miRTarBase - #MIRT471495 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PDE4D   
Synonyms ACRDYS2, DPDE3, HSPDE4D, PDE43, PDE4DN2, STRK1
Description phosphodiesterase 4D
Transcript NM_001104631   
Other Transcripts NM_001165899 , NM_006203   
Expression
Putative miRNA Targets on PDE4D
3'UTR of PDE4D
(miRNA target sites are highlighted)
>PDE4D|NM_001104631|3'UTR
   1 CAGTGCAAAAACTTTCATGCCTTTTTTTTTTTTAAGTAGAAAAATTGTTTCCAAAGTGCATGTCACATGCCACAACCACG
  81 GTCACACCTCACTGTCATCTGCCAGGACGTTTGTTGAACAAAACTGACCTTGACTACTCAGTCCAGCGCTCAGGAATATC
 161 GTAACCAGTTTTTTCACCTCCATGTCATCCGAGCAAGGTGGACATCTTCACGAACAGCGTTTTTAACAAGATTTCAGCTT
 241 GGTAGAGCTGACAAAGCAGATAAAATCTACTCCAAATTATTTTCAAGAGAGTGTGACTCATCAGGCAGCCCAAAAGTTTA
 321 TTGGACTTGGGGTTTCTATTCCTTTTTATTTGTTTGCAATATTTTCAGAAGAAAGGCATTGCACAGAGTGAACTTAATGG
 401 ACGAAGCAACAAATATGTCAAGAACAGGACATAGCACGAATCTGTTACCAGTAGGAGGAGGATGAGCCACAGAAATTGCA
 481 TAATTTTCTAATTTCAAGTCTTCCTGATACATGACTGAATAGTGTGGTTCAGTGAGCTGCACTGACCTCTACATTTTGTA
 561 TGATATGTAAAACAGATTTTTTGTAGAGCTTACTTTTATTATTAAATGTATTGAGGTATTATATTTAAAAAAAACTATGT
 641 TCAGAACTTCATCTGCCACTGGTTATTTTTTTCTAAGGAGTAACTTGCAAGTTTTCAGTACAAATCTGTGCTACACTGGA
 721 TAAAAATCTAATTTATGAATTTTACTTGCACCTTATAGTTCATAGCAATTAACTGATTTGTAGTGATTCATTGTTTGTTT
 801 TATATACCAATGACTTCCATATTTTAAAAGAGAAAAACAACTTTATGTTGCAGGAAACCCTTTTTGTAAGTCTTTATTAT
 881 TTACTTTGCATTTTGTTTCACTCTTTCCAGATAAGCAGAGTTGCTCTTCACCAGTGTTTTTCTTCATGTGCAAAGTGACT
 961 ATTTGTTCTATAATACTTTTATGTGTGTTATATCAAATGTGTCTTAAGCTTCATGCAAACTCAGTCATCAGTTCGTGTTG
1041 TCTGAAGCAAGTGGGAGATATATAAATACCCAGTAGCTAAAATGGTCAGTCTTTTTTAGATGTTTTCCTACTTAGTATCT
1121 CCTAATAACGTTTTGCTGTGTCACTAGATGTTCATTTCACAAGTGCATGTCTTTCTAATAATCCACACATTTCATGCTCT
1201 AATAATCCACACATTTCATGCTCATTTTTATTGTTTTTACAGCCAGTTATAGTAAGAAAAAGGTTTTTCCCCTTGTGCTG
1281 CTTTATAATTTAGCGTGTGTCTGAACCTTATCCATGTTTGCTAGATGAGGTCTTGTCAAATATATCACTACCATTGTCAC
1361 CGGTGAAAAGAAACAGGTAGTTAAGTTAGGGTTAACATTCATTTCAACCACGAGGTTGTATATCATGACTAGCTTTTACT
1441 CTTGGTTTACAGAGAAAAGTTAAACAGCCAACTAGGCAGTTTTTAAGAATATTAACAATATATTAACAAACACCAATACA
1521 ACTAATCCTATTTGGTTTTAATGATTTCACCATGGGATTAAGAACTATATCAGGAACATCCCTGAGAAACGGTTTTAAGT
1601 GTAGCAACTACTCTTCCTTAATGGACAGCCACATAACGTGTAGGAAGTCCTTTATCACTTATCCTCGATCCATAAGCATA
1681 TCTTGCAGAGGGGAACTACTTCTTTAAACACATGGAGGGAAAGAAGATGATGCCACTGGCACCAGAGGGTTAGTACTGTG
1761 ATGCATCCTAAAATATTTATTATATTGGTAAAAATTCTGGTTAAATAAAAAATTAGAGATCACTCTTGGCTGATTTCAGC
1841 ACCAGGAACTGTATTACAGTTTTAGAGATTAATTCCTAGTGTTTACCTGATTATAGCAGTTGGCATCATGGGGCATTTAA
1921 TTCTGACTTTATCCCCACGTCAGCCTTAATAAAGTCTTCTTTACCTTCTCTATGAAGACTTTAAAGCCCAAATAATCATT
2001 TTTCACATTGATATTCAAGAATTGAGATAGATAGAAGCCAAAGTGGGTATCTGACAAGTGGAAAATCAAACGTTTAAGAA
2081 GAATTACAACTCTGAAAAGCATTTATATGTGGAACTTCTCAAGGAGCCTCCTGGGGACTGGAAAGTAAGTCATCAGCCAG
2161 GCAAATGACTCATGCTGAAGAGAGTCCCCATTTCAGTCCCCTGAGATCTAGCTGATGCTTAGATCCTTTGAAATAAAAAT
2241 TATGTCTTTATAACTCTGATCTTTTACATAAAGCAGAAGAGGAATCAACTAGTTAATTGCAAGGTTTCTACTCTGTTTCC
2321 TCTGTAAAGATCAGATGGTAATCTTTCAAATAAGAAAAAAATAAAGACGTATGTTTGACCAAGTAGTTTCACAAGAATAT
2401 TTGGGAACTTGTTTCTTTTAATTTTATTTGTCCCTGAGTGAAGTCTAGAAAGAAAGGTAAAGAGTCTAGAGTTTATTCCT
2481 CTTTCCAAAACATTCTCATTCCTCTCCTCCCTACACTTAGTATTTCCCCCACAGAGTGCCTAGAATCTTAATAATGAATA
2561 AAATAAAAAGCAGCAATATGTCATTAACAAATCCAGACCTGAAAGGGTAAAGGGTTTATAACTGCACTAATAAAGAGAGG
2641 CTCTTTTTTTTTCTTCCAGTTTGTTGGTTTTTAATGGTACCGTGTTGTAAAGATACCCACTAATGGACAATCAAATTGCA
2721 GAAAAGGCTCAATATCCAAGAGACAGGGACTAATGCACTGTACAATCTGCTTATCCTTGCCCTTCTCTCTTGCCAAAGTG
2801 TGCTTCAGAAATATATACTGCTTTAAAAAAGAATAAAAGAATATCCTTTTACAAGTGGCTTTACATTTCCTAAAATGCCA
2881 TAAGAAAATGCAATATCTGGGTACTGTATGGGGAAAAAAATGTCCAAGTTTGTGTAAAACCAGTGCATTTCAGCTTGCAA
2961 GTTACTGAACACAATAATGCTGTTTTAATTTTGTTTTATATCAGTTAAAATTCACAATAATGTAGATAGAACAAATTACA
3041 GACAAGGAAAGAAAAAACTTGAATGAAATGGATTTTACAGAAAGCTTTATGATAATTTTTGAATGCATTATTTATTTTTT
3121 GTGCCATGCATTTTTTTTCTCACCAAATGACCTTACCTGTAATACAGTCTTGTTTGTCTGTTTACAACCATGTATTTATT
3201 GCAATGTACATACTGTAATGTTAATTGTAAATTATCTGTTCTTATTAAAACATCATCCCATGATGGGATGGTGTTGATAT
3281 ATTTGGAAACTCTTGGTGAGAGAATGAATGGTGTGTATACATACTCTGTACATTTTTCTTTTCTCCTGTAATATAGTCTT
3361 GTCACCTTAGAGCTTGTTTATGGAAGATTCAAGAAAACTATAAAATACTTAAAGATATATAAATTTAAAAAAACATAGCT
3441 GCAGGTCTTTGGTCCCAGGGCTGTGCCTTAACTTTAACCAATATTTTCTTCTGTTTTGCTGCATTTGAAAGGTAACAGTG
3521 GAGCTAGGGCTGGGCATTTTACATCCAGGCTTTTAATTGATTAGAATTCTGCCAATAGGTGGATTTTACAAAACCACAGA
3601 CAACCTCTGAAAGATTCTGAGACCCTTTTGAGACAGAAGCTCTTAAGTACTTCTTGCCAGGGAGCAGCACTGCATGTGTG
3681 ATGGTTGTTTGCCATCTGTTGATCAGGAACTACTTCAGCTACTTGCATTTGATTATTTCCTTTTTTTTTTTTTTTAACTC
3761 GGAAACACAACTGGGGAAATATATTCTTTCCCAGTGATTATAAACAATCTTTTTCTTTTTTTTAAGTCCTTTTGGCTTCT
3841 AGAGCTCATAGGAAAATGGACTTGATTTGAAATTGGAGCCAGAGTTTACTCGTGTTGGTTATCTATTCATCAGCTTCCTG
3921 ACATGTTAAGAGAATACATTAAAGAGAAAATACTGTTTTTTAATCCTAAAATTTTTCTTCCACTAAGATAAACCAAATGT
4001 CCTTACATATATGTAAACCCATCTATTTAAACGCAAAGGTGGGTTGATGTCAGTTTACATAGCAGAAAGCATTCACTATC
4081 CTCTAAGATTTGTTTCTGCAAAACTTTCATTGCTTTAGAATTTTAAAATTTCACCTTGTACAATGGCCAGCCCCTAAAGC
4161 AGGAAACATTTATAATGGATTATATGGAAACATCCTCCCAGTACTTGCCCAGCCCTTGAATCATGTGGCTTTTCAGTGAA
4241 AGGAAAGATTCTTTTTCTAGGAAAAATGAGCCTATTTTATTTTATTTTATTTTATTTTTTGACACAAACTGTAGATTTTA
4321 GCAGCCCTGGCCCAAAGGAATTTGATTACTTTTGTTTTAAACAGTACAAAGGGGACACTATAATTACAAAAACATCCTTA
4401 ACTGATTTGAGTTGTTTTTATTTCTTTGGATATATTTTCAGAGTGGTAAATTGTGTGTGAGAATTACAAATGATTATTCT
4481 TTTAGTGGTTTCTTAGCCTCTCTTACAGCCCACGGGGATAGTACTGTACATCAATACCTTCATATGAAATTTTTATATGC
4561 AATGAAAATAAAAGCATGGGTTGATTCTGCCTATTTATGACTCAATCTTTTACAAATAAAAGATTATTCATTTTAAATTA
4641 TAGTTCAATCAGCATGTCTCTTAGGATACTGAACGTGGTTGAAATGAAAGGATAGTGACATCATAAGTTAGTACTGATAT
4721 TCATAACCAAATAAAGCCAACTTGAGTAATTTTGCTACATTAAAAATTACCAAAATTACTTAGATGGCCTATAAGATTAA
4801 GCATGGTGTTTTCTAAGCAAGCTTTGAAAGGGGCCTTCCATACTTACTTAATTGAATATTCTGGGATATTGAAAATTATT
