miRTarBase - #MIRT461934 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TNFSF14   
Synonyms CD258, HVEML, LIGHT, LTg
Description TNF superfamily member 14
Transcript NM_003807   
Other Transcripts NM_172014   
Expression
Putative miRNA Targets on TNFSF14
3'UTR of TNFSF14
(miRNA target sites are highlighted)
>TNFSF14|NM_003807|3'UTR
   1 AGGAAGGAGCGTGGTGCATTGGACATGGGTCTGACACGTGGAGAACTCAGAGGGTGCCTCAGGGGAAAGAAAACTCACGA
  81 AGCAGAGGCTGGGCGTGGTGGCTCTCGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACCTGAGGTCAG
 161 GAGTTCGAGACCAGCCTGGCTAACATGGCAAAACCCCATCTCTACTAAAAATACAAAAATTAGCCGGACGTGGTGGTGCC
 241 TGCCTGTAATCCAGCTACTCAGGAGGCTGAGGCAGGATAATTTTGCTTAAACCCGGGAGGCGGAGGTTGCAGTGAGCCGA
 321 GATCACACCACTGCACTCCAACCTGGGAAACGCAGTGAGACTGTGCCTCAAAAAAAAGAAAGGAAGAAAAAAGAAAACTC
 401 AGGAAACAGATCTTGGGGGACACTCCAGGGAACCCAAAACTCAAAGGCGGAGAGCTCAGTGGGCACCACCAAGGCGAGAT
 481 GAAGCCCCAGCAGGCACCTTCAGAAGACCCACGTAGACTGCAGACCCTGCCACGGACAATACTAAGGACAAAAACCCAGA
 561 GACTTGGGGTCTGTGGGCCCCCAAACATGGGGTAAAGTTGATTTGCCTGATATTCAGGAAGAAGGGGTGAGGGGTGGGTA
 641 TTTATGCTTTTGATTCAGAAGAAAGTGGGGCTTGGGATTCCAGGGACTTGGCTGGGGGTGGGAAACTTCATCCACTTCCC
 721 TACTCTCATCATGAGTACGGACAGGGTGGGCGGGAGACTGATCATCGGGACTCATCATGAAGAGCCCAGCCCCACCCCAC
 801 ATACTCAGATCCCACCCACAGACTGGTGGCCACACCTCAGCCTGGTCACAAAGAGTTACACTCAGATACATGAGCACGGC
 881 AGCGTGCTCATAACTGTTTAACAACCAGCTGTCCTGGGAGGGGGACAGCTTTGTAATGTTTGCCAATTTCCATGGTGTAA
 961 ATGCTACCACCATGGCTGATTTCATCACTGCCAAGCATAGACATCCCTAATAGGACACCACGGATCTGTCCCCGGCATCC
1041 GGCCCAGGGCCTGGCACAAAGCATGCTCTAGGGAAATGCTTGCTGATTGAAAGGAAGGAAGAATGACTCTACAGTCACAC
1121 CTATGGCATCCCACAAAATCTGTCACATGGCTGCATAATCTCAGCCACTCTTTCACAACTATAGACTCATACACGCGAAG
1201 TGCCAGATTCATGCACAACCACACAATCACATGGAAGTCACAGACGGCATCACAGACAGTCACAGCACTGTGTGTATGTT
1281 ATAACACAAGCACACAAAACTCAGACAGCATCCCAGCTACACAGCCACTCCCAGAGGTGTCACCGTCACACTTGGTAATT
1361 AATACTCATTACATTAGACACAGACAGACCAAGTTATAGTCAGACCTGGTTACACACATACACACACACAATATCACCAT
1441 GACAAATACACATTACACACACACAACATCACAATGACAAACACACATTACACACACAACATCACGATGACAAACACACA
1521 TTACACACACAACATCACGATGACAAACACACATTACACACACATCACAATGACAAACACAACATTACACACACACAACA
1601 TCACAATGACACACACATCACACACACATCACAATGACAAACACACAACATTACACACATATACACACAGCCTGAGGGCC
1681 CTCCCCAGCCCAGACTAACACATCTCGGGGTGAGGACCAGACCTTGTTCATAACCCTGGGCCTCTTAACCACTGATCTTT
1761 GAAATAAATGGCAAATAGTTGTACCTGGATCTGTCTAGTTCTTAGGGGAACAAACTGAAGAAGGGTGGAGAGGAATTGTC
1841 AGGCCTAAAGAGCCCCACAGGGAAAGGGAGGAGTCGGATGGGGGGCAACCATCAGCAACAAGTGGTGGCTCCTAGAGGCA
1921 GAGGGATGGAGGTAATGACCCATGGAGGTCATTCTACAGATGAGGAACCTGGACCCAGTTGGCTCAAGTCCATGCAGGAA
2001 ATGTGGGGGAAACCAGAGACCTCACGTCTGGATCTGGCTTCCTCTCCAATCCACAATTCCTGAGGAAGTAGAGGCTACAT
2081 CCCGCAAGACGCCCTTATTAGACACATCCAGGACAGAATGACAATCCGCCAAGCCAGCTGGAAGCATAAAACACAGGGAG
2161 CTGGTGGGTTGGGTGGGGGCAGATAATGATATGCATACAAATTAGAGGGTCTATGCAAATGAGCATTGCTGCAGTGTGGC
2241 TGGAGGGAATCCTTAGTTCCTAGGATTCTAGGATATGGGTTTCGACCCCAGAGGTGAATGTATTGTTATTATTGTTTTGT
2321 TGTTGTTGTGAATGACAAGTCAAAATTTGTGGGTTATTGTTGTTATCGCCAATAGTATTCTTGTCATTGTTGCACAGTAC
2401 AGAGATGAAGGAAACAGATTTTGCAATCAGATGATCCTGGGTTCTGAGTCCACTCTGCCACTCACCAGCTATATGACCTC
2481 CAGCAATTTCCATCACCTCTCAATGCTTCAGTTTCCCCATCGGCAAGATGGTTGTGGGGGGAGAGGAACAACAGTACAGA
2561 TTCACCATCCCAAATTCAAAATGCTCCAAAATCTAGGCCGGGCGTGGTGGCTCATACCTGTAATCCCAGCACTTTGGGAG
