miRTarBase - #MIRT465165 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TSC22D2   
Synonyms TILZ4a, TILZ4b, TILZ4c
Description TSC22 domain family member 2
Transcript NM_014779   
Expression
Putative miRNA Targets on TSC22D2
3'UTR of TSC22D2
(miRNA target sites are highlighted)
>TSC22D2|NM_014779|3'UTR
   1 AGCTTTCTTAAGCCTCATTAAGAAAAAAACTGAAAGCAATCTATCCTTGTGTGCCACTGGTGTTCTTTCCACTTTATACG
  81 AAAGCAAGTAGCCATGCTTTGGTTGTGTGTTTGGCCTTTTCAGTATTAGACAATCATTCTACAAGAGCTTTTCCTCTCTC
 161 TGAGATGTCATGCAGCGCTGTTGATGTCCAGTTCTATGTCATCAGTACACAAGGAGAATAATAGATGGGGTTTATTAAAG
 241 CGAGCAAAGTCTGCATTTTACCTGGTGCGCATGAGTGGGGTCTTTAAGAGTTTTGGTGGCTCTCCCATGTTTCCTATTAC
 321 CCATGGATTTACCCTGAGCCTTCCTATCACATTATAAATAACAGTTCATCTAAAGAGCCACTTTTCTTTCTGATTCAGTA
 401 ACATTTGCCTACATAAGTTTTCATTTATTTGTGTTTTATTTATTACAGGGCTGCTATTTTCATAATGTACATGAACAATG
 481 TCACAGAACTTTTTTAATTTTTTTGAATAATTATAAGTATCAGTAAAGGAAGTGAAAGACAGGATTGCATTTAATAGATA
 561 AAACGTTTAGGCAATAATTGAACAAAAGAATCCTGGCATATTTCTAACACTAATGGCAATTTACTTATGGTATTTATTTT
 641 CAGTAGTAAAGACCCAGCTTGAATGTAAATTTTGTATAGTGTAAGTATGAAGAACATAGTGCAACTGTACAGGTAGTCAC
 721 CAGTTATTGTGATATGATAAATAATTGGGCTATTTTGATGAAGAAAACTTTGTTCATTTGTTTCTACTTTCTAAGAGAAA
 801 TTGCCACGATTCCTCTGCTTTTCAACATTTCGTATGACTTTTTTTTCGGGTGGGAATAAAAAGCTGTGAAATTGTTCAAC
 881 CTACTTTGTAACCAAAGAAGCAAAGCTGTGTAATGGAGTTTGGTTTTTTTTTGTTGTTTTTTTTTTTTTGTCTTTTTTTT
 961 TTTTTATAATGCACATTCTTTATGTATTTTTATTTAGTGTTTTCTCAGTCACAATTTTCTTTACTGTCTAGCATGATCTG
1041 CATGACCTATAATCTTTGAACCACTTTCGTACCTCATGTTTTTATCCAGCACTCTTATTGTAATATGTACTAGTCTGTGA
1121 ACAATGTCAAATAAAAGAGAACGAACAGGTAGTTTGGTGGAGCTGAGCTAGTGTACAATACACTAGTTGTAAAAAAAAAA
1201 AAAAAAAAAAGTGAGCCATCTTTTGTTCATTTAAAATGGTGTTTTGAATTTCGTATGCAGAAAACGTTTTGTTACATTGC
1281 AGATTTTAATGTATTTAATAAATGCAACATGCAGATTAAGTGCAGTGTATACTGAGTATTTAAATTAAAATGTACATTTC
1361 ATAAATACAGTTTCAAAAGAAAGCATCATTTTGTGTATACTAACACATTAAGTGTATGTCAGAAATTGATGTATAAATAT
1441 ATATTTTAACATTTTCTGAAATTAAACTGCAGTTTTGTTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAU-ACACGACGAu 5'
              | ::||||  | |||||| 
Target 5' ttttATTTATTACAGGGCTGCTa 3'
434 - 456 126.00 -11.40
2
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              :::: || | ||:||:| 
Target 5' gtttGGTTTTTTTTTGTTGTTt 3'
918 - 939 118.00 -5.30
3
miRNA  3' guGUU---UGGUAAUACACGACGAu 5'
            |||   |:| ||:|||||  || 
Target 5' agCAATCTATCCTTGTGTGCCACTg 3'
35 - 59 108.00 -12.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30447907 5 COSMIC
COSN30450012 8 COSMIC
COSN30521163 8 COSMIC
COSN27000198 30 COSMIC
COSN30159998 33 COSMIC
COSN31553037 38 COSMIC
COSN30465406 47 COSMIC
COSN30494338 55 COSMIC
COSN14040133 81 COSMIC
COSN22914624 89 COSMIC
COSN30540579 115 COSMIC
COSN20792041 317 COSMIC
COSN28392820 406 COSMIC
COSN31551389 613 COSMIC
COSN31540633 809 COSMIC
COSN31545002 864 COSMIC
COSN22628809 866 COSMIC
COSN31569479 933 COSMIC
COSN20090910 934 COSMIC
COSN20099217 950 COSMIC
COSN20090912 951 COSMIC
COSN20090915 953 COSMIC
COSN30173201 965 COSMIC
COSN29962696 966 COSMIC
COSN6736092 1069 COSMIC
COSN30177148 1076 COSMIC
COSN31543948 1110 COSMIC
COSN31572206 1127 COSMIC
COSN31486646 1166 COSMIC
COSN20099218 1208 COSMIC
COSN9135949 1227 COSMIC
COSN16917278 2005 COSMIC
COSN25066957 2013 COSMIC
COSN25020204 2232 COSMIC
COSN1921243 3129 COSMIC
COSN27198800 3217 COSMIC
COSN28981485 3230 COSMIC
COSN29233208 3510 COSMIC
COSN4812432 3623 COSMIC
COSN21123548 3726 COSMIC
COSN25130282 3860 COSMIC
COSN20683645 3876 COSMIC
COSN25418590 4020 COSMIC
COSN17713724 4804 COSMIC
COSN30611302 4840 COSMIC
COSN30549303 4939 COSMIC
COSN5038647 4981 COSMIC
COSN30692315 5248 COSMIC
COSN30682088 5386 COSMIC
COSN27159009 5628 COSMIC
COSN6736093 6137 COSMIC
COSN14782899 6288 COSMIC
COSN22100403 6561 COSMIC
COSN30724582 6586 COSMIC
COSN30213171 6804 COSMIC
COSN1269755 6853 COSMIC
COSN1921244 7070 COSMIC
COSN30757055 7262 COSMIC
COSN21775646 7336 COSMIC
COSN30621660 7348 COSMIC
COSN30661670 7432 COSMIC
COSN30660438 7458 COSMIC
COSN17860091 7544 COSMIC
rs201481721 483 GWAS
rs199842413 1841 GWAS
rs16862676 2517 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1251166634 3 dbSNP
rs201338161 8 dbSNP
rs1295912763 13 dbSNP
rs771523745 17 dbSNP
rs768558955 24 dbSNP
rs1185318981 31 dbSNP
rs780947244 35 dbSNP
rs375386549 37 dbSNP
rs1169561766 38 dbSNP
rs769933959 40 dbSNP
rs773311462 42 dbSNP
rs1300195628 43 dbSNP
rs1397651549 49 dbSNP
rs1396019570 51 dbSNP
rs763039309 53 dbSNP
rs576007239 67 dbSNP
rs1480448495 76 dbSNP
rs907946584 78 dbSNP
rs1271160929 80 dbSNP
rs775008794 81 dbSNP
rs1403333683 95 dbSNP
rs973813357 97 dbSNP
rs1458254960 102 dbSNP
rs1481340855 103 dbSNP
rs1411805629 108 dbSNP
rs1175861710 110 dbSNP
rs1028500967 115 dbSNP
rs953865108 116 dbSNP
rs144546551 125 dbSNP
rs940817180 131 dbSNP
rs1187174085 134 dbSNP
rs1460132229 137 dbSNP
rs1250023961 148 dbSNP
rs972531006 153 dbSNP
rs919761501 154 dbSNP
rs1283392763 163 dbSNP
rs746309198 166 dbSNP
rs931207657 167 dbSNP
rs11537936 172 dbSNP
rs561829310 177 dbSNP
rs945283046 178 dbSNP
rs1321993422 180 dbSNP
rs1435114785 181 dbSNP
rs1345116553 184 dbSNP
rs527515952 191 dbSNP
rs550588073 192 dbSNP
rs775661370 196 dbSNP
rs949020544 197 dbSNP
rs902263751 199 dbSNP
rs1428717071 209 dbSNP
rs999311852 210 dbSNP
rs1189302547 211 dbSNP
rs547691162 215 dbSNP
rs925284567 218 dbSNP