4881 CAGATACTTGACAATTATTTTTGGTTACCTACTCCGCAAACTACAAAGTTTTAAGGACTCAACAATAAGTTAATGAGACA
4961 CAGTGTTTGCTTTCATGGAGCTTACAGTCTGGAGGGGACAAAGGCTTAAACAATACTCATATAATTATATATGTGATCAG
5041 TACAATGAAGGAGCTCAGTGGGGTAAATAAGCAGGAACCTGAACTTGATCTGTTCCGGAGGGCCACAGAAGGCTTCCTTG
5121 AGGCCTTGAGAAAGTGATTTGCATCTGAGTTCTGAAGGATTGTAAGAGGTAACTAGGGAAAAAGTTGACAGGAAGAGGAA
5201 GGGGATCCAGACAAGAAACATTTGCAAAGATCTTGAGGCATAAATGAGCTTGAGACATCTGGAGAAACTGAGGAAAAGTG
5281 AGAGAGTAGGCAGGGCCTGGAGCCGCAGAGCCATTGCTAACCATCCTGTGTGAGATATCCCCCATTCTGTAGCTTTATTC
5361 TCATAACCCTGCTCAATTTTCTTTATAACACTTCTCACAGATTTATATACGTGTTTGTTTTTGTTATCTGTCTCTCCCAC
5441 CAGACCACAGCTCCATGAGAGCAAGGTCTTTGCTTACCAATATATCACTAGCACTTAAAACTATGCCTGGTACACAGTAG
5521 GTTCTTAATATGTGTTGAATATAGCCATCAAATTGATATTGGATATAATTCAATCTGATAAGATATTTTGAGATATTAAA
5601 GAGTTTTTAACTTGATACCATAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || |  ||||||||| 
Target 5' tttttcCCCT--TGTGCTGCTt 3'
1264 - 1283 152.00 -14.80
2
miRNA  3' guGUUUG-GUAAUACACGACGAu 5'
            ::||| || ||  |||||:| 
Target 5' acTGAACACAATA-ATGCTGTTt 3'
2964 - 2985 139.00 -9.30
3
miRNA  3' guguUUGGU--------AAUAC---ACGACGau 5'
              |||||        || ||   ||||||  
Target 5' ctttAACCAATATTTTCTTCTGTTTTGCTGCat 3'
3472 - 3504 128.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
353983 34 ClinVar
904241 58 ClinVar
904240 131 ClinVar
904239 310 ClinVar
353982 352 ClinVar
904238 403 ClinVar
904237 414 ClinVar
353981 421 ClinVar
907571 466 ClinVar
353980 501 ClinVar
907570 535 ClinVar
353979 583 ClinVar
353978 649 ClinVar
353977 780 ClinVar
353976 801 ClinVar
353975 818 ClinVar
353974 831 ClinVar
353973 876 ClinVar
353972 1023 ClinVar
353971 1034 ClinVar
353970 1200 ClinVar
353969 1201 ClinVar
353968 1251 ClinVar
353967 1268 ClinVar
353966 1278 ClinVar
906555 1295 ClinVar
353965 1323 ClinVar
353964 1361 ClinVar
353963 1379 ClinVar
353962 1446 ClinVar
353961 1464 ClinVar
906554 1572 ClinVar
353960 1636 ClinVar
904971 1637 ClinVar
353959 1638 ClinVar
353958 1649 ClinVar
904970 1729 ClinVar
353957 1773 ClinVar
904969 1778 ClinVar
353956 1782 ClinVar
904968 1850 ClinVar
353955 1924 ClinVar
353954 1938 ClinVar
353953 2003 ClinVar
353952 2004 ClinVar
353951 2036 ClinVar
904188 2066 ClinVar
353950 2100 ClinVar
353949 2167 ClinVar
904187 2185 ClinVar
904186 2198 ClinVar
904185 2225 ClinVar
353948 2244 ClinVar
353947 2279 ClinVar
353946 2288 ClinVar
353945 2329 ClinVar
907512 2336 ClinVar
353944 2369 ClinVar
353943 2383 ClinVar
353942 2484 ClinVar
907511 2510 ClinVar
353941 2515 ClinVar
906504 2604 ClinVar
353940 2653 ClinVar
353939 2654 ClinVar
353938 2747 ClinVar
353937 2768 ClinVar
906503 2841 ClinVar
353936 2934 ClinVar
353935 2999 ClinVar
904908 3028 ClinVar
353934 3167 ClinVar
904907 3210 ClinVar
353933 3214 ClinVar
904906 3325 ClinVar
353932 3349 ClinVar
904133 3418 ClinVar
904132 3492 ClinVar
353931 3562 ClinVar
353930 3588 ClinVar
353929 3756 ClinVar
353928 3844 ClinVar
904131 3863 ClinVar
353927 3875 ClinVar
904130 3892 ClinVar
353926 4001 ClinVar
353925 4039 ClinVar
353924 4299 ClinVar
353923 4398 ClinVar
353922 4513 ClinVar
907450 4524 ClinVar
907449 4529 ClinVar
353921 4622 ClinVar
353920 4659 ClinVar
353919 4660 ClinVar
353918 4675 ClinVar
906457 4703 ClinVar
906456 4727 ClinVar
906455 4886 ClinVar
353917 4915 ClinVar
353916 4965 ClinVar
904840 4981 ClinVar
353915 5000 ClinVar
353914 5118 ClinVar
353913 5125 ClinVar
353912 5190 ClinVar
904839 5201 ClinVar
353911 5241 ClinVar
353910 5260 ClinVar
353909 5283 ClinVar
353908 5295 ClinVar
904060 5304 ClinVar
353907 5413 ClinVar
353906 5545 ClinVar
COSN14173764 21 COSMIC
COSN17153057 22 COSMIC
COSN5854600 22 COSMIC
COSN19729385 33 COSMIC
COSN26988392 55 COSMIC
COSN31614371 98 COSMIC
COSN30174963 109 COSMIC
COSN6923120 141 COSMIC
COSN31542675 148 COSMIC
COSN30159453 200 COSMIC
COSN30127433 219 COSMIC
COSN30173392 235 COSMIC
COSN16398518 245 COSMIC
COSN26416371 270 COSMIC
COSN20101279 345 COSMIC
COSN7948353 462 COSMIC
COSN31603401 540 COSMIC
COSN31539787 626 COSMIC
COSN7948352 703 COSMIC
COSN2111966 789 COSMIC
COSN2111965 790 COSMIC
COSN32057715 808 COSMIC
COSN19379049 852 COSMIC
COSN31544328 1035 COSMIC
COSN21135027 1256 COSMIC
COSN5607990 1545 COSMIC
COSN5607989 1639 COSMIC
COSN7948351 1656 COSMIC
COSN27577494 1695 COSMIC
COSN20101278 1774 COSMIC
COSN27779212 1823 COSMIC
COSN6923119 1890 COSMIC
COSN31588620 2242 COSMIC
COSN28647603 2279 COSMIC
COSN28650093 2288 COSMIC
COSN26670605 2390 COSMIC
COSN28759779 2390 COSMIC
COSN31486041 2424 COSMIC
COSN32058421 2425 COSMIC
COSN25028166 2448 COSMIC
COSN20761252 2504 COSMIC
COSN1317542 2516 COSMIC
COSN20540195 2527 COSMIC
COSN31483139 2556 COSMIC
COSN20101277 2653 COSMIC
COSN5865470 2653 COSMIC
COSN7948350 2658 COSMIC
COSN28769945 2768 COSMIC
COSN31570667 2785 COSMIC
COSN28202154 2846 COSMIC
COSN15809921 2852 COSMIC
COSN31540209 2911 COSMIC
COSN198006 2913 COSMIC
COSN28249882 3101 COSMIC
COSN31550228 3114 COSMIC
COSN1317541 3141 COSMIC
COSN26537871 3187 COSMIC
COSN29667614 3221 COSMIC
COSN6923118 3273 COSMIC
COSN31517598 3338 COSMIC
COSN4851008 3482 COSMIC
COSN23600393 3576 COSMIC
COSN20101275 3740 COSMIC
COSN21397867 3936 COSMIC
COSN19390239 4046 COSMIC
COSN6923117 4234 COSMIC
COSN25267266 4375 COSMIC
COSN14542937 4481 COSMIC
COSN20091195 4622 COSMIC
COSN24596002 4677 COSMIC
COSN26863079 4713 COSMIC
COSN8227468 4783 COSMIC
COSN27051448 4787 COSMIC
COSN17503135 4915 COSMIC
COSN2111964 5148 COSMIC
COSN2111963 5374 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1460008046 1 dbSNP
rs370365789 2 dbSNP
rs1249944398 5 dbSNP
rs1209496255 10 dbSNP
rs1328738750 17 dbSNP
rs1315505315 21 dbSNP
rs1266546460 22 dbSNP
rs759703744 23 dbSNP
