313100 1207 dbSNP
rs1314676553 1209 dbSNP
rs1220520404 1210 dbSNP
rs1325324641 1211 dbSNP
rs144568330 1211 dbSNP
rs1260869436 1212 dbSNP
rs1272403018 1213 dbSNP
rs1449862177 1213 dbSNP
rs1465364923 1213 dbSNP
rs1491174689 1213 dbSNP
rs11436510 1214 dbSNP
rs200704026 1215 dbSNP
rs1270918195 1216 dbSNP
rs1033442792 1221 dbSNP
rs1333778984 1223 dbSNP
rs397735497 1228 dbSNP
rs1198743417 1229 dbSNP
rs1236963026 1230 dbSNP
rs959212634 1233 dbSNP
rs1447643965 1234 dbSNP
rs1480631301 1235 dbSNP
rs1183897977 1245 dbSNP
rs1175977779 1246 dbSNP
rs1416476417 1251 dbSNP
rs1424732990 1273 dbSNP
rs989746795 1274 dbSNP
rs890265916 1276 dbSNP
rs1008760378 1291 dbSNP
rs161620 1295 dbSNP
rs559807250 1298 dbSNP
rs1399621224 1304 dbSNP
rs549833149 1305 dbSNP
rs994462869 1309 dbSNP
rs1027330315 1310 dbSNP
rs1379753312 1311 dbSNP
rs1395262885 1312 dbSNP
rs886052962 1314 dbSNP
rs1005529625 1320 dbSNP
rs548787621 1325 dbSNP
rs971966934 1327 dbSNP
rs934332561 1331 dbSNP
rs976779865 1338 dbSNP
rs980278332 1339 dbSNP
rs921369844 1342 dbSNP
rs1034358441 1354 dbSNP
rs932822722 1355 dbSNP
rs957460607 1366 dbSNP
rs1180911937 1375 dbSNP
rs1305237704 1375 dbSNP
rs1446198935 1375 dbSNP
rs1470346991 1376 dbSNP
rs888701395 1380 dbSNP
rs1203087053 1385 dbSNP
rs990081454 1397 dbSNP
rs1482456838 1398 dbSNP
rs1293084158 1400 dbSNP
rs113536060 1401 dbSNP
rs946091500 1405 dbSNP
rs1289682396 1414 dbSNP
rs1483839185 1419 dbSNP
rs1224536750 1422 dbSNP
rs1375714768 1423 dbSNP
rs1187680391 1424 dbSNP
rs763493186 1434 dbSNP
rs1255838476 1437 dbSNP
rs1303666184 1447 dbSNP
rs1478956503 1454 dbSNP
rs148453821 1455 dbSNP
rs944532944 1472 dbSNP
rs572871169 1473 dbSNP
rs552879065 1490 dbSNP
rs1054862308 1511 dbSNP
rs558231884 1512 dbSNP
rs374021788 1514 dbSNP
rs111309126 1515 dbSNP
rs1202205741 1517 dbSNP
rs1465424785 1524 dbSNP
rs966575521 1528 dbSNP
rs886093149 1535 dbSNP
rs534589177 1542 dbSNP
rs1384184340 1545 dbSNP
rs397717945 1545 dbSNP
rs1324359967 1551 dbSNP
rs138968865 1553 dbSNP
rs201722515 1554 dbSNP
rs1403187321 1558 dbSNP
rs1400281076 1565 dbSNP
rs1024977369 1574 dbSNP
rs1292893014 1580 dbSNP
rs1277150496 1583 dbSNP
rs1346785353 1589 dbSNP
rs907455211 1598 dbSNP
rs537388227 1606 dbSNP
rs1001624548 1609 dbSNP
rs1429371159 1614 dbSNP
rs1034494396 1617 dbSNP
rs976750374 1621 dbSNP
rs957429317 1629 dbSNP
rs556943624 1641 dbSNP
rs1020395572 1643 dbSNP
rs765883953 1653 dbSNP
rs1246639251 1656 dbSNP
rs546236128 1658 dbSNP
rs7210335 1665 dbSNP
rs940217664 1667 dbSNP
rs1210777847 1668 dbSNP
rs568149292 1672 dbSNP
rs911757369 1673 dbSNP
rs944611985 1675 dbSNP
rs377751565 1676 dbSNP
rs921779184 1678 dbSNP
rs930493904 1683 dbSNP
rs1037263079 1696 dbSNP
rs1434090610 1706 dbSNP
rs928224894 1712 dbSNP
rs938988165 1713 dbSNP
rs1464068412 1715 dbSNP