2641 GTCAAAGTGGACGGATAACCTGAGGTCAGGAGCTCCAGACCAGCCTGGCCAACATGGCGAAACCCCATCTCTACTAAAAA
2721 TACAAAAAATTACCTGGGTGTGGTGGGGGGCACCTGTAACCCCAGCTACTCGGGAGGCTGAGGCAGGAACCCTGGAGGTT
2801 GAGGTTGCAGTGAGCTGAGATCACACCACTGCACTCCAGCCTGGGTGACAGAGCAAGGCTCCCATCTCAAAAAACAAAAA
2881 AACATGCTCCAAAATCTGAAACTCTTTGAGCCCCAGTGTGATGCCACAAGTGGGAAATTCCACAACTCATCACATGTGAT
2961 AGATTGCAGTGGAAATGCAGGCACACACCACGAAGTTTACTCAGCATCCTCAAAGGAAATCCCCGTCAGTAGCTATATAT
3041 CATTTTCTCACATGCCAGATAGGTATCTCTCATCTTTTACTGTTAGGTACTTCTGTGTTGAATAGGTGGAGGAAAATGAT
3121 TGCTGGTTAGTAGTATATAAATTCAGAGTCAGGAAGGATGGTGATGTCGGCTGGGTGCAGTGGCTCATGCCTGTAATTCC
3201 AATGTGATACCCTACCTTGTGTTTAACGTGATTGACTCTCCCTTAGCTGAGAGGGCCAGGCAGACTCTATTTTGGCTTCT
3281 TCGCTTGCAGTCTCTCACCCACCCCCCTTCCTCAAGGACTTAAGCTGACTCCCAGCACATCCAAGAATGCGATTACTGAT
3361 AAGATACTGTGACAAGCTATATCCACAATTCCCAGGAATTCGTCCGGTTGATAGCACCCAAAGCCCCCGCGTCTATCACC
3441 TTGTGATAGATTTAAAGCCCCTGCACCTGGAACTGTTTGTTTTTCTGTTACCATTTATCTTTTTCACTTTCTTGCCTGTT
3521 TTGCTTCTGTAAAATTGCTTCAGCTCGGCTCCCTCTTCCCCTTCTAAACCAAGGTATAAAAAGAAACCTAGCCCCTTCTT
3601 TGGGGTGGAGAGAATTTTGAGCGCTAGCCGTCTCTCAGTCGCCGGCTAATAAAGGACTCCTGAATTAGTCTAAAAAAAAA
3681 AAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUG--UGGUAA--CAGUGUGAGGu 5'
            |||  |:| ||  |  ||||||| 
Target 5' gaAACAGATC-TTGGGGGACACTCCa 3'
403 - 427 147.00 -16.60
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' atcACACCACT---GCACTCCa 3'
322 - 340 144.00 -18.50
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' atcACACCACT---GCACTCCa 3'
2820 - 2838 144.00 -18.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26999270 1 COSMIC
COSN30468387 3 COSMIC
COSN26999271 10 COSMIC
COSN30185583 27 COSMIC
COSN30467001 58 COSMIC
COSN30468928 62 COSMIC
COSN30454983 65 COSMIC
COSN30455903 66 COSMIC
COSN26437165 69 COSMIC
COSN30518647 69 COSMIC
COSN30510314 70 COSMIC
COSN28202010 78 COSMIC
COSN30491144 79 COSMIC
COSN13841945 95 COSMIC
COSN31501470 103 COSMIC
COSN30106666 105 COSMIC
COSN30106671 107 COSMIC
COSN30460022 116 COSMIC
COSN30489192 117 COSMIC
COSN31502479 118 COSMIC
COSN8977431 124 COSMIC
COSN31611774 128 COSMIC
COSN32052693 135 COSMIC
COSN31523829 136 COSMIC
COSN20221049 156 COSMIC
COSN30449265 166 COSMIC
COSN30473658 176 COSMIC
COSN31594469 179 COSMIC
COSN30153791 198 COSMIC
COSN28451303 295 COSMIC
COSN30108001 328 COSMIC
COSN28402014 559 COSMIC
COSN20867286 568 COSMIC
COSN6148315 725 COSMIC
COSN31638958 752 COSMIC
COSN22089968 1345 COSMIC
COSN28801459 1425 COSMIC
COSN24966425 1474 COSMIC
COSN4968534 1744 COSMIC
COSN8977430 2600 COSMIC
COSN26749665 2604 COSMIC
COSN21622456 3060 COSMIC
COSN22648731 3316 COSMIC
COSN1219626 3472 COSMIC
COSN22592490 3641 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1422885362 5 dbSNP
rs1162274727 10 dbSNP
rs759740843 11 dbSNP
rs1236453386 14 dbSNP
rs878968600 18 dbSNP
rs751918160 19 dbSNP
rs559258053 26 dbSNP
rs574503575 27 dbSNP
rs1259276152 29 dbSNP
rs763400384 31 dbSNP
rs1354215162 34 dbSNP
rs988644827 35 dbSNP
rs1287877661 37 dbSNP
rs183195549 38 dbSNP
rs770432758 39 dbSNP
rs1010595168 41 dbSNP
rs761354170 45 dbSNP
rs776340164 46 dbSNP
rs1436308141 50 dbSNP
rs1324719908 51 dbSNP
rs1260065680 52 dbSNP
rs894836462 54 dbSNP
rs955877622 56 dbSNP
rs35073533 66 dbSNP
rs1328246606 67 dbSNP
rs1003838568 74 dbSNP