rs1322710947 26 dbSNP
rs1402955673 29 dbSNP
rs1491310362 33 dbSNP
rs1005677352 34 dbSNP
rs10718401 34 dbSNP
rs397997883 34 dbSNP
rs751784437 34 dbSNP
rs763278820 34 dbSNP
rs766741732 34 dbSNP
rs773431085 34 dbSNP
rs79105607 34 dbSNP
rs972201598 34 dbSNP
rs1394833761 35 dbSNP
rs1299462808 36 dbSNP
rs755938801 37 dbSNP
rs762155218 39 dbSNP
rs750197206 43 dbSNP
rs767435835 46 dbSNP
rs1256107836 51 dbSNP
rs963578789 58 dbSNP
rs1206189263 59 dbSNP
rs994297405 61 dbSNP
rs574884011 66 dbSNP
rs1189628499 67 dbSNP
rs1224801118 69 dbSNP
rs1041094406 70 dbSNP
rs1431695604 75 dbSNP
rs746541836 79 dbSNP
rs746025590 80 dbSNP
rs544400405 108 dbSNP
rs1467633802 109 dbSNP
rs942669789 111 dbSNP
rs889707464 124 dbSNP
rs953481477 131 dbSNP
rs779139607 132 dbSNP
rs1365173964 136 dbSNP
rs185448056 147 dbSNP
rs557609939 148 dbSNP
rs1226044912 149 dbSNP
rs1266879465 152 dbSNP
rs1329107596 156 dbSNP
rs947212976 160 dbSNP
rs1391083764 166 dbSNP
rs1262911983 167 dbSNP
rs1487695449 175 dbSNP
rs1190886417 178 dbSNP
rs901083094 181 dbSNP
rs1180125101 184 dbSNP
rs1411269087 187 dbSNP
rs770867204 190 dbSNP
rs1457730554 191 dbSNP
rs1338851855 195 dbSNP
rs1161160534 204 dbSNP
rs1347963648 207 dbSNP
rs377237433 211 dbSNP
rs1053064868 212 dbSNP
rs998649728 215 dbSNP
rs913042599 216 dbSNP
rs1052549879 217 dbSNP
rs904368689 219 dbSNP
rs1043173930 225 dbSNP
rs948478131 229 dbSNP
rs1350537430 230 dbSNP
rs1229604329 239 dbSNP
rs928016436 242 dbSNP
rs915673011 247 dbSNP
rs12187668 248 dbSNP
rs749366994 255 dbSNP
rs969321050 256 dbSNP
rs1159600999 258 dbSNP
rs1330416087 260 dbSNP
rs1471376822 266 dbSNP
rs938387620 275 dbSNP
rs919468216 285 dbSNP
rs1362460483 299 dbSNP
rs1251223935 300 dbSNP
rs984307959 305 dbSNP
rs1178950369 306 dbSNP
rs558677290 310 dbSNP
rs1423118127 315 dbSNP
rs1165251015 316 dbSNP
rs1457087679 317 dbSNP
rs942166437 320 dbSNP
rs1205022539 323 dbSNP
rs1427473134 324 dbSNP
rs909403593 326 dbSNP
rs1026213638 329 dbSNP
rs1443730834 335 dbSNP
rs1277862179 336 dbSNP
rs1300496686 337 dbSNP
rs1377635454 338 dbSNP
rs1228201643 339 dbSNP
rs1313920942 340 dbSNP
rs1361998689 341 dbSNP
rs1226529268 342 dbSNP
rs1274186675 348 dbSNP
rs202085578 348 dbSNP
rs1206734782 352 dbSNP
rs35684984 352 dbSNP
rs371424051 352 dbSNP
rs1235759814 353 dbSNP
rs1224233453 357 dbSNP
rs1352716906 359 dbSNP
rs965496730 361 dbSNP
rs1277609577 363 dbSNP
rs1447423262 363 dbSNP
rs1167643484 364 dbSNP
rs1239148127 374 dbSNP
rs756074460 376 dbSNP
rs1006566484 380 dbSNP
rs1358030135 384 dbSNP
rs889422180 386 dbSNP
rs1337939143 398 dbSNP
rs1385509043 398 dbSNP
rs752738157 403 dbSNP
rs1030455444 414 dbSNP
rs1343168733 416 dbSNP
rs891657840 417 dbSNP
rs1053349294 419 dbSNP
rs1311660822 421 dbSNP
rs886060715 421 dbSNP
rs928040761 422 dbSNP
rs1244885934 429 dbSNP
rs1046441921 430 dbSNP
rs535231823 432 dbSNP
rs1476206988 434 dbSNP
rs1189068066 435 dbSNP
rs948068876 437 dbSNP
rs956694767 438 dbSNP
rs1031559691 448 dbSNP
rs1408958515 463 dbSNP
rs140371223 466 dbSNP
rs916556638 467 dbSNP
rs998801229 477 dbSNP
rs1383420300 481 dbSNP
rs952950016 488 dbSNP
rs1273291210 490 dbSNP
rs1367083069 492 dbSNP
rs1445546044 500 dbSNP
rs527630861 501 dbSNP
rs1327022782 504 dbSNP
rs904462159 505 dbSNP
rs552919717 507 dbSNP
rs1442275156 509 dbSNP
rs1021444404 510 dbSNP
rs1219002045 516 dbSNP
rs1236429818 533 dbSNP
rs781074391 535 dbSNP
rs894220889 539 dbSNP
rs1200986405 542 dbSNP
rs1056810858 549 dbSNP
rs938313851 551 dbSNP
rs1448726271 552 dbSNP
rs1409078621 562 dbSNP
rs1282064914 566 dbSNP
rs1215639018 568 dbSNP
rs1386209419 569 dbSNP
rs897507155 570 dbSNP
rs1359823261 575 dbSNP
rs1294255231 577 dbSNP
rs1244106307 578 dbSNP
rs886060714 583 dbSNP
rs537772870 585 dbSNP
rs1285305387 587 dbSNP
rs1348672953 591 dbSNP
rs1019791713 596 dbSNP
rs1432969709 598 dbSNP
rs1325203545 602 dbSNP
rs1298062230 604 dbSNP
rs1425713566 612 dbSNP
rs146550468 615 dbSNP
rs1162025198 621 dbSNP
rs1224215768 621 dbSNP
rs1249052792 623 dbSNP
rs942280957 627 dbSNP
rs1182179786 631 dbSNP
rs909484793 634 dbSNP
rs1021283312 635 dbSNP
rs1471407655 635 dbSNP
rs1011528675 637 dbSNP
rs771800083 638 dbSNP
rs1305163410 639 dbSNP
rs143651288 640 dbSNP
rs886060713 649 dbSNP
rs932181149 658 dbSNP
rs1409281959 659 dbSNP
rs1240300719 665 dbSNP
rs1192796773 670 dbSNP
rs1337488340 673 dbSNP
rs1490482971 682 dbSNP
rs1283423521 684 dbSNP
rs1359860549 686 dbSNP
rs1182305877 688 dbSNP
rs1270840805 689 dbSNP
rs1272041047 691 dbSNP
rs1340943239 697 dbSNP
rs192747895 701 dbSNP
rs1195881999 705 dbSNP
rs1251984224 707 dbSNP
rs1440086241 708 dbSNP
rs1219958829 711 dbSNP
rs923311121 711 dbSNP
rs1237314815 727 dbSNP
rs1053001308 729 dbSNP
rs1321417587 732 dbSNP
rs1388555073 733 dbSNP
rs1273895949 736 dbSNP
rs1168601863 738 dbSNP
rs1003126961 739 dbSNP
rs1394271838 745 dbSNP
rs187460970 748 dbSNP
rs948118933 750 dbSNP
rs1295061210 753 dbSNP
rs1406139853 754 dbSNP
rs956667485 771 dbSNP
rs1347917732 778 dbSNP
rs1301750176 779 dbSNP
rs1342231369 779 dbSNP
rs886060712 780 dbSNP
rs1436203527 787 dbSNP
rs1348951779 789 dbSNP
rs1030989820 790 dbSNP
rs1170641494 791 dbSNP
rs1048371761 793 dbSNP
rs1420885098 795 dbSNP
rs1464608487 801 dbSNP
rs200995197 801 dbSNP
rs111824883 808 dbSNP
rs918840083 809 dbSNP
rs968656639 810 dbSNP
rs1021999235 811 dbSNP
rs1012712100 815 dbSNP
rs35839600 816 dbSNP
rs1197018390 817 dbSNP
rs67531361 817 dbSNP
rs139587044 818 dbSNP
rs1283305096 822 dbSNP
rs1233689055 824 dbSNP
rs1324920623 825 dbSNP
rs1206843835 827 dbSNP
rs1206090290 828 dbSNP
rs1266682501 828 dbSNP
rs369129936 831 dbSNP
rs1257562215 841 dbSNP
rs1035372053 842 dbSNP
rs1198822691 844 dbSNP
rs766147057 846 dbSNP
rs564008297 847 dbSNP
rs1430022915 848 dbSNP
rs1481398793 848 dbSNP
