miRTarBase - #MIRT466436 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TFAP2A   
Synonyms AP-2, AP-2alpha, AP2TF, BOFS, TFAP2
Description transcription factor AP-2 alpha
Transcript NM_001032280   
Other Transcripts NM_001042425 , NM_003220   
Expression
Putative miRNA Targets on TFAP2A
3'UTR of TFAP2A
(miRNA target sites are highlighted)
>TFAP2A|NM_001032280|3'UTR
   1 GGCTCTCCTCCCGCCCCGCCCCTCCCACGCCTCACCAGCCCCCCGCGCGCCCACCCTCCGGCGGGTGACAGCTCCGGGAT
  81 CAGCAACCCTTCCTGCTGCTGCTACTGCTGCTGCTGCTGCCGCCGCCGCCGCCGCCGCTGCCCTTGGGTCCCCCCGAGTC
 161 TCCGGGACTGCCCTCTCGACTGTCAGTGGGGCAGCCTCTCCGACTCTGCACCCGCCTCGACCTCCCCACCCGCTCCCACA
 241 CCCCTGTGCCCTCATGTGGAGCCTAAGAGAACAGAACAGGCCGTGAAGCCAGCAGAGAAAAGTTCTGCCAAGTTTGTGAA
 321 CCCTTTTTTTTTTAAACAAAACAACAAATCAACAACAGCAACAACAACAACAAAAATTAAAAACTTTTTTCTAAAAAAAA
 401 AGTGAAAATAAAAAAAATTATATGCGCTTCATGGGACTGAGTCACCACCTTCCCTTACATACTTCAGTTCAGATTGTAGC
 481 CATACTTAAAAAAAAAAAAAAAGCCAAAAGATGATGACAACATTTTTATCAGTATTGTGAATAAACTTGAACACAAATAC
 561 ACGAAGTTCCATGTCATGTCTTCAGTTGTAGAAGTTTTTCCTCTTTAAGGTAAAGCGACCAACTTGAACTTTCTCTGGCA
 641 ACACGATTCGCAGTTATATAAGGGAATCAGTGTTCACGTCTCTGTATATATTTATTTATGTGTAATTTAATGGGAATTGT
 721 AAATATGGTGAGTCTGTTTTAAGCCTTTTTTTTTTTATTTATCTGATCTTGTTTACCTCTTGTTTAGTGGGTTTTGAATC
 801 TTCCCTATTAGTTCTTCATGTGGTTCATGGTACTGATTTAGAAATCCAGTGTTTGGGGGATTTTTTTCTCTGGGATTCAT
 881 GAATTTAGCCCTGTTGTAGCATGTTAAAGGTGACAAACAGCTGGACAAATTTTTAAAAAGTAAAATAAAATTTTATCTAT
 961 AATTAGTATTATTACATTTAGCTTTTCATTGAACCGAAAGAAAAAAAGTGATATTGGACCCTGGAAAGATTTTGAAACTT
1041 GAGTGGTTTGATAACCCTTCTATGTATTGTAGGGAGAAAAAAAAAAGTTTATTTTATTCCACTGTCCTCCCTTAAAAGCA
1121 TCATTTGAGCAATAAATGAATATTGTCTTTAAACCAAGGGTTAGGGAATTTTCCTCTCTCTCTCTCTCTCCTCTCTCTTT
1201 CTGTTCAAAGAACTTCAAACATTTGGGACCACCTGGTATTCTGTATTTTCACTGGCCATATTGGAAGCAGTTCTAGTTGC
1281 ATTGTATTGAGTTGTGCTGGCAGTAGTTTCCATGCCTGTCAATGTATCATAGTCCTTTGTTGCCCAGATAAATAAATATT
1361 TGATACGCTTTATGTCGATTTTTTTTTATTCAGTGGCTGTCTTTACCCAGGCGTATTTTTGTTCTTGGCAGTATTTTTTA
1441 TTCAGTATGGTTACAGTAATTGAGTTTAACTCTCCCTTGGCAATTGCTCCTTGCAATAAGCAGCTGAACCCATTGTTTCC
1521 CTCAAGTATAATAAAAACTTACTTTCAACTTGGAGTTCAGAGCAGGGTATCATTTAGATATTCCACTGTGTCTGTATTCA
1601 GACAAATGACACAATAAAACCCAATGTATTCTTTTGGATAAAAGATTGTTTGTACTGCTAAAGGAATGACATACTGTCTT
1681 TTCCTTACTAGAAACATTAATTTTATTATTAAAAATAAAGTTTTATTTTATTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            ||| || |  || ||||||| 
Target 5' agCAACCCTTCCTGCTGCTGCTa 3'
82 - 104 160.00 -15.30
2
miRNA  3' guGUUUGGUAAU--ACACGACGAu 5'
            :|||  |||:  ||| ||||| 
Target 5' gaTAAAAGATTGTTTGTACTGCTa 3'
1637 - 1660 134.00 -12.00
3
miRNA  3' guguuUGGUAAU-AC-ACGACGAU------- 5'
               :|:| |: || |||||||:       
Target 5' ctgctGCTACTGCTGCTGCTGCTGCCGCCGC 3'
96 - 126 129.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
984572 1 ClinVar
1203480 88 ClinVar
1207683 139 ClinVar
COSN30179706 16 COSMIC
COSN30448399 24 COSMIC
COSN31498704 26 COSMIC
COSN26998358 34 COSMIC
COSN26998365 38 COSMIC
COSN30553577 39 COSMIC
COSN30130091 45 COSMIC
COSN20041069 46 COSMIC
COSN31612898 47 COSMIC
COSN30119599 59 COSMIC
COSN30506703 63 COSMIC
COSN31528365 76 COSMIC
COSN26998370 101 COSMIC
COSN26998369 104 COSMIC
COSN30669956 113 COSMIC
COSN26442539 118 COSMIC
COSN18730999 121 COSMIC
COSN30514486 127 COSMIC
COSN26998357 128 COSMIC
COSN26998364 140 COSMIC
COSN30695357 181 COSMIC
COSN2131437 323 COSMIC
COSN17234722 361 COSMIC
COSN2131435 383 COSMIC
COSN28451926 393 COSMIC
COSN28201153 482 COSMIC
COSN18723490 488 COSMIC
COSN27346350 488 COSMIC
COSN26556827 552 COSMIC
COSN20102391 745 COSMIC
COSN29078875 746 COSMIC
COSN2131433 825 COSMIC
COSN29535666 1076 COSMIC
COSN27254125 1077 COSMIC
COSN31542024 1366 COSMIC
COSN29533932 1378 COSMIC
COSN21350772 1386 COSMIC
COSN19658955 1432 COSMIC
COSN6718831 1558 COSMIC
COSN31582628 1612 COSMIC
COSN31486209 1631 COSMIC
COSN22892347 1646 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757896248 2 dbSNP
rs749936793 4 dbSNP
rs764897160 5 dbSNP
rs761472794 6 dbSNP
rs753566744 7 dbSNP
rs1259126090 8 dbSNP
rs763868660 9 dbSNP
rs760518852 10 dbSNP
rs775472363 12 dbSNP
rs1393005080 13 dbSNP
rs767561818 13 dbSNP
rs1231856814 17 dbSNP
rs1330444356 18 dbSNP
rs968780292 18 dbSNP
rs771942212 19 dbSNP
rs1021755301 23 dbSNP
rs371339437 24 dbSNP
rs552520811 26 dbSNP
rs1304029829 27 dbSNP
rs771219549 29 dbSNP
rs1434970906 35 dbSNP
rs761920926 37 dbSNP
rs749517602 39 dbSNP
rs778198576 40 dbSNP
rs770263013 41 dbSNP
rs1377549684 42 dbSNP
rs748502364 43 dbSNP
rs781698007 44 dbSNP
rs1240459392 45 dbSNP
rs1260664295 45 dbSNP
rs774267757 45 dbSNP
rs1261168096 46 dbSNP
rs1216105724 48 dbSNP
rs755465363 49 dbSNP
rs925002147 52 dbSNP
rs530677405 53 dbSNP
rs563344990 58 dbSNP
rs1377300959 59 dbSNP
rs1174486376 62 dbSNP
rs1363190893 62 dbSNP
rs1455690395 63 dbSNP
rs1167248049 65 dbSNP
rs542047656 66 dbSNP
rs1246232305 69 dbSNP
rs1461180426 79 dbSNP
rs369680359 81 dbSNP
rs574832806 84 dbSNP
rs1375726110 86 dbSNP
rs1392335736 87 dbSNP
rs10456013 88 dbSNP
rs541008118 92 dbSNP
rs976392453 95 dbSNP
rs936995435 98 dbSNP
rs1199107159 99 dbSNP
rs909590607 104 dbSNP
rs1212463749 107 dbSNP
rs1263321356 107 dbSNP
rs985440269 111 dbSNP
rs1344734284 112 dbSNP
rs1177590362 113 dbSNP
rs1280678804 115 dbSNP
rs1189972431 116 dbSNP
rs1471589859 116 dbSNP
rs952359971 118 dbSNP
rs1264691695 121 dbSNP
rs1298007473 121 dbSNP
rs1474929157 121 dbSNP
rs1394779030 124 dbSNP
rs764664664 126 dbSNP
rs188674648 127 dbSNP
rs759057111 128 dbSNP
rs1355313097 130 dbSNP
rs966069097 131 dbSNP
rs1309903650 132 dbSNP
rs1308939096 133 dbSNP
rs1204736976 134 dbSNP
rs558781203 138 dbSNP
rs1027777749 139 dbSNP
rs1461010 139 dbSNP
rs1474815820 139 dbSNP
rs952111195 139 dbSNP
rs970110686 139 dbSNP
rs983584018 139 dbSNP
rs1313831421 142 dbSNP
rs1328138243 142 dbSNP
rs1013473016 143 dbSNP
rs1024708087 143 dbSNP
rs1363447437 143 dbSNP
rs896380071 143 dbSNP
rs1332048106 144 dbSNP
rs1052230470 147 dbSNP
rs576370374 150 dbSNP
rs1043516659 152 dbSNP
rs1375834719 155 dbSNP
rs879600114 156 dbSNP
rs1185939128 157 dbSNP
rs1246458258 161 dbSNP
rs1033048391 163 dbSNP
rs931711956 164 dbSNP
rs554863655 166 dbSNP
rs921640701 168 dbSNP
rs1346245005 175 dbSNP
rs1000507129 177 dbSNP
rs903119541 181 dbSNP
rs1041913358 185 dbSNP
rs1014105118 188 dbSNP
rs865876939 194 dbSNP
rs1346866545 197 dbSNP
rs1388509761 201 dbSNP
rs944946792 203 dbSNP
rs895531375 205 dbSNP
rs1317405576 213 dbSNP
rs1215190646 214 dbSNP
rs1246244659 218 dbSNP
rs1470023095 219 dbSNP
rs1035826843 223 dbSNP
rs1475748486 225 dbSNP
rs1055552867 227 dbSNP
rs1477250710 234 dbSNP
rs1179249633 235 dbSNP
rs536878759 243 dbSNP
rs1409391499 244 dbSNP
rs1400585644 264 dbSNP
rs937109804 265 dbSNP
rs1326187998 267 dbSNP
rs920745965 267 dbSNP
rs1330081738 269 dbSNP
rs1434074194 283 dbSNP
rs1281025601 291 dbSNP
rs1374037010 293 dbSNP
rs118042860 297 dbSNP
rs1266384437 302 dbSNP
rs980233072 309 dbSNP
rs970522088 312 dbSNP
rs1024324181 318 dbSNP
rs1207089465 321 dbSNP
rs1442243547 323 dbSNP
rs1470109641 324 dbSNP
rs1258624822 326 dbSNP
rs992755911 326 dbSNP
rs868777552 327 dbSNP
rs1164960101 328 dbSNP
rs960616888 333 dbSNP
rs111823522 334 dbSNP
rs1294868465 334 dbSNP
rs1409192672 334 dbSNP
rs34512481 334 dbSNP
rs546903889 334 dbSNP
rs1030918433 337 dbSNP
rs2763172 337 dbSNP
rs1234009643 341 dbSNP
rs1357212931 341 dbSNP
rs201528167 342 dbSNP
rs546690434 343 dbSNP
rs999390920 355 dbSNP
rs1273385395 358 dbSNP
rs903713519 358 dbSNP
rs1274221636 361 dbSNP
rs1437626762 365 dbSNP
rs1214663204 371 dbSNP
rs1486258957 374 dbSNP
rs34426547 374 dbSNP
rs397885453 374 dbSNP
rs776813404 374 dbSNP
rs9350372 385 dbSNP
rs1188111555 386 dbSNP
rs1367350373 400 dbSNP
rs534571057 401 dbSNP
rs1022531195 402 dbSNP
rs1169267968 402 dbSNP
rs1419713131 410 dbSNP
rs1340848444 411 dbSNP
rs1305907326 418 dbSNP
rs560622395 418 dbSNP
rs762265236 418 dbSNP
rs1377222122 419 dbSNP
rs995958548 420 dbSNP
rs1333638502 421 dbSNP
rs1338770571 422 dbSNP
rs1229630753 423 dbSNP
rs900215570 425 dbSNP
rs1040063782 430 dbSNP
rs944394499 431 dbSNP
rs570465051 432 dbSNP
rs1282888127 437 dbSNP
rs1349290262 439 dbSNP
rs1200386054 441 dbSNP
rs552459189 443 dbSNP
rs1254939046 445 dbSNP
rs151315569 459 dbSNP
rs1048035394 461 dbSNP
rs930861855 462 dbSNP
rs1294929845 465 dbSNP
rs1448450330 470 dbSNP
rs1166534115 474 dbSNP
rs1396628089 475 dbSNP
rs1435339410 476 dbSNP
rs1407693225 480 dbSNP
rs1399896260 482 dbSNP
rs1368962252 485 dbSNP
rs1328417565 486 dbSNP
rs1410668347 487 dbSNP
rs920790273 489 dbSNP
rs1162023475 496 dbSNP
rs1206398486 503 dbSNP
rs1232913299 503 dbSNP
rs1254767473 503 dbSNP
rs1268180761 503 dbSNP
rs1433134003 503 dbSNP
rs544361557 503 dbSNP
rs879148487 503 dbSNP
rs980646678 503 dbSNP
rs1464190357 506 dbSNP
rs1186274818 512 dbSNP
rs146797011 513 dbSNP
rs1454553382 523 dbSNP
rs930864550 526 dbSNP
rs1197852952 528 dbSNP
rs1045385 534 dbSNP
rs919528845 537 dbSNP
rs1471783636 539 dbSNP
rs917285027 543 dbSNP
rs1250694622 545 dbSNP
rs992872441 546 dbSNP
rs1328185684 561 dbSNP
rs548057203 570 dbSNP
rs1386591329 576 dbSNP
rs1439089148 580 dbSNP
rs1299579212 585 dbSNP
rs1287106589 586 dbSNP
rs1031619666 590 dbSNP
rs770745416 593 dbSNP
rs1208677848 595 dbSNP
rs749647128 596 dbSNP
rs1335396861 603 dbSNP
rs1206207432 607 dbSNP
rs1294989605 612 dbSNP
rs184322632 613 dbSNP
rs529930646 617 dbSNP
rs1274697106 618 dbSNP
rs1488575938 619 dbSNP
rs978003444 623 dbSNP
rs540540292 627 dbSNP
rs773862113 633 dbSNP
rs559552401 634 dbSNP
rs912101100 637 dbSNP
rs986171234 638 dbSNP
rs953491795 643 dbSNP
rs1033404425 644 dbSNP
rs996371955 645 dbSNP
rs1000215119 649 dbSNP
rs201450721 650 dbSNP
rs1457572911 656 dbSNP
rs1292186347 660 dbSNP
rs541132655 662 dbSNP
rs1392537049 663 dbSNP
rs1008635901 667 dbSNP
rs886127182 668 dbSNP
rs1047402910 670 dbSNP
rs576308493 675 dbSNP
rs967666380 677 dbSNP
rs75419063 678 dbSNP
rs899381145 686 dbSNP
rs1321699771 687 dbSNP
rs1481502601 688 dbSNP
rs1205517569 691 dbSNP
rs564928565 701 dbSNP
rs543460673 712 dbSNP
rs1190209109 713 dbSNP
rs1414584845 717 dbSNP
rs1167723607 719 dbSNP
rs1162930769 726 dbSNP
rs181681871 728 dbSNP
rs1456044231 734 dbSNP
rs147713410 739 dbSNP
rs917418676 741 dbSNP
rs1470971654 742 dbSNP
rs201819112 744 dbSNP
rs74636495 746 dbSNP
rs542820219 754 dbSNP
rs992901960 754 dbSNP
rs78186274 756 dbSNP
rs1308848637 757 dbSNP
rs1417130577 757 dbSNP
rs397965898 757 dbSNP
rs546035279 757 dbSNP
rs61569279 757 dbSNP
rs1228891486 758 dbSNP
rs1212928116 761 dbSNP
rs1273620078 761 dbSNP
rs572623022 774 dbSNP
rs934727559 775 dbSNP
rs1001269086 777 dbSNP
rs978704830 782 dbSNP
rs967992812 783 dbSNP
rs1275044076 790 dbSNP
rs1206706862 791 dbSNP
rs888219576 799 dbSNP
rs574855862 800 dbSNP
rs1225215874 814 dbSNP
rs1353119982 829 dbSNP
rs1300520666 830 dbSNP
rs3088288 851 dbSNP
rs2763171 855 dbSNP
rs770287660 860 dbSNP
rs1273247813 862 dbSNP
rs1440341474 867 dbSNP
rs1435328426 868 dbSNP
rs768958142 868 dbSNP
rs1362755113 869 dbSNP
rs1236149981 872 dbSNP
rs1279251186 873 dbSNP
rs929663694 875 dbSNP
rs1208170205 876 dbSNP
rs115631304 880 dbSNP
rs1036570717 888 dbSNP
rs1008668333 900 dbSNP
rs1246352169 911 dbSNP
rs944993067 913 dbSNP
rs912048188 918 dbSNP
rs2763170 925 dbSNP
rs1455856393 929 dbSNP
rs1192094582 932 dbSNP
rs986284423 943 dbSNP
rs113256477 944 dbSNP
rs926067373 951 dbSNP
rs1390201473 952 dbSNP
rs185414193 955 dbSNP
rs1319488970 966 dbSNP
rs898830681 966 dbSNP
rs1422692618 969 dbSNP
rs967404207 970 dbSNP
rs1454364823 971 dbSNP
rs1254305813 974 dbSNP
rs1366870946 978 dbSNP
rs1045079330 989 dbSNP
rs558581973 994 dbSNP
rs1242562543 995 dbSNP
rs1014169148 996 dbSNP
rs1310209012 1000 dbSNP
rs537069740 1002 dbSNP
rs773868091 1008 dbSNP
rs1222840005 1009 dbSNP
rs1458670881 1011 dbSNP
rs781574382 1013 dbSNP
rs569833793 1019 dbSNP
rs896012283 1024 dbSNP
rs1157722187 1027 dbSNP
rs1226225494 1031 dbSNP
rs1057206801 1039 dbSNP
rs1406708427 1046 dbSNP
rs1324040714 1050 dbSNP
rs1349074900 1056 dbSNP
rs1289951647 1057 dbSNP
rs888157123 1060 dbSNP
rs924658320 1064 dbSNP
rs1433409201 1068 dbSNP
rs1026734969 1077 dbSNP
rs755049370 1082 dbSNP
rs1311943316 1086 dbSNP
rs1043143423 1087 dbSNP
rs1286511609 1087 dbSNP
rs947408228 1087 dbSNP
rs2857059 1088 dbSNP
rs2857060 1090 dbSNP
rs1450253873 1092 dbSNP
rs1206983895 1099 dbSNP
rs1434969502 1102 dbSNP
rs921261649 1107 dbSNP
rs11553434 1109 dbSNP
rs1482987555 1111 dbSNP
rs747101844 1119 dbSNP
rs1166174221 1120 dbSNP
rs545023610 1128 dbSNP
rs994362396 1148 dbSNP
rs1163493464 1158 dbSNP
rs80094467 1159 dbSNP
rs780237615 1168 dbSNP
rs1420215580 1173 dbSNP
rs193259940 1174 dbSNP
rs1409106470 1179 dbSNP
rs1306333817 1181 dbSNP
rs150236619 1191 dbSNP
rs554956373 1191 dbSNP
rs911739270 1191 dbSNP
rs950451840 1191 dbSNP
rs1026110190 1199 dbSNP
rs1231102724 1199 dbSNP
rs1275758017 1203 dbSNP
rs1342156023 1211 dbSNP
rs994590730 1218 dbSNP
rs1482178043 1220 dbSNP
rs2763169 1227 dbSNP
rs1443644771 1229 dbSNP
rs758681260 1230 dbSNP
rs1236552659 1237 dbSNP
rs1471590963 1245 dbSNP
rs1190322421 1249 dbSNP
rs1390560124 1252 dbSNP
rs963406342 1262 dbSNP
rs1211276559 1273 dbSNP
rs1404183446 1292 dbSNP
rs1415141620 1296 dbSNP
rs753621983 1301 dbSNP
rs1338976093 1303 dbSNP
rs1437540491 1306 dbSNP
rs769945457 1308 dbSNP
rs890721929 1310 dbSNP
rs1013604340 1312 dbSNP
rs186469860 1314 dbSNP
rs1258318039 1316 dbSNP
rs1346264670 1332 dbSNP
rs1057238457 1336 dbSNP
rs1277251337 1346 dbSNP
rs573067252 1347 dbSNP
rs903352914 1352 dbSNP
rs1248200556 1359 dbSNP
rs1043562443 1366 dbSNP
rs926153731 1367 dbSNP
rs978864068 1372 dbSNP
rs1478303478 1375 dbSNP
rs1172132887 1377 dbSNP
rs946154698 1378 dbSNP
rs1321473588 1381 dbSNP
rs1458833747 1381 dbSNP
rs1388127884 1387 dbSNP
rs398094002 1388 dbSNP
rs79168174 1388 dbSNP
rs921280552 1388 dbSNP
rs913219402 1395 dbSNP
rs1233159809 1405 dbSNP
rs1273796099 1406 dbSNP
rs1320822161 1409 dbSNP
rs763807060 1411 dbSNP
rs992848628 1413 dbSNP
rs1415705332 1414 dbSNP
rs959914489 1416 dbSNP
rs1376905434 1420 dbSNP
rs1034274256 1435 dbSNP
rs1305786147 1450 dbSNP
rs1269166396 1455 dbSNP
rs979890870 1456 dbSNP
rs952570651 1460 dbSNP
rs911771746 1467 dbSNP
rs987384905 1469 dbSNP
rs1375793545 1475 dbSNP
rs1473630522 1476 dbSNP
rs1461108659 1489 dbSNP
rs1354584022 1490 dbSNP
rs1027267354 1493 dbSNP
rs745977233 1496 dbSNP
rs1295719804 1507 dbSNP
rs1391894372 1519 dbSNP
rs919086036 1520 dbSNP
rs896920283 1521 dbSNP
rs2763168 1523 dbSNP
rs1007857899 1528 dbSNP
rs1229723381 1540 dbSNP
rs752628820 1543 dbSNP
rs1288405877 1550 dbSNP
rs890669566 1556 dbSNP
rs1050634350 1559 dbSNP
rs1236415373 1567 dbSNP
rs1188398798 1571 dbSNP
rs1266786003 1571 dbSNP
rs1476033051 1572 dbSNP
rs1356790715 1586 dbSNP
rs552923535 1588 dbSNP
rs1266707717 1596 dbSNP
rs904677951 1600 dbSNP
rs963137415 1601 dbSNP
rs1183030841 1608 dbSNP
rs16893358 1624 dbSNP
rs1417621210 1636 dbSNP
rs991137970 1638 dbSNP
rs1251986694 1647 dbSNP
rs1369206619 1651 dbSNP
rs946130784 1652 dbSNP
rs372257234 1654 dbSNP
rs1373001091 1656 dbSNP
rs1410944291 1660 dbSNP
rs1308181918 1663 dbSNP
rs1333337314 1685 dbSNP
rs1389109049 1688 dbSNP
rs1035936230 1692 dbSNP
rs1321895923 1707 dbSNP
rs1243853812 1731 dbSNP
rs1289281376 1732 dbSNP
rs913330699 1736 dbSNP
rs1234343067 1740 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            ||| || |  || ||||||| 
Target 5' --CAACCCUUCCUGCUGCUGCUa 3'
1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000379613.3 | 3UTR | CAACCCUUCCUGCUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000379613.3 | 3UTR | CAACCCUUCCUGCUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000379613.3 | 3UTR | CAACCCUUCCUGCUGCUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000379613.3 | 3UTR | CAACCCUUCCUGCUGCUGCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000379613.3 | 3UTR | CAACCCUUCCUGCUGCUGCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000379613.3 | 3UTR | CAACCCUUCCUGCUGCUGCUACUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.285 1.1e-2 -0.338 3.2e-3 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.438 1.8e-2 -0.181 2.0e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.412 2.3e-2 -0.335 5.5e-2 24 Click to see details
GSE19536 Breast cancer 0.182 3.5e-2 0.135 9.0e-2 100 Click to see details
GSE14794 Lymphoblastoid cells -0.19 3.6e-2 -0.225 1.6e-2 90 Click to see details
GSE32688 Pancreatic cancer 0.259 7.6e-2 0.117 2.6e-1 32 Click to see details
GSE19783 ER- ER- breast cancer 0.155 8.6e-2 0.167 7.1e-2 79 Click to see details
GSE38226 Liver fibrosis -0.225 1.6e-1 -0.074 3.7e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer -0.212 1.8e-1 -0.215 1.8e-1 20 Click to see details
GSE28544 Breast cancer -0.163 2.2e-1 -0.392 2.9e-2 24 Click to see details
GSE19350 CNS germ cell tumors 0.223 2.4e-1 -0.049 4.4e-1 12 Click to see details
GSE17306 Multiple myeloma 0.077 3.0e-1 0.088 2.7e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.074 3.6e-1 -0.005 4.9e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.089 3.7e-1 -0.056 4.2e-1 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.066 3.9e-1 -0.131 2.9e-1 20 Click to see details
GSE17498 Multiple myeloma -0.029 4.3e-1 -0.011 4.7e-1 40 Click to see details
GSE21032 Prostate cancer -0.017 4.4e-1 0.002 4.9e-1 83 Click to see details
GSE28260 Renal cortex and medulla -0.035 4.5e-1 0.093 3.8e-1 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.02 4.6e-1 0.212 1.5e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.02 4.6e-1 0.212 1.5e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.02 4.6e-1 0.212 1.5e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.434 0 -0.393 0 84 Click to see details
PAAD -0.991 0 -1.000 0.5 4 Click to see details
STAD 0.425 0.01 0.402 0.01 32 Click to see details
BLCA 0.523 0.01 0.426 0.04 18 Click to see details
KIRC -0.269 0.01 -0.223 0.03 68 Click to see details
HNSC 0.252 0.05 0.243 0.06 42 Click to see details
LIHC -0.211 0.07 -0.020 0.45 49 Click to see details
PCPG -0.965 0.08 -1.000 0.5 3 Click to see details
PRAD 0.175 0.11 0.134 0.18 50 Click to see details
LUSC -0.2 0.11 -0.126 0.23 38 Click to see details
LUAD 0.355 0.13 0.210 0.26 12 Click to see details
UCEC -0.249 0.15 -0.284 0.12 19 Click to see details
ESCA 0.277 0.2 0.209 0.27 11 Click to see details
CESC -0.507 0.33 -0.500 0.33 3 Click to see details
KIRP -0.071 0.35 0.105 0.28 32 Click to see details
THCA 0.05 0.35 0.042 0.38 59 Click to see details
CHOL 0.1 0.4 -0.067 0.43 9 Click to see details
KICH -0.003 0.49 0.008 0.48 25 Click to see details
COAD 0.002 0.5 0.024 0.48 8 Click to see details
COAD 0.002 0.5 0.024 0.48 8 Click to see details
COAD 0.002 0.5 0.024 0.48 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*