miRTarBase - #MIRT473872
-
| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-122 |
| Genomic Coordinates | chr18: 58451074 - 58451158 |
| Synonyms | MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122 |
| Description | Homo sapiens miR-122 stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | ||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-122-5p | |||||||||||||||||||||
| Sequence | 15| UGGAGUGUGACAAUGGUGUUUG |36 | |||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||
| Experiments | Cloned | |||||||||||||||||||||
| Editing Events in miRNAs |
|
|||||||||||||||||||||
| SNPs in miRNA | ||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | Circulating MicroRNA Expression Profiling |
|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | MAFK | ||||||||||||||||||||
| Synonyms | NFE2U, P18 | ||||||||||||||||||||
| Description | MAF bZIP transcription factor K | ||||||||||||||||||||
| Transcript | NM_002360 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on MAFK | |||||||||||||||||||||
| 3'UTR of MAFK (miRNA target sites are highlighted) |
>MAFK|NM_002360|3'UTR 1 TGCCGGCCGGGGGCGGGGGGTGGCGGGCGGCGGGCGGCGGGCAGGCGGGTGGGGGCACACCCCTCGTACCTGTCACTGGG 81 ATGCAGACTCTCGACATCCGAGTCCAAGCGCAGGCCCCTCGGGCGCAGGCAGCTCACACCAGGAAGAGACTGTATTGCAG 161 GGTGAAGAGTGGGCTCCCGTGGGCCCAGAGCTGCACGCCGGTCCACAGACACACTCACGCCCGCCACCTGCTCCCCGCAG 241 GATGTGTCTGTGTGTGGGAATTGGTATCTTGCACCCGTGGGAGTCGGGACATATAATGGAAAGGCCCTCGGGAAGTTCCG 321 CGTCCTCTGTGGGGGCTGCCGGAAGACACGGCCCCAGGAGTCAGGCCCCTGTGGTCAGGTCTAGCATGGGGCTTGTTTTC 401 CACTCCTGCTGTAAGCAGCCTTCGACACCTGTCCTGCCACGGCCTCCCAGCCGGTGCGGGAGCCCCTCACTGCCCTGACC 481 GACTCCGCAGTCCCCGGGGAGGAGCATGGATGGTGTGTCGGCAGCTCCGTCCTTCCAGCTGTCCCGTTGCAGTGCCCGTG 561 ATCCGCGTCTGCCTTAGCAGGGGCCTGCGTGAGTGGGCACGGTGTGGGAGGTCGCCTGCGTGGGGTGGTGTCTGTGTGTG 641 TGCACGCACGCCTGCCATCAAAGCAGCAGGGCTGAGGGGGTGCAGCTTGCTGGTGTTCACTGGGGGAGGGCCTGTGGGCA 721 CACATGGCAGAGAGAGTGGCTCACACGTCGTGAGGTCTCCCCTGTGCTCTGGTGACCCGAGGAGGTCGTGCAGCACAGCG 801 CAGAAGCCCCTGCCCACGGGATCCGGCCCCCCAGACACCGACCCCACAGGCCGTCCCGGATCTCAGCGGACACAGGCAGG 881 AGCGCCCCATCATTTGACGGTGAGCAGGACTCAGGCTGTGTGTCCTGGAGCTACTTCTCACCAACTGTGGTCAGTGCAGG 961 GGGAACGAGGAGGTCTTTTGGGGGCCTGGCGAGGGGAAGGGCTGCTGCAGTCTAGGGAGAGGGGGTGCAGCCTGGGGGAT 1041 GTTGGTGGACATGGATGTGGAGGTGGAAGGAGGAGGACGTTGCGTGGAGTGGTGGGAGGAGGCGGGAGCCGTGTGCGAGA 1121 GCAGGTGGAAAGCCTTGAGGGGCAGGACCAGGATGCAGCTGGCTTGTAGAAGAGCTCAGGAGTGAGCCTGGCACTCCAGA 1201 GGGCGCGGCGGGTGGGGAGGCAGCAGGCACCAGTCCAGGAGAGCTTCGTGGACGTGGCTCCTGCGCGCACACCCCCAGGA 1281 GCACAGCCACGGGCTGCAGGTGTGGCTGGCCTCAGCACTCAGTCCTCACCCGGAGCCTTTGCCTGCTCCTCCTTCCAAGA 1361 GCACTGAGGCACCAGTGGGCTTGGCACTCCACCTTGGGCTTCCTTTTCCTGGAGAGCCGCCTTGAGGGTCCCTCCTGTGA 1441 CTGGGGTCTCTGCAGCGAGAGCCGCGGGGGTTGCGGAGCCCCTGCCTGGGGGAGCTGGCGGAATGTGAGCCGCCGGCCGG 1521 GGGCCGCCACATAAGACCTGCAAGGTGGTGCCTGGGGCCCTGGCTCCTTCTCGGCTGCCCCTGCCCACCCAGTAACAGCC 1601 CCCACCAGCTACAGAGCCCAGGCGGGTGCCAGCCACGCTGGGAGGGCAGAGGACAGACAGCCCCGGGGCTGCGACTTGGT 1681 TCTGTGTCTACTGTTAGAAGTTGAGTGGGAAGCTGCAGGCCCGCCAGGACCACTGGGTCCCTACAGAGCAAAGGCCTGCG 1761 TGTTCCCAAACAGCCGTTGCCCCCGTGGCCGTGGTAGGTAATCCATATTGGATGTCATAAGGACCAGGGGGATATTTAAA 1841 GAGAGAAACAGAAAATATATAGAGATATAAAATTATATTCACAGTTTATCTACAGATTTTTCGTAACAATCTTTCTTTTC 1921 CAGTTTGATACTGTAAATCTATCAGAGCAGAGCCGGGGGCACGGGCACAGGTGGGAGTTGGGAGCAAAGCGGAGGCCCGG 2001 GCTGCCCGCCGTCCCCCTTCATCTCCCCACGGACTGTACCAGGCAGCTGGGCCCCGCAGGACAGGCCGCAGCGGGTGGCC 2081 GGTTCTGTCCCGTCTTGGGGTTCTTGGTGTCCACGTCTTGTGGGCCGTGGGCTTCTACCTGCCCTTGGCCTGCAGTGCTT 2161 TGCTGGAGAAGGGACTCCCTGGTCCCCAGGGTGGACGGAGCCGCTGTCACCGCCCAGAGCTGGGCCGGGGAAGCACGGTG 2241 TGTTCTGCTTTTCTTTTCAGATTGTTGAAATTTCATTGTCATGATTTAATATATGGATTTTTTTATTTAAGAAAAAGACG 2321 AGGGACTCTTTGTCACGTGGGTTTGTTTTCTGTCTCCGTGCCTCCGGCTTCCCAAAGAGATCCAGGTCTTTGCGTTTCCA 2401 GGGCGTGGGGACCCCGGCCCCCTATGCCGCCACGCCGCCACACCGCCTCACCCTGGCTTCTGTGCTACTTGGCAGTTCCA 2481 TTTCATTATTTATTTTTTGTGCTGCTTTTTATCATGATATAAATTATTGAAAACAGATCACATGTGGGCCCGTGTCTGGC 2561 CGCCGCCGCCCTGCCCCGTCCCTGCGGCCACCACCTAATTTATTGCCGTGCGTCCTGCTGCTGTGACTGCTTTTGTACCT 2641 TTGCAATAAAGAATTTTCTGGTTTCAGA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