rs779353227 849 dbSNP
rs545678251 856 dbSNP
rs1002598291 858 dbSNP
rs1454115793 860 dbSNP
rs1281860309 861 dbSNP
rs1290344196 862 dbSNP
rs897606388 864 dbSNP
rs755406685 866 dbSNP
rs202165590 869 dbSNP
rs1283413809 872 dbSNP
rs573384171 872 dbSNP
rs1300227445 873 dbSNP
rs1262818351 874 dbSNP
rs3839217 875 dbSNP
rs386403886 875 dbSNP
rs140301103 876 dbSNP
rs199967190 876 dbSNP
rs1021335909 880 dbSNP
rs1221978765 880 dbSNP
rs989816935 882 dbSNP
rs1397654490 887 dbSNP
rs372901892 888 dbSNP
rs1044567243 891 dbSNP
rs1431370344 897 dbSNP
rs1173806882 900 dbSNP
rs1432416450 902 dbSNP
rs1366468354 903 dbSNP
rs1408490498 904 dbSNP
rs1178705965 905 dbSNP
rs1438130393 907 dbSNP
rs1366973062 908 dbSNP
rs1032019041 909 dbSNP
rs1237799766 910 dbSNP
rs1204393606 913 dbSNP
rs1462667843 915 dbSNP
rs1306813554 918 dbSNP
rs1373283233 929 dbSNP
rs1036017424 932 dbSNP
rs1002769389 940 dbSNP
rs1309650752 943 dbSNP
rs1320264171 945 dbSNP
rs907052777 957 dbSNP
rs569185580 961 dbSNP
rs1261842523 964 dbSNP
rs1361773984 965 dbSNP
rs1203127330 968 dbSNP
rs1022738915 976 dbSNP
rs1158020176 976 dbSNP
rs1210076674 980 dbSNP
rs530742885 980 dbSNP
rs1012317949 982 dbSNP
rs895229530 990 dbSNP
rs1318020019 993 dbSNP
rs888034262 1003 dbSNP
rs1386720016 1004 dbSNP
rs1427364231 1006 dbSNP
rs1051123488 1009 dbSNP
rs932135974 1018 dbSNP
rs886060711 1023 dbSNP
rs1300407031 1024 dbSNP
rs931316042 1026 dbSNP
rs886060710 1034 dbSNP
rs145750635 1035 dbSNP
rs1385292454 1040 dbSNP
rs1226407990 1049 dbSNP
rs935389957 1058 dbSNP
rs1308137689 1060 dbSNP
rs912765104 1060 dbSNP
rs1206618350 1061 dbSNP
rs1308002033 1061 dbSNP
rs1460769405 1062 dbSNP
rs1488603027 1063 dbSNP
rs985619216 1065 dbSNP
rs1183992408 1080 dbSNP
rs550896063 1083 dbSNP
rs1447321994 1084 dbSNP
rs1407602451 1087 dbSNP
rs1300536439 1095 dbSNP
rs1411154387 1098 dbSNP
rs979452973 1098 dbSNP
rs968453316 1100 dbSNP
rs541866920 1104 dbSNP
rs1469697233 1106 dbSNP
rs749948288 1118 dbSNP
rs914459105 1119 dbSNP
rs1337839323 1123 dbSNP
rs574827993 1129 dbSNP
rs991825244 1130 dbSNP
rs989869291 1135 dbSNP
rs553526225 1138 dbSNP
rs1299218048 1143 dbSNP
rs1322767248 1149 dbSNP
rs1204183427 1154 dbSNP
rs1264822089 1159 dbSNP
rs1379933332 1160 dbSNP
rs1031316461 1166 dbSNP
rs1242346288 1170 dbSNP
rs1476158001 1173 dbSNP
rs1188976269 1175 dbSNP
rs1184393156 1177 dbSNP
rs1427941952 1177 dbSNP
rs541604095 1177 dbSNP
rs1446556561 1182 dbSNP
rs1177768500 1192 dbSNP
rs1254222805 1193 dbSNP
rs1181336516 1196 dbSNP
rs577495801 1200 dbSNP
rs559220819 1201 dbSNP
rs961762846 1202 dbSNP
rs766480342 1206 dbSNP
rs1262942452 1214 dbSNP
rs1224113114 1218 dbSNP
rs765434017 1224 dbSNP
rs780488224 1226 dbSNP
rs183295023 1227 dbSNP
rs1214922091 1232 dbSNP
rs1223016577 1239 dbSNP
rs764716521 1240 dbSNP
rs1284906419 1249 dbSNP
rs1246310567 1250 dbSNP
rs17719258 1251 dbSNP
rs971330026 1252 dbSNP
rs1310032828 1258 dbSNP
rs1432100130 1260 dbSNP
rs1469008742 1262 dbSNP
rs570292182 1267 dbSNP
rs886060709 1268 dbSNP
rs1402706369 1269 dbSNP
rs775984561 1278 dbSNP
rs1417660387 1285 dbSNP
rs1359622055 1290 dbSNP
rs1163953794 1294 dbSNP
rs556877242 1295 dbSNP
rs1355103036 1297 dbSNP
rs772386939 1299 dbSNP
rs995582527 1304 dbSNP
rs1366927892 1314 dbSNP
rs1441345622 1319 dbSNP
rs902125304 1320 dbSNP
rs1279965204 1321 dbSNP
rs149834563 1323 dbSNP
rs1243401699 1328 dbSNP
rs571553832 1342 dbSNP
rs1290582287 1343 dbSNP
rs191178674 1344 dbSNP
rs1224099125 1348 dbSNP
rs1248933575 1350 dbSNP
rs1436616570 1353 dbSNP
rs1181690076 1354 dbSNP
rs187518449 1361 dbSNP
rs1471361348 1362 dbSNP
rs547172801 1363 dbSNP
rs879138654 1367 dbSNP
rs1192078890 1368 dbSNP
rs1488231852 1374 dbSNP
rs923981567 1377 dbSNP
rs886060708 1379 dbSNP
rs1165586113 1381 dbSNP
rs1358111037 1384 dbSNP
rs1394386151 1388 dbSNP
rs1409354573 1389 dbSNP
rs1329442406 1390 dbSNP
rs891381351 1390 dbSNP
rs1450199738 1399 dbSNP
rs1243452575 1400 dbSNP
rs1247673446 1407 dbSNP
rs1383110420 1407 dbSNP
rs1049970851 1411 dbSNP
rs1307519236 1411 dbSNP
rs932818665 1412 dbSNP
rs1274332527 1415 dbSNP
rs1459439862 1422 dbSNP
rs1182157957 1424 dbSNP
rs1044205335 1428 dbSNP
rs946708107 1429 dbSNP
rs1445515037 1431 dbSNP
rs1339736993 1440 dbSNP
rs1303604245 1442 dbSNP
rs1371467924 1443 dbSNP
rs886060707 1446 dbSNP
rs1475128157 1447 dbSNP
rs1352460118 1452 dbSNP
rs916584320 1453 dbSNP
rs1406467532 1454 dbSNP
rs1468129476 1462 dbSNP
rs140905619 1464 dbSNP
rs1406511511 1467 dbSNP
rs1454297374 1468 dbSNP
rs1292987537 1469 dbSNP
rs1325424890 1483 dbSNP
rs1162838332 1484 dbSNP
rs1462588500 1492 dbSNP
rs1227542322 1494 dbSNP
rs1374902634 1495 dbSNP
rs1168596117 1497 dbSNP
rs1306255053 1498 dbSNP
rs1320664752 1506 dbSNP
rs1430606486 1507 dbSNP
rs990861515 1513 dbSNP
rs958603813 1521 dbSNP
rs1462036023 1524 dbSNP
rs934412726 1527 dbSNP
rs1450177453 1529 dbSNP
rs924304813 1534 dbSNP
rs1446589956 1543 dbSNP
rs1264859196 1547 dbSNP
rs182839747 1555 dbSNP
rs1480739273 1557 dbSNP
rs981239445 1559 dbSNP
rs1259490990 1567 dbSNP
rs528207347 1568 dbSNP
rs961856114 1572 dbSNP
rs1470833816 1575 dbSNP
rs1286845294 1580 dbSNP
rs1383823945 1587 dbSNP
rs1014643546 1590 dbSNP
rs991340204 1591 dbSNP
rs1343073623 1596 dbSNP
rs1222286804 1600 dbSNP
rs1283200522 1608 dbSNP
rs951900686 1609 dbSNP
rs1006396904 1622 dbSNP
rs1235167362 1628 dbSNP
rs1329096001 1629 dbSNP
rs1263136385 1631 dbSNP
rs138187044 1636 dbSNP
rs190993206 1637 dbSNP
rs10075508 1638 dbSNP
rs1205917084 1648 dbSNP
rs530824932 1649 dbSNP
rs1489877703 1653 dbSNP
rs1198695495 1661 dbSNP
rs1269541461 1661 dbSNP
rs563437810 1662 dbSNP
rs1008232027 1664 dbSNP
rs902092589 1666 dbSNP
rs867532098 1667 dbSNP
rs1040651283 1669 dbSNP
rs999658660 1670 dbSNP