rs555253143 78 dbSNP
rs1047900107 79 dbSNP
rs997378692 90 dbSNP
rs1483166108 92 dbSNP
rs1307248042 93 dbSNP
rs369516171 94 dbSNP
rs900462817 95 dbSNP
rs1017475790 96 dbSNP
rs899275345 101 dbSNP
rs1455540777 102 dbSNP
rs1171755170 104 dbSNP
rs1376855880 105 dbSNP
rs538163247 106 dbSNP
rs569582706 107 dbSNP
rs1037775953 108 dbSNP
rs943362632 114 dbSNP
rs1432941899 117 dbSNP
rs1319978102 123 dbSNP
rs1047447484 126 dbSNP
rs910584616 129 dbSNP
rs1237135958 132 dbSNP
rs929070897 137 dbSNP
rs766033750 138 dbSNP
rs1364223049 140 dbSNP
rs896637834 144 dbSNP
rs933924552 146 dbSNP
rs1418722956 150 dbSNP
rs190344627 153 dbSNP
rs977963721 155 dbSNP
rs966425701 159 dbSNP
rs1469475335 166 dbSNP
rs914975921 167 dbSNP
rs1266650109 174 dbSNP
rs1263041124 179 dbSNP
rs145412013 180 dbSNP
rs926822765 198 dbSNP
rs1455856539 205 dbSNP
rs566593929 207 dbSNP
rs1395267864 212 dbSNP
rs546711417 212 dbSNP
rs529989855 213 dbSNP
rs1443257419 215 dbSNP
rs1292242664 218 dbSNP
rs755620920 220 dbSNP
rs185777842 225 dbSNP
rs113787112 226 dbSNP
rs764565795 229 dbSNP
rs1273474873 230 dbSNP
rs1336279120 233 dbSNP
rs1333642179 236 dbSNP
rs988226373 237 dbSNP
rs1178668190 239 dbSNP
rs1452689197 240 dbSNP
rs531503308 245 dbSNP
rs1472164712 263 dbSNP
rs1181701734 268 dbSNP
rs1418874982 273 dbSNP
rs1381466352 274 dbSNP
rs955673190 279 dbSNP
rs1162772278 293 dbSNP
rs1349747752 294 dbSNP
rs1030116359 295 dbSNP
rs975929662 297 dbSNP
rs763464532 299 dbSNP
rs1300486933 300 dbSNP
rs562828192 301 dbSNP
rs150059193 302 dbSNP
rs1037744806 311 dbSNP
rs1007635390 314 dbSNP
rs1226052823 318 dbSNP
rs889073803 323 dbSNP
rs775908923 324 dbSNP
rs552663883 326 dbSNP
rs139373217 328 dbSNP
rs1211370375 329 dbSNP
rs1258408263 330 dbSNP
rs1185716179 332 dbSNP
rs1445304969 340 dbSNP
rs558673108 347 dbSNP
rs540330068 351 dbSNP
rs1006567596 352 dbSNP
rs1173138041 359 dbSNP
rs1042721282 378 dbSNP
rs1429472772 378 dbSNP
rs181501038 388 dbSNP
rs1285333832 389 dbSNP
rs1204949022 392 dbSNP
rs1026427639 397 dbSNP
rs1283307102 406 dbSNP
rs554593792 412 dbSNP
rs577856607 413 dbSNP
rs776779917 415 dbSNP
rs575834582 426 dbSNP
rs868573407 429 dbSNP
rs1295261823 433 dbSNP
rs1341374736 436 dbSNP
rs1234673930 446 dbSNP
rs896263817 448 dbSNP
rs112937759 449 dbSNP
rs868321866 457 dbSNP
rs1208239195 464 dbSNP
rs776765356 473 dbSNP
rs905374099 475 dbSNP
rs868011067 476 dbSNP
rs1043978552 478 dbSNP
rs946983712 480 dbSNP
rs1431373616 486 dbSNP
rs913892374 490 dbSNP
rs1432734540 492 dbSNP
rs1326973950 494 dbSNP
rs1317608261 499 dbSNP
rs1380293390 508 dbSNP
rs879830086 513 dbSNP
rs1432205071 517 dbSNP
rs1317972248 521 dbSNP
rs1363896835 531 dbSNP
rs1441533393 532 dbSNP
rs187210740 533 dbSNP
rs934090838 534 dbSNP
rs1218455735 537 dbSNP
rs771149887 539 dbSNP
rs1317753121 546 dbSNP
rs1210606681 549 dbSNP
rs970825628 555 dbSNP
rs975479716 556 dbSNP
rs1194771772 568 dbSNP
rs182340929 569 dbSNP
rs1476651685 571 dbSNP
rs537171507 577 dbSNP
rs1193155488 578 dbSNP
rs1408188476 582 dbSNP
rs910407428 587 dbSNP
rs984711638 589 dbSNP
rs566726952 592 dbSNP
rs546649917 598 dbSNP
rs768726660 604 dbSNP
rs1458473256 605 dbSNP
rs1156584631 606 dbSNP
rs993747319 608 dbSNP
rs1461550827 617 dbSNP
rs1327784902 623 dbSNP
rs963509089 626 dbSNP
rs1329306187 627 dbSNP