rs1376613405 1727 dbSNP
rs1171719517 1731 dbSNP
rs1188263806 1736 dbSNP
rs1388864234 1736 dbSNP
rs1430877397 1736 dbSNP
rs1049280736 1738 dbSNP
rs1245160564 1742 dbSNP
rs571386177 1743 dbSNP
rs1425955819 1750 dbSNP
rs1482952840 1756 dbSNP
rs1205125708 1760 dbSNP
rs1252021860 1760 dbSNP
rs894894773 1766 dbSNP
rs1011034909 1768 dbSNP
rs1043495928 1775 dbSNP
rs1171660697 1776 dbSNP
rs1316679881 1786 dbSNP
rs1393986100 1787 dbSNP
rs902319148 1795 dbSNP
rs367885331 1796 dbSNP
rs999336688 1803 dbSNP
rs1369200395 1810 dbSNP
rs1168551238 1828 dbSNP
rs1420115005 1829 dbSNP
rs1387530263 1830 dbSNP
rs940311557 1837 dbSNP
rs1423524327 1843 dbSNP
rs1297304578 1851 dbSNP
rs575079591 1864 dbSNP
rs775865016 1868 dbSNP
rs1178964281 1874 dbSNP
rs1482127386 1876 dbSNP
rs1438157888 1888 dbSNP
rs1272337864 1889 dbSNP
rs1204394514 1890 dbSNP
rs1018801972 1891 dbSNP
rs1045409943 1904 dbSNP
rs539395778 1912 dbSNP
rs1001760517 1924 dbSNP
rs1339454498 1926 dbSNP
rs1307290740 1928 dbSNP
rs370221388 1938 dbSNP
rs754518597 1968 dbSNP
rs192778595 1971 dbSNP
rs1307938508 1979 dbSNP
rs573802724 1982 dbSNP
rs984583449 1985 dbSNP
rs542411157 1987 dbSNP
rs1457727700 1998 dbSNP
rs1356407111 2012 dbSNP
rs1008609077 2018 dbSNP
rs1217823743 2021 dbSNP
rs1283919859 2024 dbSNP
rs1019623243 2027 dbSNP
rs965927045 2028 dbSNP
rs1471632309 2029 dbSNP
rs1445564238 2049 dbSNP
rs1181360771 2050 dbSNP
rs758226811 2064 dbSNP
rs1269391905 2065 dbSNP
rs9902963 2089 dbSNP
rs692180 2096 dbSNP
rs1326450820 2099 dbSNP
rs141802218 2100 dbSNP
rs776939484 2108 dbSNP
rs1405030436 2117 dbSNP
rs544700252 2118 dbSNP
rs1322168391 2123 dbSNP
rs1382125946 2129 dbSNP
rs183542930 2134 dbSNP
rs886052963 2135 dbSNP
rs1160490040 2140 dbSNP
rs940464622 2142 dbSNP
rs1411514221 2164 dbSNP
rs770763503 2165 dbSNP
rs1177170715 2169 dbSNP
rs1481473479 2174 dbSNP
rs1379258393 2175 dbSNP
rs1196722551 2179 dbSNP
rs1450799956 2181 dbSNP
rs146025743 2185 dbSNP
rs928285806 2190 dbSNP
rs563896823 2195 dbSNP
rs1346542166 2196 dbSNP
rs935157651 2200 dbSNP
rs937035940 2203 dbSNP
rs1233222037 2209 dbSNP
rs1327374603 2216 dbSNP
rs1322893137 2240 dbSNP
rs1433369239 2244 dbSNP
rs1388124044 2248 dbSNP
rs1040223332 2249 dbSNP
rs901686213 2260 dbSNP
rs1400223646 2267 dbSNP
rs1055963498 2270 dbSNP
rs893429320 2274 dbSNP
rs1170733039 2279 dbSNP
rs1012119560 2288 dbSNP
rs996015116 2290 dbSNP
rs1028924207 2299 dbSNP
rs1447454982 2300 dbSNP
rs1323769389 2307 dbSNP
rs1041895620 2311 dbSNP
rs372226654 2312 dbSNP
rs1438104005 2315 dbSNP
rs552942446 2317 dbSNP
rs1008328655 2322 dbSNP
rs1200381636 2330 dbSNP
rs1340606254 2345 dbSNP
rs376601294 2349 dbSNP
rs1300476620 2368 dbSNP
rs1226600107 2371 dbSNP
rs1364976356 2377 dbSNP
rs1315971767 2395 dbSNP
rs1332725487 2413 dbSNP
rs1357502658 2415 dbSNP