rs1159927652 1673 dbSNP
rs1050022964 1675 dbSNP
rs902691854 1678 dbSNP
rs369662586 1679 dbSNP
rs893337074 1679 dbSNP
rs997081619 1679 dbSNP
rs1377466394 1685 dbSNP
rs1043791826 1686 dbSNP
rs1419368940 1693 dbSNP
rs934443244 1700 dbSNP
rs1316679450 1702 dbSNP
rs924384790 1705 dbSNP
rs1045855773 1706 dbSNP
rs949736583 1707 dbSNP
rs946770798 1711 dbSNP
rs895263046 1715 dbSNP
rs1055043111 1725 dbSNP
rs751797196 1729 dbSNP
rs1419450893 1733 dbSNP
rs1456892552 1733 dbSNP
rs1180205913 1735 dbSNP
rs939395717 1740 dbSNP
rs1383026066 1748 dbSNP
rs940598701 1749 dbSNP
rs951951017 1752 dbSNP
rs1342756476 1762 dbSNP
rs1274090770 1764 dbSNP
rs920458629 1766 dbSNP
rs829260 1773 dbSNP
rs1373137548 1776 dbSNP
rs1015691668 1782 dbSNP
rs66487103 1782 dbSNP
rs981332595 1782 dbSNP
rs1379402060 1791 dbSNP
rs940500235 1800 dbSNP
rs1380900645 1803 dbSNP
rs1245483260 1807 dbSNP
rs1292661595 1808 dbSNP
rs1323569441 1810 dbSNP
rs955381007 1814 dbSNP
rs759316443 1816 dbSNP
rs1028314647 1819 dbSNP
rs1446162639 1822 dbSNP
rs1480885919 1825 dbSNP
rs1200340766 1827 dbSNP
rs907719228 1846 dbSNP
rs77207456 1850 dbSNP
rs1183806571 1855 dbSNP
rs1415411471 1857 dbSNP
rs951879534 1867 dbSNP
rs1426218615 1878 dbSNP
rs1028780275 1880 dbSNP
rs1033638468 1880 dbSNP
rs1402107850 1885 dbSNP
rs999038756 1894 dbSNP
rs903323219 1905 dbSNP
rs974365721 1907 dbSNP
rs771153498 1912 dbSNP
rs749539498 1924 dbSNP
rs999795274 1927 dbSNP
rs10940636 1938 dbSNP
rs1212896120 1939 dbSNP
rs1294893508 1939 dbSNP
rs1381800252 1945 dbSNP
rs1022875375 1948 dbSNP
rs1261085550 1957 dbSNP
rs1460699035 1960 dbSNP
rs1438659912 1961 dbSNP
rs1243271258 1964 dbSNP
rs930600783 1965 dbSNP
rs541514148 1972 dbSNP
rs777893321 1974 dbSNP
rs1185466180 1989 dbSNP
rs1419574608 1992 dbSNP
rs1478465319 1999 dbSNP
rs577458431 2003 dbSNP
rs1469617071 2004 dbSNP
rs760686759 2004 dbSNP
rs1205518166 2007 dbSNP
rs769776423 2008 dbSNP
rs374348695 2010 dbSNP
rs1288412825 2011 dbSNP
rs772806416 2012 dbSNP
rs1239731180 2013 dbSNP
rs1220466396 2022 dbSNP
rs145671390 2022 dbSNP
rs1383734349 2029 dbSNP
rs1223914050 2030 dbSNP
rs911695292 2033 dbSNP
rs780381459 2036 dbSNP
rs986911365 2036 dbSNP
rs181959249 2042 dbSNP
rs576631473 2050 dbSNP
rs73758090 2066 dbSNP
rs1340463603 2071 dbSNP
rs796612405 2072 dbSNP
rs1480369407 2083 dbSNP
rs1173562657 2084 dbSNP
rs1045602226 2086 dbSNP
rs1427670568 2087 dbSNP
rs577109679 2100 dbSNP
rs1158649788 2104 dbSNP
rs907819307 2106 dbSNP
rs1158368961 2107 dbSNP
rs567705113 2109 dbSNP
rs999491079 2115 dbSNP
rs1418729760 2116 dbSNP
rs903376639 2127 dbSNP
rs1276449693 2150 dbSNP
rs552578840 2153 dbSNP
rs1385400012 2166 dbSNP
rs747331829 2167 dbSNP
rs1222921835 2169 dbSNP
rs1471515165 2171 dbSNP
rs1236882705 2176 dbSNP
rs1355335195 2186 dbSNP
rs1024883559 2187 dbSNP
rs1290347480 2189 dbSNP
rs1490343422 2191 dbSNP
rs1200182489 2203 dbSNP
rs1248886933 2203 dbSNP
rs1468927640 2211 dbSNP
rs1176922539 2221 dbSNP
rs1381172029 2226 dbSNP
rs1013994372 2239 dbSNP
rs1365016969 2242 dbSNP
rs191053576 2243 dbSNP
rs148755437 2244 dbSNP
rs1325446420 2250 dbSNP
rs930496525 2252 dbSNP
rs1352628018 2254 dbSNP
rs1441226486 2264 dbSNP
rs570255294 2268 dbSNP
rs921645686 2270 dbSNP
rs1378699956 2274 dbSNP
rs12658211 2279 dbSNP
rs10036063 2288 dbSNP
rs1356431778 2298 dbSNP
rs1211038228 2299 dbSNP
rs1292280073 2299 dbSNP
rs1292654462 2304 dbSNP
rs868777975 2313 dbSNP
rs1018601961 2314 dbSNP
rs1239134659 2320 dbSNP
rs940589803 2321 dbSNP
rs1355693390 2327 dbSNP
rs74710642 2329 dbSNP
rs548172452 2336 dbSNP
rs1165018463 2338 dbSNP
rs1394278968 2342 dbSNP
rs530027622 2343 dbSNP
rs1402179414 2362 dbSNP
rs1450093661 2362 dbSNP
rs931761764 2362 dbSNP
rs1297979659 2363 dbSNP
rs1340642920 2368 dbSNP
rs374170854 2368 dbSNP
rs796829320 2369 dbSNP
rs1011455343 2372 dbSNP
rs1267852532 2378 dbSNP
rs547850308 2379 dbSNP
rs1218536529 2380 dbSNP
rs1259177573 2381 dbSNP
rs895326779 2381 dbSNP
rs185766952 2383 dbSNP
rs1403135798 2391 dbSNP
rs975464302 2394 dbSNP
rs1443167714 2395 dbSNP
rs1189745675 2403 dbSNP
rs1371377632 2403 dbSNP
rs1003601713 2408 dbSNP
rs1171292295 2414 dbSNP
rs1425602176 2415 dbSNP
rs1468050657 2419 dbSNP
rs1175379138 2427 dbSNP
rs751373723 2435 dbSNP
rs1170710162 2440 dbSNP
rs1478767892 2441 dbSNP
rs957413513 2447 dbSNP
rs1033410742 2456 dbSNP
rs1279397452 2459 dbSNP
rs1320555995 2462 dbSNP
rs749651668 2462 dbSNP
rs1421303725 2463 dbSNP
rs181590190 2474 dbSNP
rs1202375674 2480 dbSNP
rs10035437 2484 dbSNP
rs1488005894 2493 dbSNP
rs1194403435 2494 dbSNP
rs1265274689 2508 dbSNP
rs1479390540 2509 dbSNP
rs576580458 2510 dbSNP
rs886315813 2514 dbSNP
rs829259 2515 dbSNP
rs930442260 2520 dbSNP
rs1451206545 2522 dbSNP
rs1419796393 2528 dbSNP
rs994527194 2531 dbSNP
rs549474560 2535 dbSNP
rs1316666731 2570 dbSNP
rs1278108859 2571 dbSNP
rs1403605982 2574 dbSNP
rs1301075221 2576 dbSNP
rs1332030580 2576 dbSNP
rs1224559925 2583 dbSNP
rs1370138144 2593 dbSNP
rs34530754 2595 dbSNP
rs878940076 2601 dbSNP
rs542930751 2604 dbSNP
rs1217473274 2606 dbSNP
rs140177583 2607 dbSNP
rs1433874834 2612 dbSNP
rs1267883550 2613 dbSNP
rs911680193 2614 dbSNP
rs1348876306 2618 dbSNP
rs1179330261 2622 dbSNP
rs1379330230 2623 dbSNP
rs1439881143 2624 dbSNP
rs1004841311 2631 dbSNP
rs890369076 2637 dbSNP
rs1423363194 2639 dbSNP
rs978160703 2641 dbSNP
rs1392006581 2643 dbSNP
rs188636179 2646 dbSNP
rs1305257582 2649 dbSNP
rs13172038 2653 dbSNP
rs1376486315 2653 dbSNP
rs931814248 2653 dbSNP
rs138669344 2654 dbSNP
rs200998520 2655 dbSNP
rs1265976872 2656 dbSNP
rs1489397184 2656 dbSNP
rs1427037814 2657 dbSNP
rs1189186679 2658 dbSNP
rs1477825686 2659 dbSNP
rs1233662300 2660 dbSNP
rs1200667113 2663 dbSNP
rs574934107 2665 dbSNP
rs1456481160 2668 dbSNP