rs1016387435 628 dbSNP
rs1279941240 633 dbSNP
rs1271584505 634 dbSNP
rs952088343 646 dbSNP
rs773358138 647 dbSNP
rs1230461523 650 dbSNP
rs1266518361 653 dbSNP
rs1328550178 654 dbSNP
rs1007563682 657 dbSNP
rs1292564160 687 dbSNP
rs993531289 690 dbSNP
rs1450406863 695 dbSNP
rs1198849640 704 dbSNP
rs377612324 710 dbSNP
rs557428659 719 dbSNP
rs747092475 725 dbSNP
rs1490087221 738 dbSNP
rs1052174690 739 dbSNP
rs1410794988 740 dbSNP
rs537570732 750 dbSNP
rs1001973987 751 dbSNP
rs905344291 752 dbSNP
rs567465702 754 dbSNP
rs550676240 767 dbSNP
rs1329539309 775 dbSNP
rs903211826 776 dbSNP
rs1044314581 785 dbSNP
rs1286638619 786 dbSNP
rs1350105292 792 dbSNP
rs1233912509 795 dbSNP
rs1286016866 798 dbSNP
rs1269510242 799 dbSNP
rs189420925 826 dbSNP
rs1209730180 840 dbSNP
rs1274379486 843 dbSNP
rs1484212265 859 dbSNP
rs892751883 860 dbSNP
rs1347090844 864 dbSNP
rs1189263946 866 dbSNP
rs1052707451 877 dbSNP
rs933954422 878 dbSNP
rs344561 883 dbSNP
rs1405726492 884 dbSNP
rs937721716 894 dbSNP
rs1307193326 904 dbSNP
rs1375899141 909 dbSNP
rs1396822699 922 dbSNP
rs1365222461 929 dbSNP
rs1039744133 940 dbSNP
rs926376433 942 dbSNP
rs1336440542 943 dbSNP
rs982300163 946 dbSNP
rs1244182855 952 dbSNP
rs1271242865 953 dbSNP
rs949074868 956 dbSNP
rs918959705 964 dbSNP
rs1274357822 965 dbSNP
rs1411709132 969 dbSNP
rs146359868 975 dbSNP
rs748130832 989 dbSNP
rs772110780 990 dbSNP
rs963602919 996 dbSNP
rs1391874822 1001 dbSNP
rs1167837327 1006 dbSNP
rs942815380 1011 dbSNP
rs1447568519 1015 dbSNP
rs12609318 1021 dbSNP
rs45494896 1022 dbSNP
rs1467433292 1028 dbSNP
rs951915012 1030 dbSNP
rs749080607 1033 dbSNP
rs116502110 1034 dbSNP
rs960339752 1040 dbSNP
rs574564344 1041 dbSNP
rs74571514 1047 dbSNP
rs1437902848 1050 dbSNP
rs1020712782 1054 dbSNP
rs543831485 1065 dbSNP
rs1009460192 1067 dbSNP
rs969162387 1071 dbSNP
rs1253845501 1079 dbSNP
rs1343868478 1082 dbSNP
rs1022461540 1085 dbSNP
rs1053729063 1094 dbSNP
rs1271689063 1102 dbSNP
rs1463192670 1102 dbSNP
rs1187821703 1106 dbSNP
rs1011455281 1111 dbSNP
rs796221321 1118 dbSNP
rs755775798 1123 dbSNP
rs1196485899 1131 dbSNP
rs1376078487 1153 dbSNP
rs140089736 1155 dbSNP
rs1046146509 1168 dbSNP
rs1390892293 1182 dbSNP
rs1455756323 1185 dbSNP
rs1283640193 1190 dbSNP
rs998415005 1194 dbSNP
rs749985955 1195 dbSNP
rs558938966 1196 dbSNP
rs1039711782 1197 dbSNP
rs1330953581 1199 dbSNP
rs1444717846 1207 dbSNP
rs1228589027 1211 dbSNP
rs1269678446 1213 dbSNP
rs757054678 1215 dbSNP
rs1326397218 1218 dbSNP
rs1207587029 1219 dbSNP
rs1273659540 1224 dbSNP
rs11673225 1226 dbSNP
rs942261794 1228 dbSNP
rs1189465377 1230 dbSNP
rs942784329 1232 dbSNP
rs545305866 1245 dbSNP
rs888492233 1246 dbSNP
rs1414499686 1254 dbSNP
rs909449189 1255 dbSNP
rs1048481237 1256 dbSNP
rs1464473769 1260 dbSNP
rs146078425 1267 dbSNP
rs1030955096 1270 dbSNP
rs553149549 1271 dbSNP
rs919115638 1276 dbSNP
rs765015487 1283 dbSNP
rs1227180741 1290 dbSNP
rs1312793759 1292 dbSNP
rs1020273938 1293 dbSNP
rs972374156 1307 dbSNP
rs753241635 1309 dbSNP
rs1483234655 1316 dbSNP
rs1207077133 1318 dbSNP
rs140713058 1320 dbSNP
rs1254170136 1324 dbSNP
rs1011566738 1327 dbSNP
rs1178511931 1340 dbSNP
rs1181812696 1341 dbSNP
rs2279627 1343 dbSNP
rs567404724 1344 dbSNP
rs980473801 1345 dbSNP