rs115371692 2419 dbSNP
rs964033857 2420 dbSNP
rs374104069 2426 dbSNP
rs996891591 2432 dbSNP
rs1425979015 2433 dbSNP
rs1371034188 2448 dbSNP
rs1170443817 2459 dbSNP
rs1028877205 2470 dbSNP
rs143133684 2475 dbSNP
rs546598294 2476 dbSNP
rs972896862 2486 dbSNP
rs1410326965 2487 dbSNP
rs1235397937 2493 dbSNP
rs1186164595 2494 dbSNP
rs886052964 2502 dbSNP
rs907720455 2503 dbSNP
rs1203699934 2505 dbSNP
rs962210236 2509 dbSNP
rs886052965 2520 dbSNP
rs1341883609 2528 dbSNP
rs981201241 2530 dbSNP
rs562655160 2532 dbSNP
rs76156285 2533 dbSNP
rs1377171802 2545 dbSNP
rs1283839865 2547 dbSNP
rs960874118 2553 dbSNP
rs937004875 2554 dbSNP
rs1407981466 2557 dbSNP
rs1369712460 2558 dbSNP
rs1055390815 2576 dbSNP
rs1165134647 2588 dbSNP
rs763118529 2590 dbSNP
rs991454430 2603 dbSNP
rs916861299 2609 dbSNP
rs186556135 2612 dbSNP
rs1042253729 2613 dbSNP
rs1458201459 2614 dbSNP
rs1180646899 2615 dbSNP
rs903331076 2624 dbSNP
rs774929925 2627 dbSNP
rs1270257153 2654 dbSNP
rs1224171949 2655 dbSNP
rs923689711 2661 dbSNP
rs905712898 2665 dbSNP
rs113390675 2674 dbSNP
rs1286602833 2674 dbSNP
rs796305511 2674 dbSNP
rs886052966 2674 dbSNP
rs1409290422 2682 dbSNP
rs1349744572 2684 dbSNP
rs944239549 2688 dbSNP
rs1041149966 2702 dbSNP
rs899923476 2712 dbSNP
rs1322461047 2718 dbSNP
rs1180968059 2722 dbSNP
rs146698137 2724 dbSNP
rs1413724452 2729 dbSNP
rs1156251450 2730 dbSNP
rs1027001036 2731 dbSNP
rs1426435995 2734 dbSNP
rs1163571839 2739 dbSNP
rs1416731942 2740 dbSNP
rs1459485305 2741 dbSNP
rs931835159 2744 dbSNP
rs1209590812 2747 dbSNP
rs1172277234 2750 dbSNP
rs1400376050 2751 dbSNP
rs1050754287 2754 dbSNP
rs1324417166 2755 dbSNP
rs1392530066 2757 dbSNP
rs1220934980 2759 dbSNP
rs1365223169 2766 dbSNP
rs1273961871 2776 dbSNP
rs191738448 2778 dbSNP
rs755732323 2787 dbSNP
rs1318161691 2797 dbSNP
rs539257353 2800 dbSNP
rs886052967 2801 dbSNP
rs1178851856 2805 dbSNP
rs897163785 2819 dbSNP
rs1285081037 2830 dbSNP
rs1425086478 2839 dbSNP
rs139115520 2848 dbSNP
rs762083428 2853 dbSNP
rs1208402227 2876 dbSNP
rs1483612867 2879 dbSNP
rs1257905930 2903 dbSNP
rs1231667002 2907 dbSNP
rs961895861 2908 dbSNP
rs566449657 2916 dbSNP
rs1367141677 2920 dbSNP
rs533168611 2933 dbSNP
rs1318674810 2937 dbSNP
rs1035362444 2938 dbSNP
rs1433977891 2942 dbSNP
rs1195257556 2951 dbSNP
rs149904153 2958 dbSNP
rs968368712 2962 dbSNP
rs1359042001 2969 dbSNP
rs1169827322 2970 dbSNP
rs145828729 2976 dbSNP
rs753514553 2977 dbSNP
rs886052968 2982 dbSNP
rs935010477 2992 dbSNP
rs975781951 3006 dbSNP
rs1256525534 3010 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||||||||   :|||||| 
Target 5' -ucACACCAUU---GCACUCCa 3'
1 - 18
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000253801.2 | 3UTR | UCACACCAUUGCACUCCAACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*