rs1258023998 2678 dbSNP
rs534327241 2681 dbSNP
rs1264720035 2684 dbSNP
rs959781648 2686 dbSNP
rs756749847 2693 dbSNP
rs576500177 2699 dbSNP
rs1422739231 2711 dbSNP
rs1164805461 2716 dbSNP
rs184648028 2718 dbSNP
rs1459870049 2724 dbSNP
rs1314402818 2727 dbSNP
rs116784965 2729 dbSNP
rs1400005654 2732 dbSNP
rs970782541 2736 dbSNP
rs936073293 2745 dbSNP
rs753978593 2746 dbSNP
rs1313483146 2747 dbSNP
rs557226166 2747 dbSNP
rs1004586412 2755 dbSNP
rs1257255142 2760 dbSNP
rs1258467070 2764 dbSNP
rs542389616 2764 dbSNP
rs977822678 2765 dbSNP
rs888467035 2766 dbSNP
rs1482699754 2767 dbSNP
rs702531 2768 dbSNP
rs994743397 2773 dbSNP
rs993011754 2781 dbSNP
rs868820695 2785 dbSNP
rs1169157659 2787 dbSNP
rs1423447125 2790 dbSNP
rs1466484744 2793 dbSNP
rs1173213583 2815 dbSNP
rs900447197 2818 dbSNP
rs958887400 2823 dbSNP
rs1357676903 2831 dbSNP
rs1034466494 2834 dbSNP
rs1303552226 2839 dbSNP
rs1038876803 2841 dbSNP
rs944563149 2843 dbSNP
rs911606543 2849 dbSNP
rs1277496246 2851 dbSNP
rs1220269223 2852 dbSNP
rs1318446121 2852 dbSNP
rs994630053 2854 dbSNP
rs1311297193 2857 dbSNP
rs1210371897 2862 dbSNP
rs1042149609 2867 dbSNP
rs945009818 2880 dbSNP
rs1374061115 2891 dbSNP
rs963455442 2895 dbSNP
rs1192233564 2900 dbSNP
rs1014634434 2905 dbSNP
rs1004960923 2906 dbSNP
rs914931747 2907 dbSNP
rs1423482925 2908 dbSNP
rs989575841 2909 dbSNP
rs1177055336 2921 dbSNP
rs1360761971 2921 dbSNP
rs1361047060 2922 dbSNP
rs959603927 2922 dbSNP
rs1051698359 2924 dbSNP
rs1173776503 2925 dbSNP
rs1413687697 2926 dbSNP
rs926912359 2926 dbSNP
rs796987175 2928 dbSNP
rs702530 2934 dbSNP
rs1180710847 2944 dbSNP
rs1438015850 2954 dbSNP
rs1272916942 2966 dbSNP
rs970877304 2970 dbSNP
rs1237664932 2972 dbSNP
rs1219521789 2977 dbSNP
rs1182459690 2983 dbSNP
rs1280310326 2985 dbSNP
rs1016065901 2986 dbSNP
rs1237714820 2995 dbSNP
rs1314715824 2996 dbSNP
rs200919800 2999 dbSNP
rs181672311 3000 dbSNP
rs1488932159 3001 dbSNP
rs1219421821 3022 dbSNP
rs900366938 3023 dbSNP
rs952928798 3027 dbSNP
rs1192082780 3041 dbSNP
rs35914743 3042 dbSNP
rs1427561692 3044 dbSNP
rs1026972493 3048 dbSNP
rs1158171496 3058 dbSNP
rs1438025147 3058 dbSNP
rs1361224802 3070 dbSNP
rs770632741 3073 dbSNP
rs1321511835 3086 dbSNP
rs1053613485 3089 dbSNP
rs1276353998 3091 dbSNP
rs1374248484 3094 dbSNP
rs878919811 3102 dbSNP
rs1209923529 3118 dbSNP
rs1317868134 3121 dbSNP
rs1288554360 3124 dbSNP
rs900419307 3137 dbSNP
rs936141268 3138 dbSNP
rs1288367655 3139 dbSNP
rs559808475 3139 dbSNP
rs926033731 3139 dbSNP
rs1017537167 3140 dbSNP
rs760712576 3167 dbSNP
rs1350980371 3178 dbSNP
rs1381079485 3188 dbSNP
rs917225860 3190 dbSNP
rs1161483351 3193 dbSNP
rs1413022273 3199 dbSNP
rs993068775 3204 dbSNP
rs1325338910 3205 dbSNP
rs866300570 3206 dbSNP
rs958938930 3213 dbSNP
rs188938118 3214 dbSNP
rs1331620698 3216 dbSNP
rs1378585664 3220 dbSNP
rs1242012838 3223 dbSNP
rs1283053061 3225 dbSNP
rs1300986940 3238 dbSNP
rs763175961 3239 dbSNP
rs1229376350 3242 dbSNP
rs1447067463 3244 dbSNP
rs1042507511 3249 dbSNP
rs1316451188 3253 dbSNP
rs79505011 3276 dbSNP
rs1160181769 3284 dbSNP
rs1239040284 3294 dbSNP
rs1459229092 3299 dbSNP
rs1418111009 3305 dbSNP
rs1185567208 3311 dbSNP
rs1236955180 3311 dbSNP
rs1379844237 3318 dbSNP
rs1473119144 3338 dbSNP
rs1164928774 3343 dbSNP
rs1421314856 3348 dbSNP
rs72764043 3349 dbSNP
rs1171069375 3351 dbSNP
rs1402068938 3353 dbSNP
rs754780759 3354 dbSNP
rs954382060 3358 dbSNP
rs1254740095 3365 dbSNP
rs1029990994 3366 dbSNP
rs1339025569 3369 dbSNP
rs996131269 3378 dbSNP
rs900420758 3389 dbSNP
rs748259147 3401 dbSNP
rs1181826454 3414 dbSNP
rs1466070150 3418 dbSNP
rs1265815935 3419 dbSNP
rs1443083864 3421 dbSNP
rs1190090934 3426 dbSNP
rs1214821874 3427 dbSNP
rs1487143460 3428 dbSNP
rs776895496 3429 dbSNP
rs1032223584 3434 dbSNP
rs1194174366 3434 dbSNP
rs937680460 3442 dbSNP
rs1001114384 3444 dbSNP
rs902315596 3450 dbSNP
rs1415704081 3453 dbSNP
rs1322965211 3457 dbSNP
rs926841929 3460 dbSNP
rs982342092 3479 dbSNP
rs949531257 3492 dbSNP
rs908688632 3494 dbSNP
rs1274503320 3500 dbSNP
rs1057057646 3515 dbSNP
rs937302649 3518 dbSNP
rs1227691786 3520 dbSNP
rs1340985003 3549 dbSNP
rs1283940888 3555 dbSNP
rs1487953685 3560 dbSNP
rs886060706 3562 dbSNP
rs1431241710 3571 dbSNP
rs983381664 3575 dbSNP
rs1377872553 3583 dbSNP
rs1397903714 3584 dbSNP
rs952817542 3585 dbSNP
rs547764520 3588 dbSNP
rs1359337865 3589 dbSNP
rs1419693419 3602 dbSNP
rs1299348979 3610 dbSNP
rs567635956 3624 dbSNP
rs1294312900 3632 dbSNP
rs1196366606 3638 dbSNP
rs1385478933 3639 dbSNP
rs1323265657 3642 dbSNP
rs1331943691 3650 dbSNP
rs1236751472 3664 dbSNP
rs1307254393 3672 dbSNP
rs964048779 3685 dbSNP
rs1017506351 3686 dbSNP
rs1262443762 3712 dbSNP
rs983636220 3726 dbSNP
rs954438996 3729 dbSNP
rs967669098 3735 dbSNP
rs62356652 3739 dbSNP
rs1407044204 3740 dbSNP
rs79317360 3741 dbSNP
rs1176391382 3744 dbSNP
rs1030043367 3745 dbSNP
rs1478438230 3754 dbSNP
rs1426408884 3755 dbSNP
rs112565146 3756 dbSNP
rs1293365890 3756 dbSNP
rs34128632 3756 dbSNP
rs375799039 3756 dbSNP
rs386403885 3756 dbSNP
rs776856051 3756 dbSNP
rs1192024036 3758 dbSNP
rs1391897130 3760 dbSNP
rs185725047 3761 dbSNP
rs1260654484 3767 dbSNP
rs964340361 3768 dbSNP
rs1489228647 3773 dbSNP
rs1263181910 3782 dbSNP
rs1032687366 3792 dbSNP
rs1309196236 3795 dbSNP
rs879611998 3797 dbSNP
rs1243963525 3800 dbSNP
rs1008840060 3801 dbSNP
rs747004433 3803 dbSNP
rs565346712 3806 dbSNP
rs867208837 3808 dbSNP
rs1237216088 3812 dbSNP
rs1216619189 3816 dbSNP
rs1339633718 3820 dbSNP
rs1178476738 3821 dbSNP
rs1301665110 3823 dbSNP
rs1388758594 3824 dbSNP
rs1422649277 3824 dbSNP
rs779845604 3828 dbSNP
rs1419134819 3834 dbSNP
rs1463362561 3834 dbSNP
rs886060705 3844 dbSNP