rs1368429145 1358 dbSNP
rs969047815 1368 dbSNP
rs1022432424 1373 dbSNP
rs1462299826 1377 dbSNP
rs989261281 1384 dbSNP
rs1046664912 1390 dbSNP
rs1303109153 1390 dbSNP
rs949133617 1391 dbSNP
rs957071879 1399 dbSNP
rs1342795782 1401 dbSNP
rs184489094 1405 dbSNP
rs1272202168 1417 dbSNP
rs1482627512 1418 dbSNP
rs1036092767 1419 dbSNP
rs80196597 1425 dbSNP
rs901471850 1427 dbSNP
rs908915489 1428 dbSNP
rs1050634298 1431 dbSNP
rs571615799 1431 dbSNP
rs1018483622 1436 dbSNP
rs1255999500 1437 dbSNP
rs552144571 1443 dbSNP
rs759930305 1445 dbSNP
rs1374353880 1447 dbSNP
rs1429570386 1449 dbSNP
rs1006812324 1458 dbSNP
rs1176274071 1462 dbSNP
rs1360574389 1464 dbSNP
rs1445093227 1465 dbSNP
rs1301771887 1466 dbSNP
rs763694708 1469 dbSNP
rs1444613036 1472 dbSNP
rs923435047 1472 dbSNP
rs1341131750 1473 dbSNP
rs1219618324 1488 dbSNP
rs1279514042 1488 dbSNP
rs1208352958 1499 dbSNP
rs976675064 1499 dbSNP
rs888468510 1501 dbSNP
rs398059538 1502 dbSNP
rs60918571 1502 dbSNP
rs532436424 1505 dbSNP
rs1048934244 1506 dbSNP
rs967596997 1508 dbSNP
rs1337962610 1509 dbSNP
rs930100839 1510 dbSNP
rs990269592 1517 dbSNP
rs957357164 1520 dbSNP
rs1034356107 1521 dbSNP
rs777043171 1524 dbSNP
rs566817897 1526 dbSNP
rs1176447398 1533 dbSNP
rs1318410027 1533 dbSNP
rs1036232596 1534 dbSNP
rs141687363 1535 dbSNP
rs1276379733 1538 dbSNP
rs546803167 1538 dbSNP
rs766597571 1539 dbSNP
rs980694482 1550 dbSNP
rs774784853 1554 dbSNP
rs1329881274 1555 dbSNP
rs1024783543 1557 dbSNP
rs181117961 1558 dbSNP
rs771292062 1559 dbSNP
rs1216270123 1565 dbSNP
rs1223023844 1565 dbSNP
rs1248786364 1566 dbSNP
rs1477271134 1568 dbSNP
rs879421428 1569 dbSNP
rs914933649 1569 dbSNP
rs1473248659 1573 dbSNP
rs36010866 1580 dbSNP
rs201392635 1581 dbSNP
rs35020050 1581 dbSNP
rs1383687854 1582 dbSNP
rs576187867 1582 dbSNP
rs1405876483 1583 dbSNP
rs34713061 1583 dbSNP
rs138591245 1585 dbSNP
rs1283813833 1589 dbSNP
rs1435527928 1590 dbSNP
rs1238339321 1592 dbSNP
rs1351347291 1596 dbSNP
rs1230245830 1601 dbSNP
rs781455709 1601 dbSNP
rs887404873 1606 dbSNP
rs1229368117 1607 dbSNP
rs1315840935 1607 dbSNP
rs1452487929 1610 dbSNP
rs989620129 1617 dbSNP
rs1292667119 1627 dbSNP
rs1377666179 1629 dbSNP
rs1222216519 1634 dbSNP
rs1252013855 1634 dbSNP
rs1291186941 1651 dbSNP
rs1179651273 1652 dbSNP
rs1050527655 1656 dbSNP
rs932230323 1665 dbSNP
rs923500128 1666 dbSNP
rs1411575286 1668 dbSNP
rs1156453737 1670 dbSNP
rs1040658978 1671 dbSNP
rs755580746 1676 dbSNP
rs760959929 1680 dbSNP
rs913443248 1684 dbSNP
rs976848768 1685 dbSNP
rs1306451397 1693 dbSNP
rs34955352 1694 dbSNP
rs879897762 1697 dbSNP
rs773269825 1706 dbSNP
rs560796307 1707 dbSNP
rs1018452609 1714 dbSNP
rs772301105 1721 dbSNP
rs1421943433 1738 dbSNP
rs544300525 1753 dbSNP
rs1421526591 1765 dbSNP
rs1007115013 1771 dbSNP
rs1187083791 1777 dbSNP
rs957451995 1778 dbSNP
rs141846432 1781 dbSNP
rs1469144484 1785 dbSNP
rs1202562113 1786 dbSNP
rs1249411985 1791 dbSNP
rs1442455276 1796 dbSNP
rs1189025579 1798 dbSNP
rs748216582 1807 dbSNP
rs188440673 1811 dbSNP
rs1235612475 1824 dbSNP
rs1443922199 1836 dbSNP
rs1169220518 1839 dbSNP
rs148085223 1845 dbSNP
rs767065165 1847 dbSNP
rs1427601680 1859 dbSNP
rs1166327266 1872 dbSNP
rs1214656345 1875 dbSNP
rs573177844 1876 dbSNP