rs893982958 225 dbSNP
rs1213619778 227 dbSNP
rs146353307 232 dbSNP
rs1453227148 242 dbSNP
rs1402620789 246 dbSNP
rs1244905950 247 dbSNP
rs936682698 254 dbSNP
rs996413126 260 dbSNP
rs1029643996 262 dbSNP
rs1055175671 266 dbSNP
rs1360731787 269 dbSNP
rs895239633 270 dbSNP
rs1439268856 272 dbSNP
rs955004597 274 dbSNP
rs1302938397 283 dbSNP
rs1423059284 286 dbSNP
rs987430990 287 dbSNP
rs1169530311 308 dbSNP
rs1435423602 309 dbSNP
rs1428122204 314 dbSNP
rs564417923 317 dbSNP
rs1293908494 319 dbSNP
rs1307081155 320 dbSNP
rs532525809 321 dbSNP
rs1247151651 322 dbSNP
rs886627844 324 dbSNP
rs1489817192 328 dbSNP
rs1005133519 334 dbSNP
rs1205486649 338 dbSNP
rs552245007 351 dbSNP
rs973460882 352 dbSNP
rs1292861252 358 dbSNP
rs1220397262 359 dbSNP
rs1246998371 367 dbSNP
rs919747464 384 dbSNP
rs1489877358 385 dbSNP
rs568129387 389 dbSNP
rs990697857 389 dbSNP
rs916465262 404 dbSNP
rs531685991 414 dbSNP
rs898131585 419 dbSNP
rs1246011088 447 dbSNP
rs1415042582 450 dbSNP
rs949323427 452 dbSNP
rs1198673038 465 dbSNP
rs1479402039 474 dbSNP
rs1253756185 476 dbSNP
rs1486164521 479 dbSNP
rs1187982656 480 dbSNP
rs200337684 481 dbSNP
rs201481721 482 dbSNP
rs1448713269 485 dbSNP
rs995586142 485 dbSNP
rs1028052073 486 dbSNP
rs953943675 487 dbSNP
rs1312325854 489 dbSNP
rs986597090 496 dbSNP
rs1019389498 515 dbSNP
rs966556480 521 dbSNP
rs548293341 531 dbSNP
rs1352828644 535 dbSNP
rs1422180418 537 dbSNP
rs977944293 541 dbSNP
rs1371457372 553 dbSNP
rs893582603 565 dbSNP
rs886545510 566 dbSNP
rs1449011005 569 dbSNP
rs1433520992 570 dbSNP
rs1287418533 586 dbSNP
rs996728057 586 dbSNP
rs773126739 593 dbSNP
rs1247249264 618 dbSNP
rs1159570211 620 dbSNP
rs1418354217 620 dbSNP
rs1248136805 625 dbSNP
rs1317404105 627 dbSNP
rs568301584 629 dbSNP
rs536783953 630 dbSNP
rs1242026031 642 dbSNP
rs890699081 654 dbSNP
rs534153227 657 dbSNP
rs1331863261 658 dbSNP
rs554042824 659 dbSNP
rs1238951145 660 dbSNP
rs1315562254 666 dbSNP
rs916613129 676 dbSNP
rs1285055995 681 dbSNP
rs1396867681 686 dbSNP
rs1382258954 692 dbSNP
rs949478114 693 dbSNP
rs747832344 703 dbSNP
rs1046513709 705 dbSNP
rs1437294326 711 dbSNP
rs1061239 722 dbSNP
rs962039096 728 dbSNP
rs778071090 735 dbSNP
rs1217854427 736 dbSNP
rs1361891804 742 dbSNP
rs994853991 751 dbSNP
rs570850350 753 dbSNP
rs958841410 757 dbSNP
rs1465913000 773 dbSNP
rs991060308 773 dbSNP
rs1433280723 787 dbSNP
rs766107378 798 dbSNP
rs940848679 802 dbSNP
rs1464255601 804 dbSNP
rs550349489 808 dbSNP
rs899436145 810 dbSNP
rs982029237 813 dbSNP
rs1230869412 816 dbSNP
rs1366088448 818 dbSNP
rs1244557664 819 dbSNP
rs1381613125 819 dbSNP
rs1382635314 826 dbSNP
rs1442421642 826 dbSNP
rs1295081122 828 dbSNP
rs995156739 832 dbSNP
rs148546053 833 dbSNP
rs1160629508 835 dbSNP
rs1161350759 838 dbSNP
rs1450923954 839 dbSNP
rs1191796952 841 dbSNP
rs1373192320 841 dbSNP
rs1346023744 842 dbSNP
rs183523428 848 dbSNP
rs1008391279 849 dbSNP
rs1157544085 851 dbSNP
rs1053477000 854 dbSNP
rs1019358342 864 dbSNP
rs1388617666 872 dbSNP
rs1207608186 875 dbSNP
rs529656451 880 dbSNP
rs1269692631 882 dbSNP
rs1225255862 909 dbSNP
rs999331908 910 dbSNP
rs1032191593 911 dbSNP
rs1405473173 922 dbSNP
rs1396711979 924 dbSNP
rs1431288004 924 dbSNP
rs1453061240 924 dbSNP
rs958181470 924 dbSNP
rs576002978 925 dbSNP
rs541544246 931 dbSNP
rs1378847616 933 dbSNP
rs1009369945 934 dbSNP
rs1480377675 934 dbSNP
rs145172355 936 dbSNP
rs11330414 937 dbSNP
rs1263812607 937 dbSNP
rs1347294967 937 dbSNP
rs1447802357 937 dbSNP
rs201497156 937 dbSNP
rs755957593 937 dbSNP
rs796502625 937 dbSNP
rs1380779782 938 dbSNP
rs1281170046 939 dbSNP
rs1444036662 939 dbSNP
rs1447574539 939 dbSNP
rs1050996504 940 dbSNP
rs1327851425 941 dbSNP
rs77535595 949 dbSNP
rs1403768148 950 dbSNP
rs369815824 950 dbSNP
rs375271796 950 dbSNP
rs796431684 951 dbSNP
rs1232647205 953 dbSNP
rs1427740821 953 dbSNP
rs75642934 953 dbSNP
rs878964591 953 dbSNP
rs1179995766 960 dbSNP
rs1444315809 965 dbSNP
rs1443277368 966 dbSNP
rs77364289 967 dbSNP
rs1222184098 969 dbSNP
rs1266131413 970 dbSNP
rs1261105455 971 dbSNP
rs1328429967 971 dbSNP
rs1204008424 978 dbSNP
rs1264786002 979 dbSNP
rs890624608 981 dbSNP
rs1351194245 982 dbSNP
rs1459651146 983 dbSNP
rs1186400436 985 dbSNP
rs1233162564 987 dbSNP
rs1470868493 993 dbSNP
rs1175018677 997 dbSNP
rs1411803836 998 dbSNP
rs1470594664 1000 dbSNP
rs1336832706 1005 dbSNP
rs1451189976 1011 dbSNP
rs1403257028 1013 dbSNP
rs1320915187 1015 dbSNP
rs1178942432 1017 dbSNP
rs1401776515 1020 dbSNP
rs187831497 1031 dbSNP
rs774070931 1034 dbSNP
rs190978725 1037 dbSNP
rs1183070632 1045 dbSNP
rs1036587166 1050 dbSNP
rs1249966011 1051 dbSNP
rs1337795178 1052 dbSNP
rs970786009 1062 dbSNP
rs141880383 1069 dbSNP
rs982569587 1070 dbSNP
rs1203097773 1097 dbSNP
rs898111849 1098 dbSNP
rs564280529 1099 dbSNP
rs570219193 1101 dbSNP
rs1244768729 1108 dbSNP
rs1379998545 1111 dbSNP
rs1271403526 1113 dbSNP
rs1432154645 1114 dbSNP
rs754873204 1116 dbSNP
rs543723997 1125 dbSNP
rs1316702652 1128 dbSNP
rs1426874745 1129 dbSNP
rs1366578593 1136 dbSNP
rs1163242950 1139 dbSNP
rs1037888727 1143 dbSNP
rs1392135186 1144 dbSNP
rs1242082542 1150 dbSNP
rs1187133223 1153 dbSNP
rs770208449 1155 dbSNP
rs183085494 1173 dbSNP
rs1213549511 1175 dbSNP
rs1490794938 1177 dbSNP
rs1349734724 1178 dbSNP
rs932207216 1181 dbSNP
rs1224054011 1183 dbSNP