rs1388765689 3857 dbSNP
rs1010315825 3859 dbSNP
rs193013699 3860 dbSNP
rs866405146 3863 dbSNP
rs886060704 3875 dbSNP
rs1403147792 3876 dbSNP
rs1395460025 3883 dbSNP
rs150730390 3887 dbSNP
rs561322080 3891 dbSNP
rs1046069326 3892 dbSNP
rs1201385826 3894 dbSNP
rs549492853 3898 dbSNP
rs1253812291 3901 dbSNP
rs908819493 3901 dbSNP
rs1172341032 3905 dbSNP
rs1258862734 3920 dbSNP
rs1476454425 3934 dbSNP
rs982966193 3951 dbSNP
rs368658786 3952 dbSNP
rs1192014295 3981 dbSNP
rs931477777 3992 dbSNP
rs1423338635 3999 dbSNP
rs919990258 4000 dbSNP
rs829258 4001 dbSNP
rs964019125 4002 dbSNP
rs1259388193 4007 dbSNP
rs1398048749 4008 dbSNP
rs983636625 4009 dbSNP
rs372591128 4010 dbSNP
rs933437595 4014 dbSNP
rs923026305 4023 dbSNP
rs1019608780 4032 dbSNP
rs1298766848 4032 dbSNP
rs201801677 4033 dbSNP
rs10071088 4039 dbSNP
rs1486973821 4050 dbSNP
rs1256374965 4051 dbSNP
rs1263016724 4055 dbSNP
rs745496452 4056 dbSNP
rs1021330738 4059 dbSNP
rs924955288 4060 dbSNP
rs1188605762 4064 dbSNP
rs1329628925 4102 dbSNP
rs979790412 4116 dbSNP
rs1432791680 4120 dbSNP
rs966649202 4146 dbSNP
rs1417863432 4147 dbSNP
rs1297517143 4162 dbSNP
rs1345662341 4167 dbSNP
rs1009366413 4172 dbSNP
rs958122784 4174 dbSNP
rs1291540424 4178 dbSNP
rs1379249367 4201 dbSNP
rs1234553711 4221 dbSNP
rs1329341073 4225 dbSNP
rs1350868181 4227 dbSNP
rs1032028067 4246 dbSNP
rs1013380292 4247 dbSNP
rs778454702 4268 dbSNP
rs904977262 4274 dbSNP
rs1035753631 4275 dbSNP
rs1245325219 4276 dbSNP
rs1195249560 4286 dbSNP
rs1046037384 4289 dbSNP
rs1174744793 4293 dbSNP
rs1194504659 4299 dbSNP
rs1477833279 4299 dbSNP
rs766825126 4299 dbSNP
rs905886760 4305 dbSNP
rs1013243014 4323 dbSNP
rs1408678391 4335 dbSNP
rs1402351015 4360 dbSNP
rs887326046 4363 dbSNP
rs1349086236 4373 dbSNP
rs1441277650 4376 dbSNP
rs1327517849 4380 dbSNP
rs868386545 4381 dbSNP
rs74874819 4398 dbSNP
rs1279603982 4402 dbSNP
rs1239484912 4403 dbSNP
rs1225964653 4407 dbSNP
rs931471108 4414 dbSNP
rs1437239789 4415 dbSNP
rs1214648553 4432 dbSNP
rs920108653 4440 dbSNP
rs1202018302 4443 dbSNP
rs188061894 4444 dbSNP
rs1233509804 4450 dbSNP
rs1471157241 4452 dbSNP
rs1180049593 4455 dbSNP
rs1279292712 4460 dbSNP
rs1412908220 4483 dbSNP
rs576414565 4492 dbSNP
rs1461788311 4495 dbSNP
rs886697920 4500 dbSNP
rs942749089 4502 dbSNP
rs912686307 4504 dbSNP
rs933489652 4512 dbSNP
rs886060703 4513 dbSNP
rs1337017023 4514 dbSNP
rs1445093247 4518 dbSNP
rs1282963630 4520 dbSNP
rs967787136 4525 dbSNP
rs1355333895 4530 dbSNP
rs913789408 4532 dbSNP
rs1234325187 4533 dbSNP
rs1441558860 4534 dbSNP
rs551804227 4540 dbSNP
rs558551192 4546 dbSNP
rs1336690179 4548 dbSNP
rs1195437499 4550 dbSNP
rs988481445 4551 dbSNP
rs1439647046 4555 dbSNP
rs1208051211 4567 dbSNP
rs1394690465 4577 dbSNP
rs1038826287 4578 dbSNP
rs1401974960 4588 dbSNP
rs958004031 4589 dbSNP
rs1032120785 4593 dbSNP
rs1002025314 4601 dbSNP
rs1421193747 4601 dbSNP
rs1168145531 4602 dbSNP
rs1381779043 4604 dbSNP
rs969105935 4604 dbSNP
rs1332892432 4605 dbSNP
rs1375422889 4620 dbSNP
rs1415920362 4622 dbSNP
rs532407753 4622 dbSNP
rs966744039 4630 dbSNP
rs913832052 4639 dbSNP
rs1271015709 4641 dbSNP
rs1013219783 4646 dbSNP
rs1198843865 4653 dbSNP
rs75820400 4659 dbSNP
rs79996648 4660 dbSNP
rs386688374 4661 dbSNP
rs1033458930 4663 dbSNP
rs996145613 4670 dbSNP
rs1446233169 4674 dbSNP
rs536451907 4675 dbSNP
rs1374472504 4679 dbSNP
rs1476822391 4690 dbSNP
rs1216986188 4693 dbSNP
rs1395154577 4694 dbSNP
rs1435967735 4696 dbSNP
rs1489431926 4697 dbSNP
rs186917544 4703 dbSNP
rs1359131960 4710 dbSNP
rs1382042805 4714 dbSNP
rs1223335929 4715 dbSNP
rs1319356686 4715 dbSNP
rs763662271 4718 dbSNP
rs1357103869 4722 dbSNP
rs565953920 4723 dbSNP
rs565202035 4736 dbSNP
rs755464774 4740 dbSNP
rs1302858939 4748 dbSNP
rs1348696524 4750 dbSNP
rs1236518891 4759 dbSNP
rs1006231361 4760 dbSNP
rs1349826450 4765 dbSNP
rs1205549326 4774 dbSNP
rs1243275504 4783 dbSNP
rs1449579986 4784 dbSNP
rs886413686 4785 dbSNP
rs1192622947 4788 dbSNP
rs1253179035 4791 dbSNP
rs1455209773 4801 dbSNP
rs1048026347 4808 dbSNP
rs912612548 4822 dbSNP
rs997750508 4827 dbSNP
rs902041956 4831 dbSNP
rs1051193116 4833 dbSNP
rs563832641 4834 dbSNP
rs1039217307 4841 dbSNP
rs1385389896 4843 dbSNP
rs1325497777 4847 dbSNP
rs1402232187 4851 dbSNP
rs946044161 4852 dbSNP
rs547731783 4882 dbSNP
rs752019213 4885 dbSNP
rs17291089 4886 dbSNP
rs1399717726 4890 dbSNP
rs945077729 4898 dbSNP
rs1413917058 4904 dbSNP
rs913549779 4908 dbSNP
rs763254791 4912 dbSNP
rs13160982 4915 dbSNP
rs958184729 4916 dbSNP
rs1471770952 4922 dbSNP
rs1249196975 4923 dbSNP
rs925240215 4932 dbSNP
rs1417074060 4940 dbSNP
rs1419074074 4942 dbSNP
rs939263048 4944 dbSNP
rs374870111 4949 dbSNP
rs141138109 4961 dbSNP
rs11956001 4965 dbSNP
rs531703989 4968 dbSNP
rs1395551492 4969 dbSNP
rs1463195216 4975 dbSNP
rs1215368774 4976 dbSNP
rs1329465999 4977 dbSNP
rs1024653706 4981 dbSNP
rs1372704221 4995 dbSNP
rs992338282 4996 dbSNP
rs951188734 4997 dbSNP
rs886060702 5000 dbSNP
rs950772700 5018 dbSNP
rs1293657750 5023 dbSNP
rs995217415 5024 dbSNP
rs1196363774 5026 dbSNP
rs1250348302 5028 dbSNP
rs1208135386 5029 dbSNP
rs1026306283 5030 dbSNP
rs1480682891 5030 dbSNP
rs1196985529 5032 dbSNP
rs997802957 5034 dbSNP
rs898747896 5035 dbSNP
rs1279364837 5043 dbSNP
rs1422482136 5045 dbSNP
rs902097564 5049 dbSNP
rs1017835465 5054 dbSNP
rs1018541344 5056 dbSNP
rs1007739244 5084 dbSNP
rs1291747295 5095 dbSNP
rs773431894 5096 dbSNP
rs1400703694 5097 dbSNP
rs1429606866 5100 dbSNP
rs1043503584 5103 dbSNP
rs945104328 5108 dbSNP
rs567760069 5112 dbSNP
rs1459401006 5113 dbSNP
rs11959349 5118 dbSNP
rs1171258025 5119 dbSNP
rs1051294796 5124 dbSNP
rs829257 5125 dbSNP
rs1421233487 5128 dbSNP