rs897279238 1880 dbSNP
rs1380759101 1882 dbSNP
rs1452507198 1883 dbSNP
rs1299056580 1884 dbSNP
rs1367733239 1898 dbSNP
rs558818142 1899 dbSNP
rs1025297115 1911 dbSNP
rs1244118384 1918 dbSNP
rs1215173137 1919 dbSNP
rs1320049502 1921 dbSNP
rs1298357153 1924 dbSNP
rs144648754 1928 dbSNP
rs755195056 1934 dbSNP
rs1275895383 1948 dbSNP
rs1361616017 1960 dbSNP
rs779911148 1961 dbSNP
rs1249851381 1963 dbSNP
rs906379404 1968 dbSNP
rs1365838731 1980 dbSNP
rs961849487 1992 dbSNP
rs574198492 1993 dbSNP
rs1378048584 1998 dbSNP
rs1044981712 2005 dbSNP
rs1014712987 2010 dbSNP
rs1005897301 2014 dbSNP
rs1403969400 2018 dbSNP
rs755796880 2020 dbSNP
rs1321764889 2021 dbSNP
rs184019677 2026 dbSNP
rs948022971 2030 dbSNP
rs1295294497 2031 dbSNP
rs1332111078 2037 dbSNP
rs914882152 2040 dbSNP
rs996232533 2042 dbSNP
rs1272771176 2049 dbSNP
rs1053494607 2073 dbSNP
rs1488302817 2078 dbSNP
rs149317540 2083 dbSNP
rs867114959 2084 dbSNP
rs1463476029 2086 dbSNP
rs1204554510 2089 dbSNP
rs138861239 2090 dbSNP
rs1434736735 2091 dbSNP
rs891938207 2094 dbSNP
rs1269842374 2095 dbSNP
rs1480113595 2110 dbSNP
rs1209531379 2119 dbSNP
rs1487543683 2122 dbSNP
rs1253151825 2127 dbSNP
rs1054639277 2128 dbSNP
rs1288842655 2150 dbSNP
rs1391883427 2151 dbSNP
rs1388914762 2161 dbSNP
rs1300823616 2166 dbSNP
rs145986580 2173 dbSNP
rs10410389 2175 dbSNP
rs1289673046 2177 dbSNP
rs1314656312 2180 dbSNP
rs142139390 2195 dbSNP
rs1317861733 2206 dbSNP
rs965495496 2210 dbSNP
rs911414815 2221 dbSNP
rs1265981383 2234 dbSNP
rs1214686254 2235 dbSNP
rs1489317840 2237 dbSNP
rs985664748 2255 dbSNP
rs1225698479 2258 dbSNP
rs1266969037 2261 dbSNP
rs1490244502 2263 dbSNP
rs1183253594 2275 dbSNP
rs1414240324 2278 dbSNP
rs953026174 2279 dbSNP
rs927341795 2280 dbSNP
rs1027399148 2283 dbSNP
rs950084973 2284 dbSNP
rs994144860 2294 dbSNP
rs1365416766 2296 dbSNP
rs1410020477 2297 dbSNP
rs745565861 2302 dbSNP
rs1298277350 2304 dbSNP
rs992446428 2305 dbSNP
rs1461388789 2312 dbSNP
rs1313257624 2320 dbSNP
rs1323446405 2328 dbSNP
rs1243762439 2330 dbSNP
rs961685885 2335 dbSNP
rs1290754121 2338 dbSNP
rs1035750942 2345 dbSNP
rs1206113534 2349 dbSNP
rs1234840682 2350 dbSNP
rs1479677570 2352 dbSNP
rs1002978979 2355 dbSNP
rs1257016760 2357 dbSNP
rs1178559491 2358 dbSNP
rs1470113521 2365 dbSNP
rs906348691 2366 dbSNP
rs1044950650 2367 dbSNP
rs757920913 2368 dbSNP
rs1384977290 2373 dbSNP
rs558178600 2375 dbSNP
rs45511297 2383 dbSNP
rs1431671065 2384 dbSNP
rs951908780 2414 dbSNP
rs1380795395 2415 dbSNP
rs1252697975 2417 dbSNP
rs114643649 2418 dbSNP
rs1314359719 2424 dbSNP
rs1457400145 2445 dbSNP
rs1365604033 2447 dbSNP
rs1230381380 2449 dbSNP
rs1275306009 2451 dbSNP
rs995977979 2452 dbSNP
rs1054119407 2455 dbSNP
rs1256630160 2457 dbSNP
rs751035935 2469 dbSNP
rs546940228 2477 dbSNP
rs138015050 2485 dbSNP
rs1243103616 2491 dbSNP
rs765621711 2492 dbSNP
rs1040752745 2502 dbSNP
rs943819577 2503 dbSNP
rs1018618877 2507 dbSNP
rs1324638418 2513 dbSNP
rs779460218 2517 dbSNP
rs529871635 2519 dbSNP
rs567464210 2520 dbSNP
rs1230556314 2521 dbSNP
rs952996399 2522 dbSNP
rs920158697 2532 dbSNP
rs755491560 2535 dbSNP
rs191883803 2536 dbSNP
rs961380071 2537 dbSNP
rs1361060025 2541 dbSNP
rs1214180329 2542 dbSNP
rs1044873417 2545 dbSNP
rs1325706027 2549 dbSNP
rs754234215 2555 dbSNP
rs1002947960 2557 dbSNP
rs970168365 2579 dbSNP
rs568818218 2589 dbSNP
rs549171100 2599 dbSNP
rs1218647643 2600 dbSNP
rs917205349 2601 dbSNP
rs564859373 2603 dbSNP
rs150312686 2606 dbSNP
rs762101972 2613 dbSNP
rs1405008057 2614 dbSNP
rs940048140 2630 dbSNP
rs1170617251 2634 dbSNP
rs750706998 2646 dbSNP
rs999873673 2652 dbSNP
rs528089926 2653 dbSNP
rs1040721740 2658 dbSNP
rs951877622 2659 dbSNP
rs1344335127 2693 dbSNP
rs375107601 2697 dbSNP
rs559589783 2698 dbSNP
rs889495956 2699 dbSNP
rs1049953179 2733 dbSNP
rs1221978167 2734 dbSNP
rs1462174095 2738 dbSNP
rs1329976105 2741 dbSNP
rs931472402 2749 dbSNP
rs1225953632 2750 dbSNP
rs1282799403 2751 dbSNP
rs75335556 2751 dbSNP
rs1222783951 2758 dbSNP
rs1199066772 2760 dbSNP
rs1489715827 2769 dbSNP
rs974862296 2771 dbSNP
rs574106951 2772 dbSNP
rs563894272 2776 dbSNP
rs1407168354 2804 dbSNP
rs1009890273 2807 dbSNP
rs1165225506 2810 dbSNP
rs1327745494 2820 dbSNP
rs940287673 2824 dbSNP
rs1350777210 2832 dbSNP
rs1302830681 2833 dbSNP
rs1351129851 2834 dbSNP
rs201817104 2834 dbSNP
rs1278226818 2847 dbSNP
rs1350611839 2858 dbSNP
rs1229457283 2859 dbSNP
rs190174944 2862 dbSNP
rs1294358237 2866 dbSNP
rs928615320 2867 dbSNP
rs1339836286 2883 dbSNP
rs1357800198 2883 dbSNP
rs1274946474 2884 dbSNP
rs1332155087 2886 dbSNP
rs981482480 2887 dbSNP
rs578027989 2898 dbSNP
rs1473083076 2902 dbSNP
rs1385472902 2911 dbSNP
rs1000489886 2912 dbSNP
rs1299023597 2918 dbSNP
rs1423795639 2920 dbSNP
rs1419347190 2923 dbSNP
rs558301035 2927 dbSNP
rs1165589272 2928 dbSNP
rs373062611 2930 dbSNP
rs1326924262 2937 dbSNP
rs1449365729 2939 dbSNP
rs151137447 2946 dbSNP
rs1317799986 2951 dbSNP
rs12461880 2954 dbSNP
rs1368379648 2956 dbSNP
rs990621825 2957 dbSNP
rs957915322 2958 dbSNP
rs1032561753 2964 dbSNP
rs1044578412 2968 dbSNP
rs1262873356 2980 dbSNP
rs1215364731 2981 dbSNP
rs185647212 2982 dbSNP
rs895882556 2986 dbSNP
rs1442544663 2989 dbSNP
rs1205433975 2992 dbSNP
rs1037105181 2994 dbSNP
rs1443715149 3008 dbSNP
rs1188993551 3015 dbSNP
rs1246031350 3024 dbSNP
rs116397315 3025 dbSNP
rs1019485863 3031 dbSNP
rs1048925745 3035 dbSNP
rs1470361053 3036 dbSNP
rs1007880776 3038 dbSNP
rs889434909 3039 dbSNP
rs1452622438 3040 dbSNP
rs1049516118 3042 dbSNP
rs930583414 3045 dbSNP
rs921730480 3047 dbSNP
rs1224764760 3050 dbSNP
rs931030486 3052 dbSNP
rs974618939 3055 dbSNP
rs898673728 3074 dbSNP
rs1326734426 3079 dbSNP
rs1277357349 3081 dbSNP
rs1261117360 3084 dbSNP
rs536538607 3086 dbSNP
rs61256290 3089 dbSNP
rs1305244524 3090 dbSNP
rs1263554491 3107 dbSNP
rs928907986 3108 dbSNP
rs981678861 3109 dbSNP
rs1372722837 3115 dbSNP
rs955690342 3117 dbSNP
rs1476681775 3121 dbSNP
rs1427368542 3122 dbSNP
rs1373943759 3126 dbSNP
rs1032683197 3128 dbSNP
rs1290020436 3130 dbSNP
rs1000416241 3131 dbSNP
rs1380918490 3136 dbSNP
rs1317119016 3137 dbSNP
rs1193436013 3138 dbSNP
rs1345771279 3140 dbSNP
rs970349669 3145 dbSNP
rs1023531496 3146 dbSNP
rs1322272072 3147 dbSNP
rs866023132 3155 dbSNP
rs187770663 3160 dbSNP
rs1014410981 3168 dbSNP
rs536881696 3169 dbSNP
rs1204343345 3171 dbSNP
rs571285380 3179 dbSNP
rs1287133671 3184 dbSNP
rs182159629 3185 dbSNP
rs888412186 3186 dbSNP
rs1480164172 3193 dbSNP
rs957651384 3210 dbSNP
rs1048393081 3211 dbSNP
rs930530525 3213 dbSNP
rs775251353 3215 dbSNP
rs1366656354 3218 dbSNP
rs1285425293 3220 dbSNP
rs977932992 3224 dbSNP
rs1300924235 3225 dbSNP
rs775677781 3227 dbSNP
rs879600687 3228 dbSNP
rs1238324060 3230 dbSNP
rs1019516844 3237 dbSNP
rs1008078784 3238 dbSNP
rs149011402 3239 dbSNP
rs1289868440 3240 dbSNP
rs1490195119 3241 dbSNP
rs558930159 3244 dbSNP
rs995272765 3253 dbSNP
rs898280890 3254 dbSNP
rs745624640 3262 dbSNP
rs1321691758 3263 dbSNP
rs1181797379 3267 dbSNP
rs1386195424 3268 dbSNP
rs1412091602 3269 dbSNP
rs1161242459 3272 dbSNP
rs925580983 3275 dbSNP
rs745783287 3278 dbSNP
rs978469502 3281 dbSNP
rs1004414197 3282 dbSNP
rs191479727 3283 dbSNP
rs1390736639 3285 dbSNP
rs529586459 3292 dbSNP
rs948922015 3293 dbSNP
rs1170656455 3295 dbSNP
rs1243536948 3296 dbSNP
rs1313125320 3302 dbSNP
rs915921299 3303 dbSNP
rs1205536356 3304 dbSNP
rs146870009 3305 dbSNP
rs117732253 3306 dbSNP
rs1182112847 3321 dbSNP
rs1027047501 3324 dbSNP
rs1244437140 3329 dbSNP
rs541549297 3331 dbSNP
rs572613204 3337 dbSNP
rs1352202548 3341 dbSNP
rs1461048039 3342 dbSNP
rs1337264965 3344 dbSNP
rs1408237489 3350 dbSNP
rs977460721 3350 dbSNP
rs564919898 3351 dbSNP
rs1437960840 3353 dbSNP
rs996846925 3358 dbSNP
rs1215366281 3359 dbSNP
rs1298009956 3363 dbSNP
rs899866881 3367 dbSNP
rs1257334903 3372 dbSNP
rs344562 3388 dbSNP
rs1202404754 3394 dbSNP
rs535510145 3401 dbSNP
rs113790324 3402 dbSNP
rs890260652 3404 dbSNP
rs344563 3405 dbSNP
rs1273337075 3406 dbSNP
rs1438984458 3406 dbSNP
rs1430839825 3415 dbSNP
rs1444435443 3418 dbSNP
rs1345502604 3419 dbSNP
rs187024605 3423 dbSNP
rs1028240422 3427 dbSNP
rs995615821 3428 dbSNP
rs962393551 3430 dbSNP
rs1408681616 3431 dbSNP
rs1015376889 3440 dbSNP
rs344564 3449 dbSNP
rs1325827076 3457 dbSNP
rs1222159071 3462 dbSNP
rs551021092 3467 dbSNP
rs1278541476 3468 dbSNP
rs915563415 3470 dbSNP
rs1045899284 3479 dbSNP
rs1487738499 3485 dbSNP
rs993059429 3485 dbSNP
rs1013177015 3490 dbSNP
rs894758298 3492 dbSNP
rs534401723 3497 dbSNP
rs1171891788 3498 dbSNP
rs1054704031 3499 dbSNP
rs1408663536 3510 dbSNP
rs1015688354 3516 dbSNP
rs1156632032 3518 dbSNP
rs1176641559 3528 dbSNP
rs1462616556 3529 dbSNP
rs1303996597 3531 dbSNP
rs1347399304 3542 dbSNP
rs1403213931 3543 dbSNP
rs982892813 3544 dbSNP
rs1237795556 3546 dbSNP
rs182694860 3547 dbSNP
rs1226016732 3560 dbSNP
rs1282588431 3561 dbSNP
rs1027065542 3562 dbSNP
rs1222691193 3565 dbSNP
rs548940554 3569 dbSNP
rs1225750255 3574 dbSNP
rs1041800098 3589 dbSNP
rs1232997319 3592 dbSNP
rs1471118739 3595 dbSNP
rs1175471880 3596 dbSNP
rs997380868 3601 dbSNP
rs944762134 3614 dbSNP
rs368159630 3622 dbSNP
rs1354414294 3623 dbSNP
rs546644788 3625 dbSNP
rs1423027171 3627 dbSNP
rs139266723 3628 dbSNP
rs202183406 3629 dbSNP
rs150819804 3630 dbSNP
rs190635790 3632 dbSNP
rs35797744 3632 dbSNP
rs1303985200 3636 dbSNP
rs890396370 3640 dbSNP
rs953897565 3641 dbSNP
rs1357860231 3644 dbSNP
rs1247205510 3646 dbSNP
rs780404195 3661 dbSNP
rs921210460 3662 dbSNP
rs756543133 3667 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |||||| |   :|||||| 
Target 5' aucACACCACU---GCACUCCa 3'
1 - 19
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000245912.3 | 3UTR | AUCACACCACUGCACUCCAACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*