rs1356779794 1184 dbSNP
rs1285188340 1186 dbSNP
rs1214590738 1189 dbSNP
rs74432476 1189 dbSNP
rs1361877329 1190 dbSNP
rs1191474424 1191 dbSNP
rs1269003050 1191 dbSNP
rs1302882436 1191 dbSNP
rs1409521897 1191 dbSNP
rs1417443052 1191 dbSNP
rs1481357235 1191 dbSNP
rs34952294 1191 dbSNP
rs376675183 1191 dbSNP
rs397874199 1191 dbSNP
rs397877472 1191 dbSNP
rs749744480 1191 dbSNP
rs752482363 1191 dbSNP
rs777546256 1191 dbSNP
rs869107465 1191 dbSNP
rs878894327 1191 dbSNP
rs879214590 1191 dbSNP
rs1342599103 1192 dbSNP
rs1199714041 1193 dbSNP
rs1273235384 1194 dbSNP
rs1439230136 1195 dbSNP
rs1202328186 1197 dbSNP
rs1250446896 1205 dbSNP
rs1480513311 1206 dbSNP
rs1198365921 1207 dbSNP
rs62767263 1207 dbSNP
rs1202224952 1209 dbSNP
rs1234190644 1210 dbSNP
rs1427866757 1210 dbSNP
rs959037768 1211 dbSNP
rs1050740008 1212 dbSNP
rs1022589102 1213 dbSNP
rs1270247481 1214 dbSNP
rs1398857724 1215 dbSNP
rs1408433121 1218 dbSNP
rs1225920629 1224 dbSNP
rs1307434461 1226 dbSNP
rs1324836751 1228 dbSNP
rs531768936 1229 dbSNP
rs1406912760 1230 dbSNP
rs146071445 1254 dbSNP
rs1023435698 1266 dbSNP
rs1232191986 1267 dbSNP
rs1007895181 1278 dbSNP
rs1178633102 1282 dbSNP
rs1270561619 1284 dbSNP
rs1340973680 1305 dbSNP
rs1040746183 1308 dbSNP
rs1429843203 1318 dbSNP
rs1175452511 1328 dbSNP
rs1431297475 1333 dbSNP
rs902284051 1337 dbSNP
rs923832992 1337 dbSNP
rs747253336 1338 dbSNP
rs956646417 1338 dbSNP
rs1273557230 1340 dbSNP
rs989543141 1351 dbSNP
rs999259747 1352 dbSNP
rs1263133126 1354 dbSNP
rs568262111 1355 dbSNP
rs1224138139 1361 dbSNP
rs527872024 1363 dbSNP
rs772824838 1367 dbSNP
rs1194260831 1375 dbSNP
rs1371400838 1376 dbSNP
rs1338801258 1377 dbSNP
rs1453384877 1380 dbSNP
rs1405439459 1381 dbSNP
rs1336068872 1383 dbSNP
rs1375154802 1384 dbSNP
rs1365364871 1390 dbSNP
rs1448110249 1396 dbSNP
rs1418161663 1399 dbSNP
rs957933438 1401 dbSNP
rs914920379 1403 dbSNP
rs1444774273 1404 dbSNP
rs1386133273 1407 dbSNP
rs1241961789 1410 dbSNP
rs1199280127 1413 dbSNP
rs1487111741 1417 dbSNP
rs931684155 1427 dbSNP
rs1426601093 1433 dbSNP
rs1050202678 1441 dbSNP
rs912033195 1442 dbSNP
rs1388433050 1453 dbSNP
rs1386157783 1467 dbSNP
rs1382192539 1471 dbSNP
rs1312973349 1494 dbSNP
rs1012568668 1502 dbSNP
rs1394252107 1506 dbSNP
rs188027625 1507 dbSNP
rs1327979846 1519 dbSNP
rs971098546 1521 dbSNP
rs1432687683 1524 dbSNP
rs1165133345 1533 dbSNP
rs1424864330 1543 dbSNP
rs1036512138 1544 dbSNP
rs1296390598 1547 dbSNP
rs1184713949 1560 dbSNP
rs1430827736 1562 dbSNP
rs1262966145 1567 dbSNP
rs749277869 1573 dbSNP
rs1294376585 1585 dbSNP
rs898080551 1593 dbSNP
rs191951009 1594 dbSNP
rs1049501275 1597 dbSNP
rs1263171557 1598 dbSNP
rs1327095205 1599 dbSNP
rs1296281661 1602 dbSNP
rs1381554039 1604 dbSNP
rs1356193022 1607 dbSNP
rs894480964 1610 dbSNP
rs1013396550 1611 dbSNP
rs907934077 1618 dbSNP
rs1264561534 1619 dbSNP
rs141404211 1622 dbSNP
rs1373143796 1632 dbSNP
rs962110671 1649 dbSNP
rs907308781 1650 dbSNP
rs1271538046 1653 dbSNP
rs1003373029 1657 dbSNP
rs534128948 1659 dbSNP
rs1030872133 1665 dbSNP
rs539709049 1667 dbSNP
rs920759106 1668 dbSNP
rs932204324 1688 dbSNP
rs1217965979 1698 dbSNP
rs989415539 1699 dbSNP
rs1284969277 1709 dbSNP
rs755858421 1710 dbSNP
rs1344635931 1715 dbSNP
rs1194761231 1717 dbSNP
rs1392754828 1719 dbSNP
rs1243919497 1723 dbSNP
rs953086105 1729 dbSNP
rs1297067695 1739 dbSNP
rs1446701617 1740 dbSNP
rs912164592 1742 dbSNP
rs1162704258 1743 dbSNP
rs1177778404 1743 dbSNP
rs943672587 1746 dbSNP
rs1376259995 1750 dbSNP
rs1040675462 1755 dbSNP
rs902211375 1757 dbSNP
rs1438565038 1766 dbSNP
rs911624386 1767 dbSNP
rs935077793 1769 dbSNP
rs944498875 1770 dbSNP
rs1456393978 1771 dbSNP
rs1454435083 1773 dbSNP
rs182801963 1780 dbSNP
rs1159046272 1783 dbSNP
rs1272827847 1783 dbSNP
rs187483485 1787 dbSNP
rs192447780 1788 dbSNP
rs893595120 1796 dbSNP
rs1012082708 1797 dbSNP
rs1319680909 1806 dbSNP
rs1382982173 1811 dbSNP
rs569527925 1812 dbSNP
rs1049337128 1829 dbSNP
rs894440386 1836 dbSNP
rs199842413 1840 dbSNP
rs1339359792 1844 dbSNP
rs1045797675 1845 dbSNP
rs1160603808 1854 dbSNP
rs1470641630 1856 dbSNP
rs906466595 1863 dbSNP
rs1177000912 1867 dbSNP
rs570825580 1870 dbSNP
rs998947432 1872 dbSNP
rs1327726039 1873 dbSNP
rs1014915634 1885 dbSNP
rs1264142980 1894 dbSNP
rs1462984305 1904 dbSNP
rs1180335935 1913 dbSNP
rs1441731780 1914 dbSNP
rs1276272133 1923 dbSNP
rs1255789906 1928 dbSNP
rs373810985 1928 dbSNP
rs111238275 1936 dbSNP
rs892316272 1945 dbSNP
rs973478453 1948 dbSNP
rs748909895 1962 dbSNP
rs1237477427 1968 dbSNP
rs1027747307 1974 dbSNP
rs1384414004 1976 dbSNP
rs1011210114 1982 dbSNP
rs1447966743 1991 dbSNP
rs1414043733 1998 dbSNP
rs953647661 2007 dbSNP
rs1320696237 2009 dbSNP
rs1401722941 2010 dbSNP
rs1022200222 2024 dbSNP
rs555490048 2026 dbSNP
rs140031561 2032 dbSNP
rs1385975458 2038 dbSNP
rs1426756720 2038 dbSNP
rs34765518 2038 dbSNP
rs953443261 2043 dbSNP
rs1472435323 2048 dbSNP
rs1235601474 2049 dbSNP
rs565551243 2055 dbSNP
rs541128956 2057 dbSNP
rs1285005631 2060 dbSNP
rs1214040136 2062 dbSNP
rs912075642 2069 dbSNP
rs944940603 2071 dbSNP
rs1227179026 2072 dbSNP
rs1401112998 2072 dbSNP
rs919397452 2075 dbSNP
rs977681274 2077 dbSNP
rs1340347557 2081 dbSNP
rs930842009 2083 dbSNP
rs201640455 2085 dbSNP
rs1031055342 2086 dbSNP
rs138186230 2086 dbSNP
rs71138445 2086 dbSNP
rs145249575 2092 dbSNP
rs916161574 2101 dbSNP
rs1403742888 2102 dbSNP
rs949019437 2105 dbSNP
rs1169619573 2112 dbSNP
rs1045726587 2113 dbSNP
rs1475677586 2113 dbSNP
rs1228308449 2115 dbSNP
rs557959105 2120 dbSNP
rs923597830 2125 dbSNP
rs1269237542 2129 dbSNP
rs935005334 2131 dbSNP
rs1274464564 2132 dbSNP
rs1215705889 2133 dbSNP
rs1317793979 2143 dbSNP
rs376984426 2143 dbSNP
rs1225663552 2146 dbSNP
rs1346538432 2151 dbSNP
rs137910993 2152 dbSNP
rs200881078 2154 dbSNP
rs77557880 2154 dbSNP
rs10690694 2155 dbSNP
rs63593560 2155 dbSNP
rs74860050 2155 dbSNP
rs760536089 2155 dbSNP
rs200115036 2156 dbSNP
rs1329567926 2159 dbSNP
rs1255580680 2169 dbSNP
rs1466084608 2175 dbSNP
rs1481100994 2177 dbSNP
rs114979767 2181 dbSNP
rs1481327071 2186 dbSNP
rs1425584040 2199 dbSNP
rs1043993404 2201 dbSNP
rs1487280239 2202 dbSNP
rs1457716400 2204 dbSNP
rs185730549 2204 dbSNP
rs202192401 2210 dbSNP
rs146737823 2212 dbSNP
rs377126332 2212 dbSNP
rs777625524 2212 dbSNP
rs965704765 2216 dbSNP
rs1300969831 2217 dbSNP
rs1429953942 2223 dbSNP
rs993179992 2225 dbSNP
rs947853295 2226 dbSNP
rs1026052637 2227 dbSNP
rs1446216052 2231 dbSNP
rs1398183335 2236 dbSNP
rs1329289197 2239 dbSNP
rs951926146 2240 dbSNP
rs1044895471 2249 dbSNP
rs1175035466 2257 dbSNP
rs1431109144 2265 dbSNP
rs1409621762 2273 dbSNP
rs1173718395 2275 dbSNP
rs984966825 2276 dbSNP
rs373938629 2284 dbSNP
rs1235793134 2291 dbSNP
rs1491465633 2295 dbSNP
rs563630808 2296 dbSNP
rs761766124 2296 dbSNP
rs1483836401 2297 dbSNP
rs1368162690 2299 dbSNP
rs906385275 2300 dbSNP
rs1208372273 2304 dbSNP
rs1003458837 2318 dbSNP
rs1285287095 2319 dbSNP
rs1239663781 2321 dbSNP
rs1370394314 2322 dbSNP
rs544072894 2333 dbSNP
rs531606400 2338 dbSNP
rs541861404 2339 dbSNP
rs539246241 2342 dbSNP
rs1272835982 2344 dbSNP
rs1464416098 2345 dbSNP
rs527734503 2346 dbSNP
rs1346734486 2351 dbSNP
rs1158928344 2352 dbSNP
rs547499385 2357 dbSNP
rs981708491 2358 dbSNP
rs1184840196 2362 dbSNP
rs1424903092 2363 dbSNP
rs1256146418 2364 dbSNP
rs1482751854 2365 dbSNP
rs928589318 2367 dbSNP
rs934635328 2374 dbSNP
rs12496357 2375 dbSNP
rs564504832 2381 dbSNP
rs1053552730 2385 dbSNP
rs1028123109 2402 dbSNP
rs953474399 2403 dbSNP
rs1266420913 2407 dbSNP
rs1351725959 2407 dbSNP
rs1428973248 2408 dbSNP
rs1170066726 2409 dbSNP
rs1246720025 2410 dbSNP
rs947492073 2411 dbSNP
rs1311994216 2418 dbSNP
rs147915446 2420 dbSNP
rs986643660 2428 dbSNP
rs1163704231 2432 dbSNP
rs1363850700 2436 dbSNP
rs548632743 2440 dbSNP
rs1399025268 2448 dbSNP
rs1434964237 2448 dbSNP
rs1165076750 2450 dbSNP
rs1293518209 2452 dbSNP
rs1363086217 2454 dbSNP
rs772683662 2455 dbSNP
rs1019109371 2460 dbSNP
rs966213194 2463 dbSNP
rs533601555 2465 dbSNP
rs1163337872 2467 dbSNP
rs1430773986 2471 dbSNP
rs1295645805 2472 dbSNP
rs1193328993 2474 dbSNP
rs1487436133 2475 dbSNP
rs1271404044 2479 dbSNP
rs550204146 2481 dbSNP
rs1488226489 2484 dbSNP
rs1040283202 2496 dbSNP
rs1242539597 2503 dbSNP
rs1319831556 2507 dbSNP
rs901799179 2514 dbSNP
rs16862676 2517 dbSNP
rs536162171 2530 dbSNP
rs989176263 2531 dbSNP
rs951794130 2533 dbSNP
rs1389430814 2538 dbSNP
rs548951675 2540 dbSNP
rs747055087 2549 dbSNP
rs1463991948 2552 dbSNP
rs1486061554 2557 dbSNP
rs1190301617 2560 dbSNP
rs565699723 2562 dbSNP
rs1431879643 2563 dbSNP
rs1199904290 2571 dbSNP
rs1023109733 2582 dbSNP
rs1265372739 2584 dbSNP
rs1197557579 2587 dbSNP
rs947813899 2589 dbSNP
rs1458263315 2590 dbSNP
rs1045256850 2592 dbSNP
rs981634945 2593 dbSNP
rs1276351426 2594 dbSNP
rs765993115 2596 dbSNP
rs1372424122 2613 dbSNP
rs927774542 2617 dbSNP
rs1164653033 2623 dbSNP
rs534674457 2623 dbSNP
rs956315563 2626 dbSNP
rs1400379497 2630 dbSNP
rs776734642 2634 dbSNP
rs762031671 2636 dbSNP
rs1464495377 2638 dbSNP
rs1408803946 2639 dbSNP
rs1036242552 2640 dbSNP
rs897757590 2642 dbSNP
rs1318997891 2644 dbSNP
rs557870401 2647 dbSNP
rs1049039616 2649 dbSNP
rs774087783 2651 dbSNP
rs1440450897 2653 dbSNP
rs1177969193 2665 dbSNP
rs751271111 2665 dbSNP
rs759523293 2666 dbSNP
rs572522867 2671 dbSNP
rs577744549 2675 dbSNP
rs34207847 2676 dbSNP
rs1253942985 2682 dbSNP
rs1241844626 2683 dbSNP
rs929231162 2692 dbSNP
rs1307851622 2695 dbSNP
rs1007632972 2696 dbSNP
rs1390798362 2700 dbSNP
rs1019452290 2704 dbSNP
rs966141498 2705 dbSNP
rs537299514 2708 dbSNP
rs1160552968 2709 dbSNP
rs1023122741 2711 dbSNP
rs1289000704 2712 dbSNP
rs1156869458 2715 dbSNP
rs556966122 2718 dbSNP
rs528265549 2719 dbSNP
rs1239207396 2724 dbSNP
rs1003039609 2726 dbSNP
rs752306033 2729 dbSNP
rs1266026287 2738 dbSNP
rs1464320588 2742 dbSNP
rs754222696 2745 dbSNP
rs990832947 2746 dbSNP
rs146878408 2751 dbSNP
rs542516614 2753 dbSNP
rs969138140 2757 dbSNP
rs980513631 2759 dbSNP
rs531744746 2766 dbSNP
rs1357830025 2768 dbSNP
rs1285348035 2775 dbSNP
rs1447904046 2779 dbSNP
rs759852423 2784 dbSNP
rs540451919 2786 dbSNP
rs1388341171 2790 dbSNP
rs1470543893 2798 dbSNP
rs1360063172 2803 dbSNP
rs944158184 2804 dbSNP
rs939145050 2805 dbSNP
rs1036183385 2812 dbSNP
rs919115037 2813 dbSNP
rs1414603889 2816 dbSNP
rs1163816551 2818 dbSNP
rs749637857 2821 dbSNP
rs1472404897 2827 dbSNP
rs930573692 2831 dbSNP
rs1049484168 2836 dbSNP
rs1366524710 2837 dbSNP
rs1195490671 2844 dbSNP
rs1488490181 2845 dbSNP
rs975851316 2850 dbSNP
rs1357671225 2854 dbSNP
rs1447338973 2857 dbSNP