rs891912625 5134 dbSNP
rs762163479 5139 dbSNP
rs936017029 5143 dbSNP
rs1261914475 5145 dbSNP
rs768238681 5149 dbSNP
rs1478518822 5150 dbSNP
rs1248662320 5152 dbSNP
rs1414201126 5158 dbSNP
rs1423050794 5160 dbSNP
rs1196915700 5162 dbSNP
rs1162528495 5163 dbSNP
rs560347418 5164 dbSNP
rs545273461 5165 dbSNP
rs1468065908 5166 dbSNP
rs1258748855 5167 dbSNP
rs1201100731 5170 dbSNP
rs1297641461 5172 dbSNP
rs981070251 5176 dbSNP
rs1316535565 5179 dbSNP
rs886060701 5190 dbSNP
rs941225410 5193 dbSNP
rs980670310 5196 dbSNP
rs1394662776 5198 dbSNP
rs1309694047 5199 dbSNP
rs1355036693 5202 dbSNP
rs1367937586 5204 dbSNP
rs533492070 5208 dbSNP
rs1240126624 5210 dbSNP
rs776840314 5219 dbSNP
rs917733177 5221 dbSNP
rs992036797 5238 dbSNP
rs11950495 5241 dbSNP
rs1211739287 5246 dbSNP
rs1237709143 5253 dbSNP
rs984922603 5256 dbSNP
rs11950492 5260 dbSNP
rs1026361788 5262 dbSNP
rs1440209859 5263 dbSNP
rs1158011714 5271 dbSNP
rs576005356 5279 dbSNP
rs1378507727 5281 dbSNP
rs1369645862 5282 dbSNP
rs866638632 5283 dbSNP
rs148646616 5286 dbSNP
rs1176980399 5287 dbSNP
rs1358800224 5289 dbSNP
rs143961299 5295 dbSNP
rs142429682 5304 dbSNP
rs1008207774 5317 dbSNP
rs1446649143 5320 dbSNP
rs904049218 5326 dbSNP
rs1022877215 5336 dbSNP
rs1412008489 5340 dbSNP
rs746879543 5342 dbSNP
rs1220457333 5344 dbSNP
rs1414806989 5344 dbSNP
rs1278793523 5358 dbSNP
rs1427578632 5376 dbSNP
rs1009356542 5388 dbSNP
rs1007129333 5389 dbSNP
rs1172042937 5394 dbSNP
rs1453954859 5405 dbSNP
rs1259711778 5406 dbSNP
rs891412289 5410 dbSNP
rs554040375 5411 dbSNP
rs538935097 5413 dbSNP
rs1236296088 5418 dbSNP
rs1238882903 5427 dbSNP
rs1180512217 5430 dbSNP
rs1424614219 5430 dbSNP
rs571557753 5436 dbSNP
rs1456873854 5438 dbSNP
rs1030235257 5440 dbSNP
rs1010441031 5445 dbSNP
rs1416923159 5465 dbSNP
rs1232795536 5471 dbSNP
rs1465446291 5491 dbSNP
rs1329826176 5493 dbSNP
rs1056108269 5494 dbSNP
rs1211322066 5504 dbSNP
rs1274900088 5508 dbSNP
rs1366336048 5513 dbSNP
rs1221259344 5514 dbSNP
rs1279719111 5520 dbSNP
rs904844721 5521 dbSNP
rs939034314 5521 dbSNP
rs1045015219 5522 dbSNP
rs941264425 5531 dbSNP
rs775323557 5537 dbSNP
rs771852765 5544 dbSNP
rs886060700 5545 dbSNP
rs1222269321 5555 dbSNP
rs578165124 5559 dbSNP
rs1477095221 5562 dbSNP
rs1346628655 5578 dbSNP
rs1309441467 5582 dbSNP
rs770211434 5585 dbSNP
rs935973314 5588 dbSNP
rs1448339974 5598 dbSNP
rs909752427 5602 dbSNP
rs1047336805 5615 dbSNP
rs1168963202 5620 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || |  ||||||||| 
Target 5' uuuuucCCCU--UGUGCUGCUu 3'
1 - 20
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                || |  ||||||||| 
Target 5' uuuuucCCCU--UGUGCUGCUu 3'
1 - 20
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000340635.6 | 3UTR | UUUUUCCCCUUGUGCUGCUUUAUAAUUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000340635.6 | 3UTR | UUUUUCCCCUUGUGCUGCUUUAUAAUUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.582 3.5e-3 0.600 2.6e-3 20 Click to see details
GSE38226 Liver fibrosis -0.54 5.8e-3 -0.573 3.3e-3 21 Click to see details
GSE19783 ER+ ER+ breast cancer -0.504 1.2e-2 -0.227 1.7e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.216 2.0e-2 -0.183 4.2e-2 90 Click to see details
GSE21032 Prostate cancer 0.224 2.1e-2 0.123 1.3e-1 83 Click to see details
GSE17498 Multiple myeloma -0.289 3.5e-2 -0.261 5.2e-2 40 Click to see details
GSE27834 Pluripotent stem cells 0.411 5.7e-2 0.365 8.2e-2 16 Click to see details
GSE28544 Breast cancer 0.323 6.2e-2 0.180 2.0e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.397 1.0e-1 0.538 3.6e-2 12 Click to see details
GSE19783 ER- ER- breast cancer 0.135 1.2e-1 -0.129 1.3e-1 79 Click to see details
GSE42095 Differentiated embryonic stem cells 0.17 2.2e-1 0.244 1.3e-1 23 Click to see details
GSE21687 Ependynoma primary tumors 0.09 2.4e-1 0.178 8.0e-2 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.138 2.6e-1 -0.082 3.5e-1 25 Click to see details
GSE21849 B cell lymphoma 0.099 3.0e-1 0.211 1.4e-1 29 Click to see details
GSE19536 Breast cancer 0.047 3.2e-1 -0.101 1.6e-1 100 Click to see details
GSE17306 Multiple myeloma -0.054 3.6e-1 -0.076 3.0e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.047 4.1e-1 -0.106 3.1e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.047 4.1e-1 0.026 4.5e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.018 4.6e-1 0.012 4.7e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.026 4.7e-1 -0.137 3.3e-1 13 Click to see details
GSE28260 Renal cortex and medulla -0.026 4.7e-1 -0.137 3.3e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.7 0 -0.690 0 32 Click to see details
PRAD -0.471 0 -0.462 0 50 Click to see details
BLCA -0.629 0 -0.517 0.01 18 Click to see details
LUSC 0.394 0.01 0.441 0 38 Click to see details
BRCA 0.15 0.09 0.148 0.09 84 Click to see details
KIRC 0.159 0.1 0.209 0.04 68 Click to see details
COAD -0.44 0.14 -0.619 0.05 8 Click to see details
KICH 0.183 0.19 0.287 0.08 25 Click to see details
THCA -0.114 0.19 -0.098 0.23 59 Click to see details
LUAD -0.267 0.2 -0.434 0.08 12 Click to see details
CHOL -0.291 0.22 -0.317 0.2 9 Click to see details
LIHC 0.095 0.26 0.134 0.18 49 Click to see details
PAAD 0.448 0.28 0.400 0.3 4 Click to see details
HNSC -0.094 0.28 -0.131 0.2 42 Click to see details
ESCA 0.197 0.28 0.336 0.16 11 Click to see details
PCPG 0.539 0.32 0.500 0.33 3 Click to see details
UCEC 0.051 0.42 0.065 0.4 19 Click to see details
KIRP 0.014 0.47 -0.025 0.45 32 Click to see details
CESC 0.004 0.5 0.500 0.33 3 Click to see details
CESC 0.004 0.5 0.500 0.33 3 Click to see details
CESC 0.004 0.5 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis: