miRTarBase - #MIRT468151 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SH3BP4   
Synonyms BOG25, TTP
Description SH3 domain binding protein 4
Transcript NM_014521   
Expression
Putative miRNA Targets on SH3BP4
3'UTR of SH3BP4
(miRNA target sites are highlighted)
>SH3BP4|NM_014521|3'UTR
   1 ATGGGTCCCCTCCCCTCCTGCTGCTCTGGAGTGCAAGCCCTCTTCTGCCCTGCGTGCCCTGCTGTCACCGCGGAGCTGAA
  81 GAGGGAGGAAGGGGCGGCTGCTCAGACAGATTTAGGGCCCGCCAGCTAGGCTACACCCATCATGCGCCGCCCTCCTCCAT
 161 CGAGGGAGAGGCCTGAAGGGACTGCCTACTGCAGCTCGTTGCCAATCACATAGCTTTCTATTTGTTAAGTATAAATTTAA
 241 ATTTAAAATCACTTTTTTAACGAATGGGGGGAAGGGATCTATGAGAAAGGTGGTATCTAATTTTTTTATGGACCATAAAG
 321 GTTTAAAAGAAAATAGGGGCACAGGCTGTTGAGGTTTTTATGTTGTTATAGACCTTTTTAAATTATGTTAGAGATGTATA
 401 TAGGTATTTAAAGGTCACTGGGAGCGTTTCTGATTCCCGGCCACACTTTGCATTTCAACACTCAGCCCGGAAAGATGCTC
 481 GTTCGGTTGTTGGACCTCTTTCACTCCCTGCGTGTAAGAAGGTGAATCACGTGGGAAAAAGTGGCTTTTCAGTAAACGGG
 561 TACAGCTCATTCTTTCTGAGAAGGCCCCAGGTCCTGCTCCCTCCTCGGATTTGATTGTCTTCCGTGCTTTGCCTCACTCG
 641 TAGTAAATGACCATCCATAGAATATGTGAATCTTTGGTGAGCTTCAGTGGGCAGAGTGAAGTCCCGCATTAGCATTTAGG
 721 TGCCCTGAGCTGTTTCTGCCAATAGATTAGAAAGCAGCCATGAGTTGACAGTCTTTAGGGCCCCTGCCAGTGTGCAATTA
 801 GTCATTGACAAGAACAATGCCATTTGAGAGTGAGGTGGTCCCTGCTGCTACGAGGCCATTGTACTGTTTTTTCCTTGAGG
 881 TCAAAGCAGTGCTTCCCATAGAGTTTGCTGCCTCTTCTGTGGACAGGAAGAAAACTTCATGACCGAATCAGAGCCTTGGT
 961 GGCCACTGACTCTCGTGCTTATTGCAGATGCTGTGGTTGGCCTCACAAGCAACGCCTTATGCTGATGTGCAGAGGTGCCA
1041 GCTGCCATTTGCCAAACTCTGCATTTCATTTCATCTAAGGCTTAACCCCTCTTCCTTCCTGGTGTACCTGTGTCTCCTCG
1121 GAAGGAAGTCATAGTTTAGATGAAACCATTTTTTGTACAATGTAAAGATCATCTGAGCAAGATGAGCATTTTGTAAAAAT
1201 GAAAATGTGACTCACATAAAATCAGGAACTTGACACAGTGTTGCATTAATAACTTTAGGGTGCAGACATGCTGTGTGAAT
1281 CTCACAATGCGTCGTAGATGTCGCGTGTTGGAAGGGAGCAGGAGGAAGGACTGATACTGGCAAATCAGTAGAGTGAGGTG
1361 ATCCTTAGCAACGTGCCAGGACACTTCCTGTGTGCCTGCAGTTGTCAGGGACCATTTGGGATCCCGAATCTCATTCTCTA
1441 AAACTGCTTTCTTGAAACATGTTACTTCCTTAGTATAATCAATGTATACTCCCTTACTGGCCTGAAACGTTGTATAGCTA
1521 CTTATTCAGATACTGAAGACCAACGGACTGAAAAAAAGAACAAACATTAGCTATTTTATGCTGCAAGAACCAGGACACAC
1601 AATTCGCCAATCATCCCACCATATAACCTTCGATTGTGCTTCTCAACTCCACCCCATAATTTCTCCCAGAGACCATCTAT
1681 CACCTTTTCCCCAAAGAAGAAACAAAACCAGTTGCACCTTAAACCATGGATATTTTTTCCTCAGGGGCTTTAAATAGTTT
1761 CCTATGCAACGTGTCTTGTAGCACAAATAAAATTCTACAAAAGTTGCAGTAAATTTTATTTGGATATTTTAACCTGTTAA
1841 GTGTGTGTGTGTTTTCTGTACCCAACCAGACTTTAAATAAAACAAACATGAAACCTAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGau 5'
              |:|:||| | ||||||  
Target 5' cattAGCTATTTTATGCTGCaa 3'
1565 - 1586 146.00 -12.70
2
miRNA  3' guGUU-UGGUAA----------UAC-----ACGACGAu 5'
            ||| :|||||          :||     ||||||| 
Target 5' aaCAATGCCATTTGAGAGTGAGGTGGTCCCTGCTGCTa 3'
813 - 850 142.00 -18.80
3
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' gtcccctcccctccTGCTGCTc 3'
5 - 26 140.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN18727006 54 COSMIC
COSN28592727 68 COSMIC
COSN30535039 72 COSMIC
COSN23612045 97 COSMIC
COSN30120000 97 COSMIC
COSN31572759 103 COSMIC
COSN28778111 106 COSMIC
COSN31551719 150 COSMIC
COSN6175046 236 COSMIC
COSN30166662 339 COSMIC
COSN30538206 349 COSMIC
COSN21074807 673 COSMIC
COSN7240445 875 COSMIC
COSN32063259 945 COSMIC
COSN6681610 1187 COSMIC
COSN7240446 1348 COSMIC
COSN5500297 1431 COSMIC
COSN15812341 1535 COSMIC
COSN22890995 1601 COSMIC
COSN31544971 1606 COSMIC
COSN30538866 1740 COSMIC
COSN30172872 1798 COSMIC
COSN28813747 1843 COSMIC
COSN8990311 1848 COSMIC
COSN22872467 1886 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs554560358 3 dbSNP
rs749153165 5 dbSNP
rs1421939551 8 dbSNP
rs1465508906 13 dbSNP
rs1172039801 14 dbSNP
rs377494526 16 dbSNP
rs200133390 17 dbSNP
rs1321147143 20 dbSNP
rs774296563 24 dbSNP
rs747618777 29 dbSNP
rs375870121 30 dbSNP
rs771576042 33 dbSNP
rs772683228 34 dbSNP
rs1278804770 35 dbSNP
rs1388124219 36 dbSNP
rs1283494811 38 dbSNP
rs377640440 40 dbSNP
rs769239614 46 dbSNP
rs907454514 46 dbSNP
rs1003163759 48 dbSNP
rs765488534 50 dbSNP
rs775971150 51 dbSNP
rs1401346834 53 dbSNP
rs10929083 54 dbSNP
rs559766068 55 dbSNP
rs1158691136 70 dbSNP
rs752281042 71 dbSNP
rs576422631 72 dbSNP
rs962829030 73 dbSNP
rs1423346472 74 dbSNP
rs1254644478 75 dbSNP
rs973762906 76 dbSNP
rs546124835 83 dbSNP
rs996638937 89 dbSNP
rs1267963041 92 dbSNP
rs950988744 96 dbSNP
rs777996771 97 dbSNP
rs912304548 98 dbSNP
rs563175533 100 dbSNP
rs955284462 112 dbSNP
rs879097676 114 dbSNP
rs186859482 121 dbSNP
rs986708226 122 dbSNP
rs1383253396 123 dbSNP
rs1319569170 129 dbSNP
rs975587666 132 dbSNP
rs1259091447 138 dbSNP
rs1469379102 142 dbSNP
rs924589029 144 dbSNP
rs542424733 146 dbSNP
rs755864623 147 dbSNP
rs562101787 149 dbSNP
rs527788792 150 dbSNP
rs1187012221 152 dbSNP
rs1172227894 153 dbSNP
rs936935883 162 dbSNP
rs564348476 163 dbSNP
rs1289043527 165 dbSNP
rs1158174293 182 dbSNP
rs1382914800 189 dbSNP
rs547907552 191 dbSNP
rs914669506 196 dbSNP
rs1359994596 198 dbSNP
rs948859687 199 dbSNP
rs1428340010 206 dbSNP
rs1328024954 207 dbSNP
rs1319208404 209 dbSNP
rs868805925 211 dbSNP
rs1363944215 215 dbSNP
rs1046952897 222 dbSNP
rs928819848 225 dbSNP
rs1438546366 233 dbSNP
rs570897623 238 dbSNP
rs1048029283 242 dbSNP
rs1317249410 248 dbSNP
rs1263926401 250 dbSNP
rs886747712 252 dbSNP
rs746348092 253 dbSNP
rs1003892513 262 dbSNP
rs1266349587 266 dbSNP
rs533347833 267 dbSNP
rs1213847626 268 dbSNP
rs1359576023 272 dbSNP
rs995442530 275 dbSNP
rs1468439110 277 dbSNP
rs1189920845 290 dbSNP
rs552214001 291 dbSNP
rs996586880 293 dbSNP
rs1028100706 296 dbSNP
rs1343816439 301 dbSNP
rs1025532154 303 dbSNP
rs1405596321 316 dbSNP
rs951061513 317 dbSNP
rs1420002292 320 dbSNP
rs138751391 321 dbSNP
rs373065963 322 dbSNP
rs771073282 327 dbSNP
rs963814992 328 dbSNP
rs956199506 338 dbSNP
rs1479675277 340 dbSNP
rs1426725446 342 dbSNP
rs4589703 347 dbSNP
rs958158309 349 dbSNP
rs75378194 350 dbSNP
rs1202356001 355 dbSNP
rs145499586 355 dbSNP
rs1022081391 360 dbSNP
rs1273651778 380 dbSNP
rs1165759798 391 dbSNP
rs1187065732 396 dbSNP
rs970120940 401 dbSNP
rs1321201675 402 dbSNP
rs1393743428 420 dbSNP
rs1224413530 421 dbSNP
rs1349944086 423 dbSNP
rs1459838415 426 dbSNP
rs79452962 427 dbSNP
rs928767432 431 dbSNP
rs938846792 436 dbSNP
rs1444478961 439 dbSNP
rs983671302 440 dbSNP
rs1373936124 442 dbSNP
rs914150384 443 dbSNP
rs1468538938 466 dbSNP
rs908123134 467 dbSNP
rs949456262 468 dbSNP
rs1304596424 469 dbSNP
rs567913641 470 dbSNP
rs942317882 476 dbSNP
rs533682112 478 dbSNP
rs553436139 479 dbSNP
rs1038033094 481 dbSNP
rs1470894700 481 dbSNP
rs898184622 482 dbSNP
rs1459802761 485 dbSNP
rs1264845367 486 dbSNP
rs1204064060 492 dbSNP
rs1220035321 507 dbSNP
rs1282450191 511 dbSNP
rs576458867 512 dbSNP
rs545806183 513 dbSNP
rs551571305 514 dbSNP
rs576682949 531 dbSNP
rs898339368 532 dbSNP
rs1457028023 536 dbSNP
rs995331364 539 dbSNP
rs1156447341 554 dbSNP
rs1476310460 558 dbSNP
rs141248637 559 dbSNP
rs887005278 560 dbSNP
rs1008335620 561 dbSNP
rs1244879553 562 dbSNP
rs1008023051 569 dbSNP
rs1422185215 570 dbSNP
rs1172580099 577 dbSNP
rs191319148 580 dbSNP
rs1291042351 582 dbSNP
rs1461410037 584 dbSNP
rs1243863178 585 dbSNP
rs891708211 588 dbSNP
rs1296255254 589 dbSNP
rs1011940710 593 dbSNP
rs1415055608 601 dbSNP
rs774481569 606 dbSNP
rs1353159719 607 dbSNP
rs571644647 607 dbSNP
rs1215880817 608 dbSNP
rs1295655041 611 dbSNP
rs10675591 612 dbSNP
rs142622480 612 dbSNP
rs980155232 614 dbSNP
rs1162440294 616 dbSNP
rs1422190852 622 dbSNP
rs1387053937 623 dbSNP
rs761808254 623 dbSNP
rs988267966 624 dbSNP
rs1035786406 625 dbSNP
rs1272974259 635 dbSNP
rs970991678 640 dbSNP
rs562352534 641 dbSNP
rs983636468 653 dbSNP
rs1220408929 657 dbSNP
rs1490850574 658 dbSNP
rs1293172015 663 dbSNP
rs926664350 663 dbSNP
rs183288605 669 dbSNP
rs942284232 671 dbSNP
rs973517775 687 dbSNP
rs974087128 691 dbSNP
rs919569154 695 dbSNP
rs546186785 706 dbSNP
rs1049434227 707 dbSNP
rs890876677 712 dbSNP
rs1480988370 716 dbSNP
rs886910305 734 dbSNP
rs1428867267 738 dbSNP
rs1396690754 765 dbSNP
rs1428901318 775 dbSNP
rs1388549340 776 dbSNP
rs1435159064 777 dbSNP
rs1197480498 789 dbSNP
rs1481468621 791 dbSNP
rs943985218 796 dbSNP
rs150313699 804 dbSNP
rs1479977904 806 dbSNP
rs1253573191 807 dbSNP
rs1357124069 810 dbSNP
rs1205708721 815 dbSNP
rs1432381324 817 dbSNP
rs1323223001 835 dbSNP
rs1052947767 839 dbSNP
rs899503200 840 dbSNP
rs1346852012 841 dbSNP
rs1214522257 849 dbSNP
rs564547573 850 dbSNP
rs996910881 851 dbSNP
rs187833011 852 dbSNP
rs893541784 853 dbSNP
rs1011471099 857 dbSNP
rs1021976940 860 dbSNP
rs1440924188 863 dbSNP
rs750167575 865 dbSNP
rs1001540319 867 dbSNP
rs1481581346 873 dbSNP
rs1430230319 874 dbSNP
rs760460064 891 dbSNP
rs1417366627 892 dbSNP
rs1485558591 896 dbSNP
rs1186735048 899 dbSNP
rs137918424 904 dbSNP
rs960104942 905 dbSNP
rs1261581982 908 dbSNP
rs1205959901 909 dbSNP
rs115108610 912 dbSNP
rs1015075054 914 dbSNP
rs1034338631 917 dbSNP
rs1402112816 919 dbSNP
rs959438863 926 dbSNP
rs1309079310 931 dbSNP
rs1159315894 933 dbSNP
rs1344215850 939 dbSNP
rs1432309673 945 dbSNP
rs1327324689 948 dbSNP
rs531681029 955 dbSNP
rs373491031 965 dbSNP
rs973651288 975 dbSNP
rs922194938 976 dbSNP
rs567949782 988 dbSNP
rs765952633 993 dbSNP
rs983509953 1002 dbSNP
rs1158170837 1010 dbSNP
rs1451749372 1012 dbSNP
rs1285284045 1013 dbSNP
rs533717643 1014 dbSNP
rs1241819545 1015 dbSNP
rs1185858633 1016 dbSNP
rs1256452905 1017 dbSNP
rs1462019985 1017 dbSNP
rs912261478 1021 dbSNP
rs943788660 1022 dbSNP
rs899746211 1025 dbSNP
rs149445904 1036 dbSNP
rs1358706769 1043 dbSNP
rs117213817 1054 dbSNP
rs1192881874 1056 dbSNP
rs1454405524 1062 dbSNP
rs1340793513 1070 dbSNP
rs1244783638 1076 dbSNP
rs1317923699 1081 dbSNP
rs1380675822 1082 dbSNP
rs1387406510 1082 dbSNP
rs1053373847 1088 dbSNP
rs893445659 1094 dbSNP
rs1177538131 1095 dbSNP
rs913038329 1109 dbSNP
rs1383962701 1110 dbSNP
rs753487572 1120 dbSNP
rs144195663 1121 dbSNP
rs192900192 1126 dbSNP
rs1042941169 1130 dbSNP
rs1191485658 1138 dbSNP
rs1444984551 1141 dbSNP
rs1263384561 1151 dbSNP
rs1216756709 1152 dbSNP
rs1394495410 1158 dbSNP
rs185363002 1162 dbSNP
rs778364610 1169 dbSNP
rs1356790787 1171 dbSNP
rs1269447361 1176 dbSNP
rs1323421943 1179 dbSNP
rs1328469907 1184 dbSNP
rs542549677 1194 dbSNP
rs1004116018 1196 dbSNP
rs1444870449 1210 dbSNP
rs1363732764 1212 dbSNP
rs1280503559 1215 dbSNP
rs556077741 1216 dbSNP
rs1350112539 1217 dbSNP
rs1406530368 1225 dbSNP
rs1226727824 1227 dbSNP
rs1295229574 1230 dbSNP
rs75556478 1234 dbSNP
rs1476577533 1238 dbSNP
rs1004946473 1239 dbSNP
rs1193873163 1240 dbSNP
rs541664908 1244 dbSNP
rs1266067469 1257 dbSNP
rs1027673169 1262 dbSNP
rs1452166063 1266 dbSNP
rs1439484557 1268 dbSNP
rs1193894158 1275 dbSNP
rs1272174140 1275 dbSNP
rs950654247 1280 dbSNP
rs370868022 1285 dbSNP
rs983541309 1288 dbSNP
rs778285832 1291 dbSNP
rs550617180 1292 dbSNP
rs1437256435 1294 dbSNP
rs1335728917 1295 dbSNP
rs1327392026 1301 dbSNP
rs1412020771 1303 dbSNP
rs1189579184 1304 dbSNP
rs771759210 1305 dbSNP
rs976975301 1305 dbSNP
rs578053596 1306 dbSNP
rs1029156049 1310 dbSNP
rs1474624350 1310 dbSNP
rs1179505660 1318 dbSNP
rs921222311 1334 dbSNP
rs771290883 1337 dbSNP
rs748285305 1339 dbSNP
rs534156573 1348 dbSNP
rs906255959 1354 dbSNP
rs1003743609 1355 dbSNP
rs770100874 1356 dbSNP
rs1444909744 1359 dbSNP
rs1378289376 1364 dbSNP
rs868414588 1373 dbSNP
rs138754987 1374 dbSNP
rs1403489290 1384 dbSNP
rs1370293681 1385 dbSNP
rs895290795 1388 dbSNP
rs1295397980 1406 dbSNP
rs1414561933 1411 dbSNP
rs1406527087 1421 dbSNP
rs781294599 1426 dbSNP
rs201746521 1427 dbSNP
rs1238694236 1434 dbSNP
rs1292320312 1439 dbSNP
rs1244237117 1459 dbSNP
rs1282486236 1460 dbSNP
rs1182802524 1465 dbSNP
rs1459783772 1466 dbSNP
rs1239454270 1468 dbSNP
rs1211018008 1469 dbSNP
rs1027873099 1474 dbSNP
rs1215021132 1477 dbSNP
rs1042905338 1483 dbSNP
rs1282328798 1490 dbSNP
rs141783945 1493 dbSNP
rs772830185 1495 dbSNP
rs1355105085 1498 dbSNP
rs1314921824 1509 dbSNP
rs927140499 1510 dbSNP
rs746069174 1512 dbSNP
rs770031061 1513 dbSNP
rs1304238184 1521 dbSNP
rs1448392247 1522 dbSNP
rs561671529 1541 dbSNP
rs1257840784 1542 dbSNP
rs1420957554 1543 dbSNP
rs1380876541 1544 dbSNP
rs1162798800 1545 dbSNP
rs1004886411 1546 dbSNP
rs1415611305 1548 dbSNP
rs1019054475 1551 dbSNP
rs1057089281 1557 dbSNP
rs974828260 1559 dbSNP
rs895788461 1560 dbSNP
rs1005299294 1562 dbSNP
rs1291715061 1579 dbSNP
rs559554934 1580 dbSNP
rs921115461 1583 dbSNP
rs527549211 1590 dbSNP
rs953841641 1591 dbSNP
rs115336434 1600 dbSNP
rs915151579 1601 dbSNP
rs1355654216 1606 dbSNP
rs570263786 1607 dbSNP
rs188580289 1611 dbSNP
rs1029102222 1614 dbSNP
rs889305337 1624 dbSNP
rs1009078164 1632 dbSNP
rs1019166335 1633 dbSNP
rs965037263 1635 dbSNP
rs988883061 1636 dbSNP
rs939116302 1645 dbSNP
rs1422738857 1647 dbSNP
rs192558506 1648 dbSNP
rs1165278935 1653 dbSNP
rs1427669503 1655 dbSNP
rs968860897 1657 dbSNP
rs1478195935 1669 dbSNP
rs56161233 1674 dbSNP
rs146236903 1680 dbSNP
rs555371777 1684 dbSNP
rs1332280025 1691 dbSNP
rs572790913 1699 dbSNP
rs1049378931 1701 dbSNP
rs1255774993 1712 dbSNP
rs1220022378 1717 dbSNP
rs1340741406 1718 dbSNP
rs937171897 1719 dbSNP
rs992709330 1734 dbSNP
rs1402526437 1740 dbSNP
rs917157033 1746 dbSNP
rs940656044 1753 dbSNP
rs535290508 1765 dbSNP
rs1461310940 1769 dbSNP
rs1352482583 1771 dbSNP
rs866256422 1772 dbSNP
rs1173096652 1774 dbSNP
rs1004915195 1777 dbSNP
rs558439019 1778 dbSNP
rs578105369 1779 dbSNP
rs1197418207 1785 dbSNP
rs1019378729 1787 dbSNP
rs773134716 1794 dbSNP
rs1177075868 1808 dbSNP
rs1236307877 1809 dbSNP
rs1036762754 1811 dbSNP
rs1479866493 1814 dbSNP
rs8691 1818 dbSNP
rs1318212473 1822 dbSNP
rs1262089108 1823 dbSNP
rs1230477274 1837 dbSNP
rs1343875878 1839 dbSNP
rs966050354 1841 dbSNP
rs1301905830 1842 dbSNP
rs1390680035 1849 dbSNP
rs1374562750 1852 dbSNP
rs1198327824 1854 dbSNP
rs1333180547 1856 dbSNP
rs1419740270 1859 dbSNP
rs1447209204 1864 dbSNP
rs571489487 1866 dbSNP
rs1174490456 1875 dbSNP
rs1467661228 1882 dbSNP
rs116776840 1889 dbSNP
rs1158474242 1899 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacACGACGAu 5'
                        ||||||| 
Target 5' -uccccuccccuccUGCUGCUc 3'
1 - 21
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000392011.2 | 3UTR | UCCCCUCCCCUCCUGCUGCUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.319 3.8e-2 -0.380 1.6e-2 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.364 4.4e-2 -0.350 5.1e-2 23 Click to see details
GSE19783 ER+ ER+ breast cancer -0.307 9.4e-2 -0.194 2.1e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.32 1.4e-1 -0.148 3.1e-1 13 Click to see details
GSE21032 Prostate cancer 0.115 1.5e-1 0.107 1.7e-1 83 Click to see details
GSE19536 Breast cancer 0.096 1.7e-1 0.046 3.2e-1 100 Click to see details
GSE28544 Breast cancer -0.189 1.9e-1 -0.529 3.9e-3 24 Click to see details
GSE19783 ER- ER- breast cancer 0.093 2.1e-1 0.034 3.8e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.174 2.1e-1 0.158 2.3e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.151 2.4e-1 -0.157 2.3e-1 25 Click to see details
GSE17498 Multiple myeloma -0.076 3.2e-1 0.124 2.2e-1 40 Click to see details
GSE38226 Liver fibrosis -0.107 3.2e-1 -0.116 3.1e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.053 3.4e-1 0.051 3.4e-1 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.096 3.4e-1 0.041 4.3e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.081 3.5e-1 0.000 5.0e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.123 3.5e-1 0.112 3.6e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.037 3.6e-1 -0.104 1.6e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.082 3.8e-1 0.138 3.1e-1 16 Click to see details
GSE17306 Multiple myeloma -0.027 4.3e-1 0.132 1.8e-1 49 Click to see details
GSE17306 Multiple myeloma -0.027 4.3e-1 0.132 1.8e-1 49 Click to see details
GSE17306 Multiple myeloma -0.027 4.3e-1 0.132 1.8e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.589 0 -0.610 0 42 Click to see details
KIRC -0.277 0.01 -0.239 0.02 68 Click to see details
COAD 0.751 0.02 0.667 0.04 8 Click to see details
PAAD -0.966 0.02 -0.400 0.3 4 Click to see details
BRCA -0.204 0.03 -0.319 0 84 Click to see details
BLCA 0.413 0.04 0.399 0.05 18 Click to see details
KICH -0.262 0.1 -0.383 0.03 25 Click to see details
UCEC 0.291 0.11 0.288 0.12 19 Click to see details
STAD -0.201 0.13 -0.153 0.2 32 Click to see details
KIRP -0.152 0.2 -0.153 0.2 32 Click to see details
THCA 0.093 0.24 0.039 0.38 59 Click to see details
LUAD 0.217 0.25 0.280 0.19 12 Click to see details
PRAD 0.092 0.26 0.124 0.2 50 Click to see details
LIHC 0.076 0.3 0.045 0.38 49 Click to see details
PCPG -0.572 0.31 -0.500 0.33 3 Click to see details
LUSC 0.071 0.34 0.161 0.17 38 Click to see details
ESCA -0.051 0.44 -0.045 0.45 11 Click to see details
CHOL 0.053 0.45 0.267 0.24 9 Click to see details
CESC -1 0.5 -1.000 0.5 3 Click to see details
CESC -1 0.5 -1.000 0.5 3 Click to see details
CESC -1 0.5 -1.000 0.5 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*