rs189270933 2858 dbSNP
rs929213725 2861 dbSNP
rs1007972955 2864 dbSNP
rs565113271 2866 dbSNP
rs1350974198 2870 dbSNP
rs35041894 2872 dbSNP
rs1048119866 2873 dbSNP
rs1280497773 2879 dbSNP
rs1040411325 2884 dbSNP
rs901946675 2885 dbSNP
rs115225160 2886 dbSNP
rs577093472 2888 dbSNP
rs957575842 2889 dbSNP
rs1280240149 2893 dbSNP
rs1404710725 2898 dbSNP
rs1440364968 2910 dbSNP
rs1392278863 2918 dbSNP
rs905604392 2919 dbSNP
rs1011824217 2920 dbSNP
rs1232963293 2922 dbSNP
rs1483782260 2932 dbSNP
rs139387714 2934 dbSNP
rs1478778123 2935 dbSNP
rs891987526 2935 dbSNP
rs969042679 2944 dbSNP
rs1220102624 2948 dbSNP
rs980865820 2950 dbSNP
rs1260612369 2952 dbSNP
rs1199796597 2964 dbSNP
rs1317740372 2970 dbSNP
rs1010460751 2976 dbSNP
rs1480942262 2978 dbSNP
rs756920628 2979 dbSNP
rs1274478988 2987 dbSNP
rs550306361 2995 dbSNP
rs369529623 3003 dbSNP
rs371259158 3003 dbSNP
rs1402516585 3005 dbSNP
rs1333325545 3014 dbSNP
rs969024326 3021 dbSNP
rs960425659 3033 dbSNP
rs1415824119 3054 dbSNP
rs1018236233 3079 dbSNP
rs1190260953 3083 dbSNP
rs544543953 3084 dbSNP
rs563731290 3085 dbSNP
rs1239435996 3088 dbSNP
rs1179855423 3090 dbSNP
rs559261897 3093 dbSNP
rs1457675742 3096 dbSNP
rs1329863096 3097 dbSNP
rs976822411 3103 dbSNP
rs1313132555 3105 dbSNP
rs919084060 3112 dbSNP
rs562632132 3114 dbSNP
rs1217653732 3121 dbSNP
rs529581089 3121 dbSNP
rs549715531 3122 dbSNP
rs1379245342 3125 dbSNP
rs1310012036 3126 dbSNP
rs1447440382 3131 dbSNP
rs1327101435 3133 dbSNP
rs1375970638 3141 dbSNP
rs1296378276 3142 dbSNP
rs923078948 3143 dbSNP
rs1359502864 3148 dbSNP
rs1174964852 3158 dbSNP
rs1432439915 3162 dbSNP
rs1158664263 3165 dbSNP
rs866548901 3165 dbSNP
rs930478197 3166 dbSNP
rs10513368 3175 dbSNP
rs1184083953 3179 dbSNP
rs1233650129 3185 dbSNP
rs1483803985 3186 dbSNP
rs1237219562 3200 dbSNP
rs983327370 3204 dbSNP
rs1356051238 3210 dbSNP
rs200802218 3210 dbSNP
rs746005919 3210 dbSNP
rs1239597574 3212 dbSNP
rs1301998595 3217 dbSNP
rs1304849936 3217 dbSNP
rs1379663003 3217 dbSNP
rs1412558152 3217 dbSNP
rs534635624 3217 dbSNP
rs5853479 3217 dbSNP
rs71619502 3217 dbSNP
rs879637624 3217 dbSNP
rs752995 3218 dbSNP
rs13095246 3219 dbSNP
rs774393370 3220 dbSNP
rs796457086 3220 dbSNP
rs1361524383 3221 dbSNP
rs1167562275 3229 dbSNP
rs1424852056 3233 dbSNP
rs1413541075 3234 dbSNP
rs910476892 3247 dbSNP
rs943353337 3248 dbSNP
rs1218260234 3254 dbSNP
rs1274987068 3268 dbSNP
rs1216137733 3275 dbSNP
rs536756554 3277 dbSNP
rs901877598 3282 dbSNP
rs117014419 3284 dbSNP
rs1452702757 3287 dbSNP
rs926949789 3292 dbSNP
rs1245332982 3296 dbSNP
rs1231301642 3298 dbSNP
rs1477945165 3299 dbSNP
rs1168682019 3307 dbSNP
rs1398960055 3309 dbSNP
rs1392312674 3314 dbSNP
rs1053167345 3316 dbSNP
rs573522979 3324 dbSNP
rs938388869 3326 dbSNP
rs1458870376 3335 dbSNP
rs192357640 3337 dbSNP
rs1012162189 3343 dbSNP
rs780412661 3351 dbSNP
rs75802342 3369 dbSNP
rs1325506602 3375 dbSNP
rs572104524 3384 dbSNP
rs1043271254 3385 dbSNP
rs1329128105 3386 dbSNP
rs1435546756 3390 dbSNP
rs1210441294 3393 dbSNP
rs1488197845 3395 dbSNP
rs1297845866 3401 dbSNP
rs904737044 3402 dbSNP
rs1211705624 3406 dbSNP
rs565850594 3407 dbSNP
rs1034681326 3408 dbSNP
rs1226252255 3409 dbSNP
rs1273307927 3410 dbSNP
rs1356509047 3411 dbSNP
rs564330819 3412 dbSNP
rs1302947789 3420 dbSNP
rs1288400597 3421 dbSNP
rs1386903909 3428 dbSNP
rs1366260981 3433 dbSNP
rs965361359 3434 dbSNP
rs1467607568 3438 dbSNP
rs1401512630 3444 dbSNP
rs1170345895 3452 dbSNP
rs1460666555 3453 dbSNP
rs1379661393 3454 dbSNP
rs184742204 3457 dbSNP
rs1432710998 3467 dbSNP
rs1251171811 3469 dbSNP
rs768624708 3480 dbSNP
rs1250088039 3485 dbSNP
rs145301295 3488 dbSNP
rs1187939727 3493 dbSNP
rs1026069718 3504 dbSNP
rs1258469951 3506 dbSNP
rs781293723 3509 dbSNP
rs1337188250 3511 dbSNP
rs1257442448 3516 dbSNP
rs951534168 3525 dbSNP
rs1459567564 3527 dbSNP
rs1164892975 3528 dbSNP
rs1300568319 3529 dbSNP
rs1449668680 3529 dbSNP
rs543572258 3538 dbSNP
rs910414262 3548 dbSNP
rs1404511269 3552 dbSNP
rs963586821 3553 dbSNP
rs943263776 3555 dbSNP
rs980035442 3560 dbSNP
rs926917683 3561 dbSNP
rs1296502847 3572 dbSNP
rs748395127 3574 dbSNP
rs1340516477 3576 dbSNP
rs1393359369 3577 dbSNP
rs1420325885 3582 dbSNP
rs4414875 3586 dbSNP
rs1056844389 3589 dbSNP
rs1282893547 3597 dbSNP
rs912973138 3604 dbSNP
rs1257963660 3610 dbSNP
rs781517886 3621 dbSNP
rs529547863 3622 dbSNP
rs1209677818 3630 dbSNP
rs1241775341 3636 dbSNP
rs1353788155 3637 dbSNP
rs1279541174 3638 dbSNP
rs1270434911 3639 dbSNP
rs543322899 3643 dbSNP
rs1053094169 3644 dbSNP
rs1414398827 3654 dbSNP
rs1257169619 3655 dbSNP
rs1373945223 3666 dbSNP
rs1300260883 3676 dbSNP
rs1420436493 3678 dbSNP
rs1425605527 3679 dbSNP
rs1185536506 3688 dbSNP
rs1366579489 3694 dbSNP
rs1157960423 3697 dbSNP
rs1468493702 3704 dbSNP
rs1474849180 3708 dbSNP
rs1369992997 3711 dbSNP
rs1159898947 3714 dbSNP
rs893230084 3715 dbSNP
rs1255035317 3719 dbSNP
rs1218319414 3723 dbSNP
rs1282877491 3725 dbSNP
rs1488357016 3725 dbSNP
rs1455480940 3735 dbSNP
rs1285294600 3737 dbSNP
rs1233118820 3739 dbSNP
rs1039917849 3743 dbSNP
rs947552387 3757 dbSNP
rs527351365 3774 dbSNP
rs557497082 3778 dbSNP
rs901455642 3785 dbSNP
rs1319447749 3786 dbSNP
rs1400794338 3788 dbSNP
rs146542408 3789 dbSNP
rs1316239327 3792 dbSNP
rs201290917 3793 dbSNP
rs80003920 3794 dbSNP
rs1398887967 3823 dbSNP
rs77608774 3829 dbSNP
rs906070277 3830 dbSNP
rs79182970 3841 dbSNP
rs551315530 3842 dbSNP
rs1016489178 3849 dbSNP
rs896112430 3850 dbSNP
rs1477908328 3856 dbSNP
rs1229533725 3860 dbSNP
rs993179371 3876 dbSNP
rs1026033013 3877 dbSNP
rs951873019 3880 dbSNP
rs150048655 3881 dbSNP
rs1452819758 3883 dbSNP
rs530600554 3889 dbSNP
rs1256757026 3895 dbSNP
rs1333187643 3898 dbSNP
rs1034251300 3899 dbSNP
rs964611759 3918 dbSNP
rs188758000 3921 dbSNP
rs1198746536 3922 dbSNP
rs763533518 3923 dbSNP
rs992488921 3927 dbSNP
rs923196707 3937 dbSNP
rs1483463784 3946 dbSNP
rs956018104 3951 dbSNP
rs988787652 3954 dbSNP
rs1460824670 3964 dbSNP
rs1392030525 3965 dbSNP
rs753364917 3970 dbSNP
rs1418420328 3975 dbSNP
rs370727247 3979 dbSNP
rs1246741642 3984 dbSNP
rs1478747008 3984 dbSNP
rs1326994642 3989 dbSNP
rs1467482341 3989 dbSNP
rs1240417902 3991 dbSNP
rs1199739345 3997 dbSNP
rs907835378 3997 dbSNP
rs1414157676 3999 dbSNP
rs1471461239 4000 dbSNP
rs947453972 4000 dbSNP
rs1158146485 4003 dbSNP
rs1167919738 4004 dbSNP
rs1353674267 4004 dbSNP
rs1415772801 4004 dbSNP
rs199550410 4004 dbSNP
rs59588626 4004 dbSNP
rs775638140 4004 dbSNP
rs62922062 4005 dbSNP
rs945760670 4007 dbSNP
rs1382764317 4008 dbSNP
rs1377773023 4009 dbSNP
rs1212543837 4011 dbSNP
rs1467270695 4011 dbSNP
rs71304214 4019 dbSNP
rs868228744 4020 dbSNP
rs1436814832 4021 dbSNP
rs1355917055 4022 dbSNP
rs1409943486 4022 dbSNP
rs1310362628 4023 dbSNP
rs115850292 4024 dbSNP
rs1224231658 4024 dbSNP
rs1372372692 4028 dbSNP
rs1296180420 4029 dbSNP
rs181372357 4043 dbSNP
rs978546719 4044 dbSNP
rs536089296 4045 dbSNP
rs552838539 4046 dbSNP
rs1302432138 4050 dbSNP
rs1314371115 4064 dbSNP
rs1361865889 4066 dbSNP
rs1044517882 4067 dbSNP
rs1418959952 4068 dbSNP
rs1406241890 4073 dbSNP
rs927417629 4084 dbSNP
rs1255671624 4085 dbSNP
rs1475730288 4091 dbSNP
rs1257135930 4093 dbSNP
rs1342934881 4094 dbSNP
rs566386230 4097 dbSNP
rs1489329190 4101 dbSNP
rs1207413243 4102 dbSNP
rs1253835685 4104 dbSNP
rs1304779828 4118 dbSNP
rs938832053 4119 dbSNP
rs1176351400 4120 dbSNP
rs1355831795 4134 dbSNP
rs1292342822 4139 dbSNP
rs1057374366 4141 dbSNP
rs1361928842 4143 dbSNP
rs897424127 4144 dbSNP
rs1452419782 4147 dbSNP
rs1434756527 4150 dbSNP
rs1173476783 4152 dbSNP
rs1394147613 4158 dbSNP
rs1462329386 4160 dbSNP
rs1417540006 4161 dbSNP
rs994449531 4171 dbSNP
rs1047829771 4185 dbSNP
rs1186101132 4187 dbSNP
rs1478891541 4187 dbSNP
rs112434187 4202 dbSNP
rs925720927 4209 dbSNP
rs887490914 4210 dbSNP
rs1429768777 4211 dbSNP
rs538556725 4229 dbSNP
rs1484927341 4233 dbSNP
rs34854199 4241 dbSNP
rs1258944428 4244 dbSNP
rs1006375795 4246 dbSNP
rs764977560 4247 dbSNP
rs186037034 4250 dbSNP
rs1442103508 4251 dbSNP
rs1231091665 4254 dbSNP
rs997324900 4264 dbSNP
rs901424706 4265 dbSNP
rs934252500 4274 dbSNP
rs1030178616 4283 dbSNP
rs1295831460 4284 dbSNP
rs577970321 4290 dbSNP
rs887134531 4292 dbSNP
rs113298198 4293 dbSNP
rs914548792 4294 dbSNP
rs758847473 4312 dbSNP
rs1017008016 4314 dbSNP
rs905303438 4317 dbSNP
rs1269490151 4320 dbSNP
rs1001367594 4322 dbSNP
rs559028670 4323 dbSNP
rs1230618917 4333 dbSNP
rs1034220332 4339 dbSNP
rs959912877 4346 dbSNP
rs1251582919 4349 dbSNP
rs1272587743 4349 dbSNP
rs1226181325 4357 dbSNP
rs1305290808 4366 dbSNP
rs968753554 4368 dbSNP
rs12629077 4369 dbSNP
rs1442302773 4374 dbSNP
rs1266003226 4383 dbSNP
rs1489324701 4390 dbSNP
rs574284704 4391 dbSNP
rs1324466129 4393 dbSNP
rs74873018 4396 dbSNP
rs146961858 4398 dbSNP
rs967055219 4405 dbSNP
rs1057306861 4414 dbSNP
rs978857179 4416 dbSNP
rs1174274343 4417 dbSNP
rs1251943201 4421 dbSNP
rs528736360 4439 dbSNP
rs1191649724 4442 dbSNP
rs1439369298 4443 dbSNP
rs1190177383 4446 dbSNP
rs781181707 4450 dbSNP
rs1282005116 4453 dbSNP
rs1048675558 4456 dbSNP
rs975519020 4457 dbSNP
rs1346479757 4459 dbSNP
rs922776694 4465 dbSNP
rs1301945090 4466 dbSNP
rs1408907722 4470 dbSNP
rs1336754119 4479 dbSNP
rs887406951 4482 dbSNP
rs147581605 4493 dbSNP
rs1404686849 4505 dbSNP
rs770055148 4508 dbSNP
rs1313684618 4520 dbSNP
rs887387179 4524 dbSNP
rs1352146341 4533 dbSNP
rs564864504 4543 dbSNP
rs1171723126 4554 dbSNP
rs1471083501 4562 dbSNP
rs1364178659 4569 dbSNP
rs900276482 4569 dbSNP
rs1038818244 4570 dbSNP
rs74686212 4571 dbSNP
rs997251581 4576 dbSNP
rs777981547 4577 dbSNP
rs1002299608 4578 dbSNP
rs1211127989 4583 dbSNP
rs1485071046 4585 dbSNP
rs1030104894 4601 dbSNP
rs1034158362 4604 dbSNP
rs1437530502 4607 dbSNP
rs891663006 4615 dbSNP
rs1010533824 4617 dbSNP
rs566399536 4622 dbSNP
rs1361323057 4626 dbSNP
rs1237417120 4629 dbSNP
rs895662655 4648 dbSNP
rs1014531167 4649 dbSNP
rs1414359464 4661 dbSNP
rs1353652253 4663 dbSNP
rs1020181294 4678 dbSNP
rs1401347041 4679 dbSNP
rs1021543608 4686 dbSNP
rs1385665532 4687 dbSNP
rs969097394 4691 dbSNP
rs550645993 4694 dbSNP
rs1323460411 4699 dbSNP
rs1451419058 4705 dbSNP
rs1219024581 4709 dbSNP
rs999856806 4723 dbSNP
rs567063620 4728 dbSNP
rs963725101 4731 dbSNP
rs1254788643 4740 dbSNP
rs534997434 4741 dbSNP
rs1447070559 4743 dbSNP
rs1284242776 4749 dbSNP
rs1210179185 4752 dbSNP
rs960092037 4753 dbSNP
rs992950307 4754 dbSNP
rs28454055 4755 dbSNP
rs1333041179 4759 dbSNP
rs1272141573 4769 dbSNP
rs1431626756 4781 dbSNP
rs566349333 4782 dbSNP
rs1432758797 4784 dbSNP
rs1396415395 4792 dbSNP
rs1165302509 4799 dbSNP
rs1460714239 4800 dbSNP
rs984740762 4802 dbSNP
rs538888944 4803 dbSNP
rs189232963 4811 dbSNP
rs941665341 4816 dbSNP
rs1413154449 4822 dbSNP
rs1191672666 4824 dbSNP
rs1470176948 4826 dbSNP
rs1254161976 4834 dbSNP
rs1038685807 4843 dbSNP
rs900202744 4845 dbSNP
rs182396088 4859 dbSNP
rs537099234 4864 dbSNP
rs938047095 4871 dbSNP
rs760577353 4883 dbSNP
rs768605953 4892 dbSNP
rs1344851427 4893 dbSNP
rs1338859163 4899 dbSNP
rs891589386 4911 dbSNP
rs896594598 4913 dbSNP
rs1014084851 4932 dbSNP
rs1010086974 4933 dbSNP
rs1373172052 4934 dbSNP
rs1021932599 4942 dbSNP
rs1326488453 4948 dbSNP
rs1439943089 4952 dbSNP
rs1041975270 4954 dbSNP
rs1330515477 4971 dbSNP
rs557483648 4980 dbSNP
rs4681620 4991 dbSNP
rs1166238532 4993 dbSNP
rs543147349 4998 dbSNP
rs1231377544 5000 dbSNP
rs1032617015 5004 dbSNP
rs963694485 5007 dbSNP
rs960063055 5008 dbSNP
rs367546917 5014 dbSNP
rs1234919503 5020 dbSNP
rs1025736612 5021 dbSNP
rs1230031781 5023 dbSNP
rs1029350349 5033 dbSNP
rs1271126632 5034 dbSNP
rs187198751 5038 dbSNP
rs1281648998 5047 dbSNP
rs1213192126 5048 dbSNP
rs1348639501 5067 dbSNP
rs1304129864 5069 dbSNP
rs1233427794 5072 dbSNP
rs1446071795 5075 dbSNP
rs1281017631 5082 dbSNP
rs1210141578 5096 dbSNP
rs951607918 5096 dbSNP
rs1305763645 5099 dbSNP
rs955340346 5099 dbSNP
rs984320457 5100 dbSNP
rs910071454 5101 dbSNP
rs982964595 5102 dbSNP
rs908714497 5103 dbSNP
rs545660925 5104 dbSNP
rs1469941900 5105 dbSNP
rs1249936116 5106 dbSNP
rs1213256130 5107 dbSNP
rs974332832 5108 dbSNP
rs746477505 5111 dbSNP
rs975677405 5113 dbSNP
rs1210097030 5114 dbSNP
rs1310433886 5125 dbSNP
rs774707492 5130 dbSNP
rs544537244 5136 dbSNP
rs921565941 5137 dbSNP
rs1372315986 5145 dbSNP
rs1415267351 5146 dbSNP
rs145724666 5147 dbSNP
rs1355547583 5148 dbSNP
rs372319044 5158 dbSNP
rs539969717 5164 dbSNP
rs1312152422 5165 dbSNP
rs1160425752 5166 dbSNP
rs945815633 5177 dbSNP
rs1410150447 5184 dbSNP
rs1190341671 5191 dbSNP
rs761394932 5192 dbSNP
rs903033327 5196 dbSNP
rs1411360245 5197 dbSNP
rs770599010 5198 dbSNP
rs1180262915 5202 dbSNP
rs1042877561 5204 dbSNP
rs1277571398 5208 dbSNP
rs1486872754 5208 dbSNP
rs1216350963 5213 dbSNP
rs1316151753 5224 dbSNP
rs1265936313 5243 dbSNP
rs1234760296 5250 dbSNP
rs1000089321 5251 dbSNP
rs190882447 5252 dbSNP
rs1393831230 5256 dbSNP
rs1363418692 5259 dbSNP
rs1280345050 5261 dbSNP
rs543765192 5268 dbSNP
rs996467474 5275 dbSNP
rs1386929918 5279 dbSNP
rs866212008 5280 dbSNP
rs138971156 5282 dbSNP
rs1462292788 5290 dbSNP
rs1417465690 5293 dbSNP
rs1253109502 5297 dbSNP
rs890847916 5305 dbSNP
rs1183502663 5308 dbSNP
rs1430404592 5311 dbSNP
rs182637359 5312 dbSNP
rs186189768 5318 dbSNP
rs895780936 5319 dbSNP
rs1014283616 5323 dbSNP
rs1246099452 5324 dbSNP
rs1215404603 5325 dbSNP
rs1468724298 5327 dbSNP
rs34106738 5328 dbSNP
rs1242095946 5331 dbSNP
rs528829795 5333 dbSNP
rs963187769 5333 dbSNP
rs1193116050 5346 dbSNP
rs1423356317 5353 dbSNP
rs1363733216 5368 dbSNP
rs1476416592 5369 dbSNP
rs1033927170 5376 dbSNP
rs951485499 5386 dbSNP
rs1006076099 5399 dbSNP
rs1017102698 5404 dbSNP
rs992124216 5408 dbSNP
rs532236588 5412 dbSNP
rs766679249 5416 dbSNP
rs1373729649 5439 dbSNP
rs1169900805 5447 dbSNP
rs1447727386 5448 dbSNP
rs975595478 5466 dbSNP
rs1195397777 5468 dbSNP
rs1454565027 5472 dbSNP
rs1371028576 5473 dbSNP
rs1207718268 5474 dbSNP
rs1431537555 5474 dbSNP
rs1251529546 5477 dbSNP
rs148377812 5478 dbSNP
rs1339421960 5483 dbSNP
rs1306299544 5490 dbSNP
rs1235615903 5494 dbSNP
rs6803715 5496 dbSNP
rs1436991107 5498 dbSNP
rs1393487011 5505 dbSNP
rs954347511 5506 dbSNP
rs1297790934 5527 dbSNP
rs1276198789 5528 dbSNP
rs899756270 5528 dbSNP
rs1175471173 5543 dbSNP
rs569099791 5545 dbSNP
rs1232837309 5547 dbSNP
rs1376989840 5548 dbSNP
rs111634361 5549 dbSNP
rs190036776 5553 dbSNP
rs1250861498 5554 dbSNP
rs1180944458 5562 dbSNP
rs1043231012 5571 dbSNP
rs925776688 5573 dbSNP
rs112004510 5574 dbSNP
rs1344992346 5592 dbSNP
rs574617077 5593 dbSNP
rs9818469 5598 dbSNP
rs1336700353 5604 dbSNP
rs753140566 5608 dbSNP
rs959578632 5610 dbSNP
rs1408186530 5614 dbSNP
rs1189521950 5618 dbSNP
rs559749973 5621 dbSNP
rs1392099654 5630 dbSNP
rs992425272 5637 dbSNP
rs1447774764 5642 dbSNP
rs1170723019 5643 dbSNP
rs1024952075 5647 dbSNP
rs1047079162 5653 dbSNP
rs1364120053 5657 dbSNP
rs887147419 5679 dbSNP
rs1471373745 5689 dbSNP
rs1259161084 5690 dbSNP
rs187347874 5700 dbSNP
rs1395707765 5701 dbSNP
rs1254747215 5703 dbSNP
rs1207356708 5705 dbSNP
rs1405695152 5713 dbSNP
rs1226808406 5723 dbSNP
rs527271151 5723 dbSNP
rs925351005 5724 dbSNP
rs1391755985 5725 dbSNP
rs140391320 5726 dbSNP
rs1338730789 5732 dbSNP
rs1332151800 5735 dbSNP
rs989901451 5752 dbSNP
rs996981029 5758 dbSNP
rs1297961270 5772 dbSNP
rs1366716012 5773 dbSNP
rs1224641180 5776 dbSNP
rs1319707573 5776 dbSNP
rs932539908 5776 dbSNP
rs1029812780 5788 dbSNP
rs1051468857 5791 dbSNP
rs559114327 5792 dbSNP
rs868845994 5807 dbSNP
rs150357133 5809 dbSNP
rs1247948817 5812 dbSNP
rs1207273053 5828 dbSNP
rs1470092503 5837 dbSNP
rs777787160 5843 dbSNP
rs1468373080 5846 dbSNP
rs1209558745 5847 dbSNP
rs1250184105 5850 dbSNP
rs1445301853 5860 dbSNP
rs1410159222 5870 dbSNP
rs967455323 5878 dbSNP
rs1271947446 5882 dbSNP
rs1228230947 5883 dbSNP
rs1365922917 5884 dbSNP
rs1319769887 5885 dbSNP
rs1432697229 5904 dbSNP
rs1396342422 5911 dbSNP
rs995264392 5914 dbSNP
rs1372365735 5915 dbSNP
rs1473092757 5919 dbSNP
rs978495676 5920 dbSNP
rs1167085443 5933 dbSNP
rs1055271257 5938 dbSNP
rs1460774339 5939 dbSNP
rs925712800 5941 dbSNP
rs937129393 5943 dbSNP
rs1390425044 5945 dbSNP
rs79499371 5952 dbSNP
rs1317043106 5953 dbSNP
rs1340618501 5956 dbSNP
rs373276687 5959 dbSNP
rs1341518920 5966 dbSNP
rs1296812540 5974 dbSNP
rs1226026224 5975 dbSNP
rs949948300 5980 dbSNP
rs1047458311 5982 dbSNP
rs1032345162 5990 dbSNP
rs1334585741 5993 dbSNP
rs779752416 6000 dbSNP
rs1329037961 6001 dbSNP
rs941375738 6011 dbSNP
rs1229417065 6018 dbSNP
rs1038424874 6022 dbSNP
rs192106183 6044 dbSNP
rs1167269759 6070 dbSNP
rs1485016469 6081 dbSNP
rs72999319 6092 dbSNP
rs974809775 6094 dbSNP
rs1444263737 6099 dbSNP
rs768533039 6100 dbSNP
rs1477225594 6106 dbSNP
rs560039002 6117 dbSNP
rs1182739101 6118 dbSNP
rs764644871 6123 dbSNP
rs751616272 6124 dbSNP
rs114382366 6133 dbSNP
rs1021628243 6134 dbSNP
rs1279236271 6137 dbSNP
rs868756394 6139 dbSNP
rs978847608 6140 dbSNP
rs1280963101 6151 dbSNP
rs1409989457 6154 dbSNP
rs1376026 6170 dbSNP
rs1360292494 6177 dbSNP
rs1175947580 6198 dbSNP
rs1157707077 6203 dbSNP
rs1410569245 6206 dbSNP
rs931027587 6206 dbSNP
rs1472351615 6210 dbSNP
rs1249869938 6216 dbSNP
rs958428440 6221 dbSNP
rs991279015 6222 dbSNP
rs917081191 6230 dbSNP
rs949874304 6231 dbSNP
rs1311537337 6234 dbSNP
rs1209291481 6248 dbSNP
rs562708720 6251 dbSNP
rs1410744456 6252 dbSNP
rs772802151 6258 dbSNP
rs908467003 6259 dbSNP
rs1286013388 6262 dbSNP
rs1228765928 6264 dbSNP
rs1328136111 6268 dbSNP
rs531607808 6269 dbSNP
rs941313988 6275 dbSNP
rs1286037972 6277 dbSNP
rs1038756200 6283 dbSNP
rs1234644741 6284 dbSNP
rs899882390 6291 dbSNP
rs1379198383 6293 dbSNP
rs1302807289 6302 dbSNP
rs1446379155 6305 dbSNP
rs1347327170 6306 dbSNP
rs1290611312 6308 dbSNP
rs183894922 6312 dbSNP
rs1410082013 6314 dbSNP
rs1167310702 6323 dbSNP
rs1315563655 6332 dbSNP
rs894926276 6333 dbSNP
rs1181226348 6336 dbSNP
rs1482269366 6342 dbSNP
rs1051131456 6349 dbSNP
rs550056942 6350 dbSNP
rs1464257709 6375 dbSNP
rs1265877648 6376 dbSNP
rs1010169042 6377 dbSNP
rs1321797257 6380 dbSNP
rs1208861748 6381 dbSNP
rs1278018765 6382 dbSNP
rs1021179300 6387 dbSNP
rs904091106 6410 dbSNP
rs1364779180 6411 dbSNP
rs999788291 6428 dbSNP
rs1182887167 6432 dbSNP
rs1001149293 6461 dbSNP
rs1252404556 6461 dbSNP
rs1033091164 6464 dbSNP
rs1434858482 6490 dbSNP
rs958396974 6505 dbSNP
rs991205244 6506 dbSNP
rs1180622433 6514 dbSNP
rs1458555952 6525 dbSNP
rs1349503250 6527 dbSNP
rs115482306 6539 dbSNP
rs116365190 6540 dbSNP
rs765187708 6542 dbSNP
rs1171200613 6557 dbSNP
rs983006224 6563 dbSNP
rs1448675745 6567 dbSNP
rs1245894779 6569 dbSNP
rs1211278647 6576 dbSNP
rs766027337 6577 dbSNP
rs1264484884 6579 dbSNP
rs747951458 6581 dbSNP
rs1218789861 6586 dbSNP
rs1029028560 6597 dbSNP
rs1276016901 6599 dbSNP
rs1228230267 6600 dbSNP
rs1375308590 6605 dbSNP
rs1306161959 6610 dbSNP
rs78157302 6613 dbSNP
rs987001693 6615 dbSNP
rs941272580 6623 dbSNP
rs1371590635 6627 dbSNP
rs1391227574 6628 dbSNP
rs961562313 6630 dbSNP
rs972695188 6636 dbSNP
rs759954932 6645 dbSNP
rs921229152 6650 dbSNP
rs1200818473 6651 dbSNP
rs1433523204 6655 dbSNP
rs932656863 6668 dbSNP
rs1279687167 6669 dbSNP
rs1051106281 6682 dbSNP
rs1047412 6688 dbSNP
rs990519811 6695 dbSNP
rs1251837840 6714 dbSNP
rs916329531 6717 dbSNP
rs1340753879 6723 dbSNP
rs1258256354 6729 dbSNP
rs912660959 6734 dbSNP
rs1234485923 6746 dbSNP
rs1311929188 6750 dbSNP
rs949165118 6758 dbSNP
rs1393289816 6759 dbSNP
rs1351195144 6760 dbSNP
rs777724510 6761 dbSNP
rs1368673629 6764 dbSNP
rs1042932190 6770 dbSNP
rs904062284 6779 dbSNP
rs1174223455 6786 dbSNP
rs1205751432 6789 dbSNP
rs1046965109 6790 dbSNP
rs902691049 6791 dbSNP
rs1253061597 6792 dbSNP
rs935555837 6798 dbSNP
rs1180883881 6819 dbSNP
rs1479509677 6821 dbSNP
rs1481776035 6825 dbSNP
rs1001518904 6829 dbSNP
rs1053942063 6830 dbSNP
rs1201490096 6852 dbSNP
rs894097851 6853 dbSNP
rs1055393548 6857 dbSNP
rs188832259 6860 dbSNP
rs996133373 6863 dbSNP
rs207463881 6866 dbSNP
rs1230603983 6875 dbSNP
rs1455313959 6884 dbSNP
rs1028954890 6887 dbSNP
rs894108944 6888 dbSNP
rs1226702967 6889 dbSNP
rs1342291099 6901 dbSNP
rs1008997797 6910 dbSNP
rs1396478355 6921 dbSNP
rs1173134463 6926 dbSNP
rs867799367 6930 dbSNP
rs539126229 6932 dbSNP
rs1458593056 6934 dbSNP
rs973007300 6936 dbSNP
rs1461742378 6962 dbSNP
rs192613231 6964 dbSNP
rs1024005031 6965 dbSNP
rs1369620920 6969 dbSNP
rs971116050 6970 dbSNP
rs1423799477 6981 dbSNP
rs76324703 6984 dbSNP
rs753228433 6987 dbSNP
rs1267765845 6995 dbSNP
rs1207012062 7045 dbSNP
rs1365996209 7056 dbSNP
rs569597516 7077 dbSNP
rs184233488 7081 dbSNP
rs1284916995 7094 dbSNP
rs962582577 7104 dbSNP
rs1339846634 7105 dbSNP
rs1305696165 7106 dbSNP
rs1226339445 7107 dbSNP
rs756576764 7111 dbSNP
rs1469703374 7117 dbSNP
rs1319479453 7123 dbSNP
rs974356562 7130 dbSNP
rs1211402559 7141 dbSNP
rs554868876 7142 dbSNP
rs1398532495 7148 dbSNP
rs921198090 7150 dbSNP
rs954018748 7157 dbSNP
rs3177575 7161 dbSNP
rs981900451 7170 dbSNP
rs1252041637 7173 dbSNP
rs923707426 7179 dbSNP
rs1187769494 7187 dbSNP
rs574093962 7191 dbSNP
rs1191004377 7198 dbSNP
rs757274793 7199 dbSNP
rs1247735708 7203 dbSNP
rs1187053338 7208 dbSNP
rs1453609115 7208 dbSNP
rs986752043 7214 dbSNP