DRVs in gene 3'UTRs | |||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM545217 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000343242.4 | 3UTR | CACUCCACCUUGGGCUUCCUUUUCCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset SRR1045082 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000343242.4 | 3UTR | CACUCCACCUUGGGCUUCCUUUUCCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1462574 | |
| Method / RBP | PAR-CLIP / AGO2 |
|---|---|
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000343242.4 | 3UTR | CACUCCACCUUGGGCUUCCUUUUCCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR)
Other evidence
Transcription factor regulation Circular RNA sponge
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000012 | CYP7A1 | cytochrome P450 family 7 subfamily A member 1 |  |
|
|
3 | 1 | |||||
| MIRT000364 | IGF1R | insulin like growth factor 1 receptor | |
|
|
|
4 | 3 | ||||
| MIRT000365 | SRF | serum response factor | |
|
|
|
4 | 1 | ||||
| MIRT000663 | RAC1 | Rac family small GTPase 1 | |
|
|
|
|
5 | 2 | |||
| MIRT000717 | RHOA | ras homolog family member A | |
|
2 | 2 | ||||||
| MIRT003006 | CCNG1 | cyclin G1 | |
|
|
|
4 | 4 | ||||
| MIRT003079 | GTF2B | general transcription factor IIB | |
|
2 | 1 | ||||||
| MIRT003080 | GYS1 | glycogen synthase 1 | |
|
|
|
4 | 2 | ||||
| MIRT003081 | ANK2 | ankyrin 2 | |
|
|
3 | 1 | |||||
| MIRT003082 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | |
|
|
3 | 1 | |||||
| MIRT003083 | ENTPD4 | ectonucleoside triphosphate diphosphohydrolase 4 | |
|
|
|
4 | 2 | ||||
| MIRT003084 | ANXA11 | annexin A11 | |
|
|
|
4 | 2 | ||||
| MIRT003085 | ALDOA | aldolase, fructose-bisphosphate A | |
|
|
3 | 2 | |||||
| MIRT003086 | RAB6B | RAB6B, member RAS oncogene family | |
|
|
3 | 1 | |||||
| MIRT003087 | RAB11FIP1 | RAB11 family interacting protein 1 | |
|
|
|
|
5 | 3 | |||
| MIRT003088 | FOXP1 | forkhead box P1 | |
|
|
3 | 1 | |||||
| MIRT003089 | MECP2 | methyl-CpG binding protein 2 | |
|
|
3 | 2 | |||||
| MIRT003090 | NCAM1 | neural cell adhesion molecule 1 | |
|
|
|
4 | 3 | ||||
| MIRT003091 | UBAP2 | ubiquitin associated protein 2 | |
|
|
3 | 1 | |||||
| MIRT003092 | TBX19 | T-box 19 | |
|
|
3 | 1 | |||||
| MIRT003093 | AACS | acetoacetyl-CoA synthetase | |
|
|
3 | 1 | |||||
| MIRT003094 | DUSP2 | dual specificity phosphatase 2 | |
|
|
3 | 1 | |||||
| MIRT003095 | ATP1A2 | ATPase Na+/K+ transporting subunit alpha 2 | |
|
|
3 | 1 | |||||
| MIRT003097 | MAPK11 | mitogen-activated protein kinase 11 | |
|
|
3 | 1 | |||||
| MIRT003098 | FUNDC2 | FUN14 domain containing 2 | |
|
|
3 | 1 | |||||
| MIRT003099 | AKT3 | AKT serine/threonine kinase 3 | |
|
|
3 | 3 | |||||
| MIRT003100 | TPD52L2 | tumor protein D52 like 2 | |
|
|
|
4 | 3 | ||||
| MIRT003102 | GALNT10 | polypeptide N-acetylgalactosaminyltransferase 10 | |
|
|
|
4 | 2 | ||||
| MIRT003103 | G6PC3 | glucose-6-phosphatase catalytic subunit 3 | |
|
|
|
4 | 2 | ||||
| MIRT003104 | AP3M2 | adaptor related protein complex 3 mu 2 subunit | |
|
|
3 | 1 | |||||
| MIRT003105 | SLC7A1 | solute carrier family 7 member 1 | |
|
|
|
4 | 4 | ||||
| MIRT003106 | XPO6 | exportin 6 | |
|
|
3 | 1 | |||||
| MIRT003107 | FOXJ3 | forkhead box J3 | |
|
|
3 | 1 | |||||
| MIRT003108 | SLC7A11 | solute carrier family 7 member 11 | |
|
|
3 | 1 | |||||
| MIRT003109 | TRIB1 | tribbles pseudokinase 1 | |
|
|
3 | 1 | |||||
| MIRT003110 | EGLN3 | egl-9 family hypoxia inducible factor 3 | |
|
|
3 | 1 | |||||
| MIRT003111 | NUMBL | NUMB like, endocytic adaptor protein | |
|
|
3 | 1 | |||||
| MIRT003112 | ADAM17 | ADAM metallopeptidase domain 17 | |
|
|
3 | 5 | |||||
| MIRT003727 | DSTYK | dual serine/threonine and tyrosine protein kinase | |
|
|
3 | 2 | |||||
| MIRT003728 | FAM117B | family with sequence similarity 117 member B | |
|
|
3 | 1 | |||||
| MIRT004364 | BCL2L2 | BCL2 like 2 | |
|
|
|
4 | 2 | ||||
| MIRT004527 | PRKAB1 | protein kinase AMP-activated non-catalytic subunit beta 1 | |
|
2 | 1 | ||||||
| MIRT004879 | ADAM10 | ADAM metallopeptidase domain 10 | |
|
|
|
|
5 | 1 | |||
| MIRT005782 | ACVR1C | activin A receptor type 1C | |
1 | 1 | |||||||
| MIRT006123 | PRKRA | protein activator of interferon induced protein kinase EIF2AK2 | |
|
|
|
4 | 1 | ||||
| MIRT006421 | WNT1 | Wnt family member 1 | |
|
|
3 | 1 | |||||
| MIRT007007 | PTPN1 | protein tyrosine phosphatase, non-receptor type 1 | |
1 | 1 | |||||||
| MIRT007081 | NT5C3A | 5'-nucleotidase, cytosolic IIIA | |
1 | 1 | |||||||
| MIRT007082 | P4HA1 | prolyl 4-hydroxylase subunit alpha 1 | |
1 | 1 | |||||||
| MIRT007083 | ZNF395 | zinc finger protein 395 | |
1 | 1 | |||||||
| MIRT007084 | SOCS1 | suppressor of cytokine signaling 1 | |
1 | 1 | |||||||
| MIRT023217 | SSR3 | signal sequence receptor subunit 3 | |
1 | 1 | |||||||
| MIRT023218 | PHOX2A | paired like homeobox 2a | |
1 | 1 | |||||||
| MIRT023219 | DZIP1L | DAZ interacting zinc finger protein 1 like | |
1 | 1 | |||||||
| MIRT023220 | GSTM2 | glutathione S-transferase mu 2 | |
1 | 1 | |||||||
| MIRT023221 | RAI14 | retinoic acid induced 14 | |
1 | 1 | |||||||
| MIRT023222 | STARD13 | StAR related lipid transfer domain containing 13 | |
1 | 1 | |||||||
| MIRT023223 | CNN3 | calponin 3 | |
1 | 1 | |||||||
| MIRT023224 | A2M | alpha-2-macroglobulin | |
1 | 1 | |||||||
| MIRT023225 | EFCAB6 | EF-hand calcium binding domain 6 | |
1 | 1 | |||||||
| MIRT023226 | GLOD4 | glyoxalase domain containing 4 | |
1 | 1 | |||||||
| MIRT023227 | CALR | calreticulin | |
1 | 1 | |||||||
| MIRT023228 | POFUT1 | protein O-fucosyltransferase 1 | |
1 | 1 | |||||||
| MIRT023229 | PYGO1 | pygopus family PHD finger 1 | |
1 | 1 | |||||||
| MIRT023230 | CDY2B | chromodomain Y-linked 2B | |
1 | 1 | |||||||
| MIRT023231 | CDC42EP3 | CDC42 effector protein 3 | |
1 | 1 | |||||||
| MIRT023232 | CS | citrate synthase | |
|
|
3 | 3 | |||||
| MIRT023233 | RNF170 | ring finger protein 170 | |
|
|
3 | 3 | |||||
| MIRT023234 | GTF3C6 | general transcription factor IIIC subunit 6 | |
1 | 1 | |||||||
| MIRT023235 | ZNF321P | zinc finger protein 321, pseudogene | |
1 | 1 | |||||||
| MIRT023236 | LAMP1 | lysosomal associated membrane protein 1 | |
1 | 1 | |||||||
| MIRT023237 | SLC52A2 | solute carrier family 52 member 2 | |
1 | 1 | |||||||
| MIRT023238 | ZNF658 | zinc finger protein 658 | |
1 | 1 | |||||||
| MIRT023239 | ATP13A3 | ATPase 13A3 | |
1 | 1 | |||||||
| MIRT023240 | CPNE5 | copine 5 | |
1 | 1 | |||||||
| MIRT023241 | KATNAL1 | katanin catalytic subunit A1 like 1 | |
1 | 1 | |||||||
| MIRT023242 | TMEM136 | transmembrane protein 136 | |
1 | 1 | |||||||
| MIRT023243 | ATP11A | ATPase phospholipid transporting 11A | |
1 | 1 | |||||||
| MIRT023244 | TMEM74 | transmembrane protein 74 | |
1 | 1 | |||||||
| MIRT023245 | ANKRD10 | ankyrin repeat domain 10 | |
1 | 1 | |||||||
| MIRT023246 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | |
1 | 1 | |||||||
| MIRT023247 | USP10 | ubiquitin specific peptidase 10 | |
1 | 1 | |||||||
| MIRT023248 | AKAP11 | A-kinase anchoring protein 11 | |
1 | 1 | |||||||
| MIRT023249 | BACH2 | BTB domain and CNC homolog 2 | |
1 | 1 | |||||||
| MIRT023250 | HCCS | holocytochrome c synthase | |
1 | 1 | |||||||
| MIRT023251 | Slc7a1 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | |
1 | 1 | |||||||
| MIRT023252 | GTDC2 | protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) | |
1 | 1 | |||||||
| MIRT023253 | CTPS1 | CTP synthase 1 | |
1 | 1 | |||||||
| MIRT023254 | SLC44A1 | solute carrier family 44 member 1 | |
1 | 1 | |||||||
| MIRT023255 | CLSPN | claspin | |
1 | 1 | |||||||
| MIRT023256 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | |
1 | 1 | |||||||
| MIRT023257 | FBXO7 | F-box protein 7 | |
1 | 1 | |||||||
| MIRT023258 | NCDN | neurochondrin | |
1 | 1 | |||||||
| MIRT023259 | SOX2 | SRY-box 2 | |
1 | 1 | |||||||
| MIRT023260 | ZNF618 | zinc finger protein 618 | |
1 | 1 | |||||||
| MIRT023261 | ABLIM1 | actin binding LIM protein 1 | |
1 | 1 | |||||||
| MIRT023262 | ZBTB4 | zinc finger and BTB domain containing 4 | |
1 | 1 | |||||||
| MIRT023263 | LUZP1 | leucine zipper protein 1 | |
1 | 1 | |||||||
| MIRT023264 | NLGN3 | neuroligin 3 | |
1 | 1 | |||||||
| MIRT023265 | PRR11 | proline rich 11 | |
1 | 1 | |||||||
| MIRT023266 | HHAT | hedgehog acyltransferase | |
1 | 1 | |||||||
| MIRT023267 | UBE2L3 | ubiquitin conjugating enzyme E2 L3 | |
1 | 1 | |||||||
| MIRT023268 | DNAJC18 | DnaJ heat shock protein family (Hsp40) member C18 | |
1 | 1 | |||||||
| MIRT023269 | FAM102A | family with sequence similarity 102 member A | |
1 | 1 | |||||||
| MIRT023270 | PFKFB2 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 | |
1 | 1 | |||||||
| MIRT023271 | DENND2C | DENN domain containing 2C | |
1 | 1 | |||||||
| MIRT023272 | HMOX1 | heme oxygenase 1 | |
|
|
3 | 2 | |||||
| MIRT023273 | USP28 | ubiquitin specific peptidase 28 | |
1 | 1 | |||||||
| MIRT023274 | KRT18 | keratin 18 | |
1 | 1 | |||||||
| MIRT023275 | BPGM | bisphosphoglycerate mutase | |
1 | 1 | |||||||
| MIRT023276 | ZNF233 | zinc finger protein 233 | |
1 | 1 | |||||||
| MIRT023277 | SLC25A30 | solute carrier family 25 member 30 | |
1 | 1 | |||||||
| MIRT023278 | ANKRD9 | ankyrin repeat domain 9 | |
|
|
3 | 3 | |||||
| MIRT023279 | RLN1 | relaxin 1 | |
1 | 1 | |||||||
| MIRT023280 | DDIT3 | DNA damage inducible transcript 3 | |
1 | 1 | |||||||
| MIRT023281 | TRIM65 | tripartite motif containing 65 | |
1 | 1 | |||||||
| MIRT023282 | B4GALT1 | beta-1,4-galactosyltransferase 1 | |
1 | 1 | |||||||
| MIRT023283 | ANXA7 | annexin A7 | |
1 | 1 | |||||||
| MIRT023284 | SLC19A2 | solute carrier family 19 member 2 | |
1 | 1 | |||||||
| MIRT023285 | MARCKS | myristoylated alanine rich protein kinase C substrate | |
1 | 1 | |||||||
| MIRT023286 | CLEC11A | C-type lectin domain containing 11A | |
1 | 1 | |||||||
| MIRT023287 | CENPF | centromere protein F | |
1 | 1 | |||||||
| MIRT023288 | CLDN18 | claudin 18 | |
1 | 1 | |||||||
| MIRT023289 | PFDN1 | prefoldin subunit 1 | |
1 | 1 | |||||||
| MIRT023290 | SPAG9 | sperm associated antigen 9 | |
1 | 1 | |||||||
| MIRT023291 | CEACAM8 | carcinoembryonic antigen related cell adhesion molecule 8 | |
1 | 1 | |||||||
| MIRT023292 | KRT10 | keratin 10 | |
1 | 1 | |||||||
| MIRT023293 | SET | SET nuclear proto-oncogene | |
1 | 1 | |||||||
| MIRT023294 | SLC11A2 | solute carrier family 11 member 2 | |
1 | 1 | |||||||
| MIRT023295 | MYCBP | MYC binding protein | |
|
|
3 | 3 | |||||
| MIRT023296 | GPHB5 | glycoprotein hormone beta 5 | |
1 | 1 | |||||||
| MIRT023297 | STAU2 | staufen double-stranded RNA binding protein 2 | |
1 | 1 | |||||||
| MIRT023298 | NFATC1 | nuclear factor of activated T-cells 1 | |
1 | 1 | |||||||
| MIRT023299 | ERP29 | endoplasmic reticulum protein 29 | |
1 | 1 | |||||||
| MIRT023300 | MEP1A | meprin A subunit alpha | |
1 | 1 | |||||||
| MIRT023301 | SPTLC1 | serine palmitoyltransferase long chain base subunit 1 | |
1 | 1 | |||||||
| MIRT023302 | GTF2H2 | general transcription factor IIH subunit 2 | |
1 | 1 | |||||||
| MIRT023303 | C14orf39 | chromosome 14 open reading frame 39 | |
1 | 1 | |||||||
| MIRT023304 | UBE2K | ubiquitin conjugating enzyme E2 K | |
1 | 1 | |||||||
| MIRT023305 | PPP1R9B | protein phosphatase 1 regulatory subunit 9B | |
1 | 1 | |||||||
| MIRT023306 | PSMD10 | proteasome 26S subunit, non-ATPase 10 | |
1 | 1 | |||||||
| MIRT023307 | CALD1 | caldesmon 1 | |
1 | 1 | |||||||
| MIRT023308 | TTYH3 | tweety family member 3 | |
1 | 1 | |||||||
| MIRT023309 | NMNAT2 | nicotinamide nucleotide adenylyltransferase 2 | |
1 | 1 | |||||||
| MIRT023310 | SCN4B | sodium voltage-gated channel beta subunit 4 | |
1 | 1 | |||||||
| MIRT023311 | C1orf122 | chromosome 1 open reading frame 122 | |
1 | 1 | |||||||
| MIRT023312 | PAK1 | p21 (RAC1) activated kinase 1 | |
1 | 1 | |||||||
| MIRT023313 | DNAJB1 | DnaJ heat shock protein family (Hsp40) member B1 | |
1 | 1 | |||||||
| MIRT023314 | DMXL1 | Dmx like 1 | |
1 | 1 | |||||||
| MIRT023315 | ZNF160 | zinc finger protein 160 | |
1 | 1 | |||||||
| MIRT023316 | CSRP1 | cysteine and glycine rich protein 1 | |
1 | 1 | |||||||
| MIRT023317 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | |
1 | 1 | |||||||
| MIRT023318 | RBBP5 | RB binding protein 5, histone lysine methyltransferase complex subunit | |
1 | 1 | |||||||
| MIRT023319 | ANKRD13C | ankyrin repeat domain 13C | |
1 | 1 | |||||||
| MIRT023320 | SUCLA2 | succinate-CoA ligase ADP-forming beta subunit | |
1 | 1 | |||||||
| MIRT023321 | PEA15 | phosphoprotein enriched in astrocytes 15 | |
1 | 1 | |||||||
| MIRT023322 | MTPN | myotrophin | |
1 | 1 | |||||||
| MIRT023323 | YKT6 | YKT6 v-SNARE homolog | |
1 | 1 | |||||||
| MIRT023324 | MOB3B | MOB kinase activator 3B | |
1 | 1 | |||||||
| MIRT023325 | FAM118A | family with sequence similarity 118 member A | |
1 | 1 | |||||||
| MIRT023326 | ZNF264 | zinc finger protein 264 | |
1 | 1 | |||||||
| MIRT023327 | HECTD3 | HECT domain E3 ubiquitin protein ligase 3 | |
1 | 1 | |||||||
| MIRT023328 | BATF2 | basic leucine zipper ATF-like transcription factor 2 | |
1 | 1 | |||||||
| MIRT023329 | PIP4K2A | phosphatidylinositol-5-phosphate 4-kinase type 2 alpha | |
1 | 1 | |||||||
| MIRT023330 | MAPRE1 | microtubule associated protein RP/EB family member 1 | |
1 | 1 | |||||||
| MIRT023331 | TBC1D22B | TBC1 domain family member 22B | |
1 | 1 | |||||||
| MIRT023332 | SLC9A1 | solute carrier family 9 member A1 | |
|
|
3 | 3 | |||||
| MIRT023333 | NPEPPS | aminopeptidase puromycin sensitive | |
1 | 1 | |||||||
| MIRT023334 | BCL2L1 | BCL2 like 1 | |
|
2 | 1 | ||||||
| MIRT023335 | OSMR | oncostatin M receptor | |
1 | 1 | |||||||
| MIRT023336 | CALU | calumenin | |
1 | 1 | |||||||
| MIRT023337 | BRI3BP | BRI3 binding protein | |
1 | 1 | |||||||
| MIRT023338 | PSPH | phosphoserine phosphatase | |
1 | 1 | |||||||
| MIRT023339 | APMAP | adipocyte plasma membrane associated protein | |
1 | 1 | |||||||
| MIRT023340 | WASF1 | WAS protein family member 1 | |
1 | 1 | |||||||
| MIRT023341 | LCA5 | LCA5, lebercilin | |
1 | 1 | |||||||
| MIRT023342 | NODAL | nodal growth differentiation factor | |
1 | 1 | |||||||
| MIRT023343 | CASP7 | caspase 7 | |
1 | 1 | |||||||
| MIRT023344 | CPA3 | carboxypeptidase A3 | |
1 | 1 | |||||||
| MIRT023345 | PALM | paralemmin | |
1 | 1 | |||||||
| MIRT023346 | TCP11 | t-complex 11 | |
1 | 1 | |||||||
| MIRT023347 | NALCN | sodium leak channel, non-selective | |
1 | 1 | |||||||
| MIRT023348 | PLAGL2 | PLAG1 like zinc finger 2 | |
1 | 1 | |||||||
| MIRT023349 | IDS | iduronate 2-sulfatase | |
|
|
3 | 3 | |||||
| MIRT023350 | PARP11 | poly(ADP-ribose) polymerase family member 11 | |
1 | 1 | |||||||
| MIRT023351 | MAZ | MYC associated zinc finger protein | |
1 | 1 | |||||||
| MIRT023352 | CPNE4 | copine 4 | |
1 | 1 | |||||||
| MIRT023353 | FAM19A3 | family with sequence similarity 19 member A3, C-C motif chemokine like | |
1 | 1 | |||||||
| MIRT023354 | KRT14 | keratin 14 | |
1 | 1 | |||||||
| MIRT023355 | DYNC1H1 | dynein cytoplasmic 1 heavy chain 1 | |
1 | 1 | |||||||
| MIRT023356 | GNL3L | G protein nucleolar 3 like | |
1 | 1 | |||||||
| MIRT023357 | HLA-DQA1 | major histocompatibility complex, class II, DQ alpha 1 | |
1 | 1 | |||||||
| MIRT023358 | EYA4 | EYA transcriptional coactivator and phosphatase 4 | |
1 | 1 | |||||||
| MIRT023359 | GNPDA2 | glucosamine-6-phosphate deaminase 2 | |
1 | 1 | |||||||
| MIRT023360 | BRCA2 | BRCA2, DNA repair associated | |
1 | 1 | |||||||
| MIRT023361 | ZSCAN4 | zinc finger and SCAN domain containing 4 | |
1 | 1 | |||||||
| MIRT023362 | HSPA5 | heat shock protein family A (Hsp70) member 5 | |
1 | 1 | |||||||
| MIRT023363 | SERAC1 | serine active site containing 1 | |
1 | 1 | |||||||
| MIRT023364 | SLC15A2 | solute carrier family 15 member 2 | |
1 | 1 | |||||||
| MIRT023365 | RABIF | RAB interacting factor | |
1 | 1 | |||||||
| MIRT023366 | ART3 | ADP-ribosyltransferase 3 | |
1 | 1 | |||||||
| MIRT023367 | EP400 | E1A binding protein p400 | |
1 | 1 | |||||||
| MIRT023368 | MT4 | metallothionein 4 | |
1 | 1 | |||||||
| MIRT023369 | TRAM2 | translocation associated membrane protein 2 | |
1 | 1 | |||||||
| MIRT023370 | PHPT1 | phosphohistidine phosphatase 1 | |
1 | 1 | |||||||
| MIRT023371 | KIAA0101 | PCNA clamp associated factor | |
1 | 1 | |||||||
| MIRT023372 | VHL | von Hippel-Lindau tumor suppressor | |
1 | 1 | |||||||
| MIRT023373 | IFNA1 | interferon alpha 1 | |
1 | 1 | |||||||
| MIRT023374 | FSTL3 | follistatin like 3 | |
1 | 1 | |||||||
| MIRT023375 | PHF14 | PHD finger protein 14 | |
1 | 1 | |||||||
| MIRT023376 | ZCCHC2 | zinc finger CCHC-type containing 2 | |
1 | 1 | |||||||
| MIRT023377 | GSTM3 | glutathione S-transferase mu 3 | |
1 | 1 | |||||||
| MIRT023378 | DCTN5 | dynactin subunit 5 | |
1 | 1 | |||||||
| MIRT023379 | CHST3 | carbohydrate sulfotransferase 3 | |
1 | 1 | |||||||
| MIRT023380 | HECW2 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 | |
1 | 1 | |||||||
| MIRT023381 | ADO | 2-aminoethanethiol dioxygenase | |
1 | 1 | |||||||
| MIRT023382 | POMZP3 | POM121 and ZP3 fusion | |
1 | 1 | |||||||
| MIRT023383 | CHST12 | carbohydrate sulfotransferase 12 | |
1 | 1 | |||||||
| MIRT023384 | ARSB | arylsulfatase B | |
1 | 1 | |||||||
| MIRT023385 | ATP7A | ATPase copper transporting alpha | |
1 | 1 | |||||||
| MIRT023386 | PMP22 | peripheral myelin protein 22 | |
1 | 1 | |||||||
| MIRT023387 | TGFBRAP1 | transforming growth factor beta receptor associated protein 1 | |
1 | 1 | |||||||
| MIRT023388 | ORC2 | origin recognition complex subunit 2 | |
1 | 1 | |||||||
| MIRT023389 | CREB1 | cAMP responsive element binding protein 1 | |
1 | 1 | |||||||
| MIRT023390 | CD83 | CD83 molecule | |
1 | 1 | |||||||
| MIRT023391 | TOB2 | transducer of ERBB2, 2 | |
|
|
3 | 5 | |||||
| MIRT023392 | LRP11 | LDL receptor related protein 11 | |
1 | 1 | |||||||
| MIRT023393 | MPV17 | MPV17, mitochondrial inner membrane protein | |
1 | 1 | |||||||
| MIRT023394 | TRIM29 | tripartite motif containing 29 | |
1 | 1 | |||||||
| MIRT023395 | OSBP2 | oxysterol binding protein 2 | |
1 | 1 | |||||||
| MIRT023396 | PKM | pyruvate kinase, muscle | |
|
|
|
|
|
6 | 4 | ||
| MIRT023397 | FOXK2 | forkhead box K2 | |
|
|
3 | 3 | |||||
| MIRT023398 | CLIC4 | chloride intracellular channel 4 | |
|
|
|
|
5 | 6 | |||
| MIRT023399 | ST6GALNAC4 | ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 | |
1 | 1 | |||||||
| MIRT023400 | SMURF2 | SMAD specific E3 ubiquitin protein ligase 2 | |
1 | 1 | |||||||
| MIRT023401 | LMNB2 | lamin B2 | |
|
|
3 | 5 | |||||
| MIRT023402 | BAX | BCL2 associated X, apoptosis regulator | |
|
2 | 2 | ||||||
| MIRT023403 | CDK4 | cyclin dependent kinase 4 | |
|
|
3 | 3 | |||||
| MIRT054362 | Cux1 | cut-like homeobox 1 | |
1 | 1 | |||||||
| MIRT074336 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 2 | ||||||
| MIRT109185 | VMA21 | VMA21, vacuolar ATPase assembly factor | |
|
2 | 4 | ||||||
| MIRT324745 | ACER2 | alkaline ceramidase 2 | |
|
2 | 2 | ||||||
| MIRT325564 | HIATL1 | major facilitator superfamily domain containing 14B | |
|
2 | 4 | ||||||
| MIRT438005 | MEF2D | myocyte enhancer factor 2D | |
1 | 2 | |||||||
| MIRT438206 | TGFB1 | transforming growth factor beta 1 | |
1 | 1 | |||||||
| MIRT438639 | AXL | AXL receptor tyrosine kinase | |
1 | 1 | |||||||
| MIRT438655 | NOD2 | nucleotide binding oligomerization domain containing 2 | |
|
|
3 | 1 | |||||
| MIRT438734 | FUT8 | fucosyltransferase 8 | |
|
|
3 | 1 | |||||
| MIRT449879 | CYP3A5 | cytochrome P450 family 3 subfamily A member 5 | |
|
2 | 2 | ||||||
| MIRT451716 | OLR1 | oxidized low density lipoprotein receptor 1 | |
|
2 | 2 | ||||||
| MIRT453274 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
|
2 | 2 | ||||||
| MIRT454113 | MRPL52 | mitochondrial ribosomal protein L52 | |
|
2 | 2 | ||||||
| MIRT454232 | OSBPL10 | oxysterol binding protein like 10 | |
|
2 | 15 | ||||||
| MIRT454344 | CDKL1 | cyclin dependent kinase like 1 | |
|
2 | 2 | ||||||
| MIRT455826 | ZSWIM1 | zinc finger SWIM-type containing 1 | |
|
2 | 3 | ||||||
| MIRT459903 | PIGO | phosphatidylinositol glycan anchor biosynthesis class O | |
|
2 | 12 | ||||||
| MIRT461654 | G6PC | glucose-6-phosphatase catalytic subunit | |
|
2 | 2 | ||||||
| MIRT461934 | TNFSF14 | TNF superfamily member 14 | |
|
2 | 2 | ||||||
| MIRT463834 | WSB1 | WD repeat and SOCS box containing 1 | |
|
2 | 2 | ||||||
| MIRT468615 | SUMO1 | small ubiquitin-like modifier 1 | |
|
2 | 2 | ||||||
| MIRT469456 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 6 | ||||||
| MIRT469637 | RAD21 | RAD21 cohesin complex component | |
|
2 | 6 | ||||||
| MIRT473432 | MDM4 | MDM4, p53 regulator | |
|
2 | 2 | ||||||
| MIRT473872 | MAFK | MAF bZIP transcription factor K | |
|
2 | 6 | ||||||
| MIRT476861 | FHL2 | four and a half LIM domains 2 | |
|
2 | 4 | ||||||
| MIRT476893 | FBXO21 | F-box protein 21 | |
|
2 | 2 | ||||||
| MIRT479880 | CCDC43 | coiled-coil domain containing 43 | |
|
2 | 2 | ||||||
| MIRT488848 | UBTF | upstream binding transcription factor, RNA polymerase I | |
|
2 | 2 | ||||||
| MIRT491164 | LRP3 | LDL receptor related protein 3 | |
|
2 | 2 | ||||||
| MIRT497662 | PRMT3 | protein arginine methyltransferase 3 | |
|
2 | 2 | ||||||
| MIRT499314 | ZNF485 | zinc finger protein 485 | |
|
2 | 10 | ||||||
| MIRT499759 | CIRH1A | UTP4, small subunit processome component | |
|
2 | 10 | ||||||
| MIRT500014 | ABCF2 | ATP binding cassette subfamily F member 2 | |
|
2 | 8 | ||||||
| MIRT501090 | SLC7A5 | solute carrier family 7 member 5 | |
|
2 | 4 | ||||||
| MIRT509646 | ZNF354B | zinc finger protein 354B | |
|
2 | 10 | ||||||
| MIRT509945 | TOMM70A | translocase of outer mitochondrial membrane 70 | |
|
2 | 6 | ||||||
| MIRT510320 | SLC2A3 | solute carrier family 2 member 3 | |
|
2 | 4 | ||||||
| MIRT515505 | GTF2F1 | general transcription factor IIF subunit 1 | |
|
2 | 2 | ||||||
| MIRT516410 | COPA | coatomer protein complex subunit alpha | |
|
2 | 2 | ||||||
| MIRT517861 | NCAPD2 | non-SMC condensin I complex subunit D2 | |
|
2 | 4 | ||||||
| MIRT522558 | MCAM | melanoma cell adhesion molecule | |
|
2 | 4 | ||||||
| MIRT523525 | GLUL | glutamate-ammonia ligase | |
|
2 | 2 | ||||||
| MIRT523764 | FBXO27 | F-box protein 27 | |
|
2 | 4 | ||||||
| MIRT524517 | CDK19 | cyclin dependent kinase 19 | |
|
2 | 2 | ||||||
| MIRT524753 | BIRC5 | baculoviral IAP repeat containing 5 | |
|
2 | 6 | ||||||
| MIRT529366 | YWHAB | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta | |
|
2 | 4 | ||||||
| MIRT531189 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | |
|
2 | 2 | ||||||
| MIRT531639 | C19orf52 | translocase of inner mitochondrial membrane 29 | |
|
2 | 4 | ||||||
| MIRT531913 | SLC4A1 | solute carrier family 4 member 1 (Diego blood group) | |
|
2 | 2 | ||||||
| MIRT532678 | PATZ1 | POZ/BTB and AT hook containing zinc finger 1 | |
|
2 | 2 | ||||||
| MIRT533115 | YIPF4 | Yip1 domain family member 4 | |
|
2 | 4 | ||||||
| MIRT534740 | RBM47 | RNA binding motif protein 47 | |
|
2 | 2 | ||||||
| MIRT535471 | PARVB | parvin beta | |
|
2 | 4 | ||||||
| MIRT536742 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | |
|
2 | 2 | ||||||
| MIRT537237 | GALNT3 | polypeptide N-acetylgalactosaminyltransferase 3 | |
|
2 | 2 | ||||||
| MIRT539523 | ABCF1 | ATP binding cassette subfamily F member 1 | |
|
2 | 4 | ||||||
| MIRT540438 | RBM43 | RNA binding motif protein 43 | |
|
2 | 2 | ||||||
| MIRT542982 | ERC1 | ELKS/RAB6-interacting/CAST family member 1 | |
|
2 | 2 | ||||||
| MIRT544674 | AP1S1 | adaptor related protein complex 1 sigma 1 subunit | |
|
2 | 2 | ||||||
| MIRT549514 | HDDC2 | HD domain containing 2 | |
|
2 | 2 | ||||||
| MIRT549663 | ORC6 | origin recognition complex subunit 6 | |
|
2 | 4 | ||||||
| MIRT555420 | PPIC | peptidylprolyl isomerase C | |
|
2 | 2 | ||||||
| MIRT564701 | ZNF322P1 | zinc finger protein 322 pseudogene 1 | |
|
2 | 2 | ||||||
| MIRT570046 | PKNOX1 | PBX/knotted 1 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT570257 | PRSS16 | protease, serine 16 | |
|
2 | 2 | ||||||
| MIRT571143 | HM13 | histocompatibility minor 13 | |
|
2 | 2 | ||||||
| MIRT575202 | Entpd4 | ectonucleoside triphosphate diphosphohydrolase 4 | |
|
2 | 2 | ||||||
| MIRT575282 | Mapk8ip2 | mitogen-activated protein kinase 8 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT575302 | Osbpl10 | oxysterol binding protein-like 10 | |
|
2 | 9 | ||||||
| MIRT575323 | Fbxo6 | F-box protein 6 | |
|
2 | 2 | ||||||
| MIRT575377 | Ang | angiogenin, ribonuclease, RNase A family, 5 | |
|
2 | 3 | ||||||
| MIRT575614 | Zswim1 | zinc finger SWIM-type containing 1 | |
|
2 | 3 | ||||||
| MIRT575671 | Map1b | microtubule-associated protein 1B | |
|
2 | 2 | ||||||
| MIRT607065 | POM121L7 | POM121 transmembrane nucleoporin like 7 pseudogene | |
|
2 | 2 | ||||||
| MIRT607490 | HEBP2 | heme binding protein 2 | |
|
2 | 2 | ||||||
| MIRT607522 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT607655 | BTN3A2 | butyrophilin subfamily 3 member A2 | |
|
2 | 2 | ||||||
| MIRT607795 | RHBDL2 | rhomboid like 2 | |
|
2 | 2 | ||||||
| MIRT607842 | PHLDA3 | pleckstrin homology like domain family A member 3 | |
|
2 | 2 | ||||||
| MIRT607927 | ANG | angiogenin | |
|
2 | 3 | ||||||
| MIRT607966 | SNX22 | sorting nexin 22 | |
|
2 | 2 | ||||||
| MIRT608074 | ZFP14 | ZFP14 zinc finger protein | |
|
2 | 2 | ||||||
| MIRT608141 | SYAP1 | synapse associated protein 1 | |
|
2 | 2 | ||||||
| MIRT612620 | RABL3 | RAB, member of RAS oncogene family like 3 | |
|
2 | 2 | ||||||
| MIRT617444 | CCS | copper chaperone for superoxide dismutase | |
|
2 | 2 | ||||||
| MIRT617552 | MTO1 | mitochondrial tRNA translation optimization 1 | |
|
2 | 2 | ||||||
| MIRT618772 | HLA-E | major histocompatibility complex, class I, E | |
|
2 | 2 | ||||||
| MIRT618926 | MEAF6 | MYST/Esa1 associated factor 6 | |
|
2 | 2 | ||||||
| MIRT619247 | TIAL1 | TIA1 cytotoxic granule associated RNA binding protein like 1 | |
|
2 | 2 | ||||||
| MIRT620091 | YME1L1 | YME1 like 1 ATPase | |
|
2 | 2 | ||||||
| MIRT620483 | XKR6 | XK related 6 | |
|
2 | 2 | ||||||
| MIRT620570 | WBSCR27 | methyltransferase like 27 | |
|
2 | 4 | ||||||
| MIRT622977 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | |
|
2 | 2 | ||||||
| MIRT623169 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | |
|
2 | 2 | ||||||
| MIRT624165 | DGKE | diacylglycerol kinase epsilon | |
|
2 | 2 | ||||||
| MIRT625268 | AGAP9 | ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 | |
|
2 | 2 | ||||||
| MIRT625396 | AKR7L | aldo-keto reductase family 7 like (gene/pseudogene) | |
|
2 | 2 | ||||||
| MIRT625694 | OPTN | optineurin | |
|
2 | 2 | ||||||
| MIRT626093 | MKLN1 | muskelin 1 | |
|
2 | 2 | ||||||
| MIRT626431 | CHDH | choline dehydrogenase | |
|
2 | 2 | ||||||
| MIRT627013 | FIG4 | FIG4 phosphoinositide 5-phosphatase | |
|
2 | 2 | ||||||
| MIRT627077 | SF3A1 | splicing factor 3a subunit 1 | |
|
2 | 2 | ||||||
| MIRT627140 | HS3ST1 | heparan sulfate-glucosamine 3-sulfotransferase 1 | |
|
2 | 2 | ||||||
| MIRT627347 | TSHZ2 | teashirt zinc finger homeobox 2 | |
|
2 | 2 | ||||||
| MIRT627420 | THAP2 | THAP domain containing 2 | |
|
2 | 2 | ||||||
| MIRT627441 | TAS2R5 | taste 2 receptor member 5 | |
|
2 | 2 | ||||||
| MIRT628078 | KAT7 | lysine acetyltransferase 7 | |
|
2 | 4 | ||||||
| MIRT628276 | CYB5D1 | cytochrome b5 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT629094 | F2RL1 | F2R like trypsin receptor 1 | |
|
2 | 2 | ||||||
| MIRT629236 | CINP | cyclin dependent kinase 2 interacting protein | |
|
2 | 2 | ||||||
| MIRT629286 | UNC13A | unc-13 homolog A | |
|
2 | 2 | ||||||
| MIRT629407 | ADM2 | adrenomedullin 2 | |
|
2 | 2 | ||||||
| MIRT629584 | RFC2 | replication factor C subunit 2 | |
|
2 | 2 | ||||||
| MIRT629635 | WDR31 | WD repeat domain 31 | |
|
2 | 2 | ||||||
| MIRT629874 | NOM1 | nucleolar protein with MIF4G domain 1 | |
|
2 | 2 | ||||||
| MIRT629984 | NARS | asparaginyl-tRNA synthetase | |
|
2 | 2 | ||||||
| MIRT630043 | TERF2 | telomeric repeat binding factor 2 | |
|
2 | 2 | ||||||
| MIRT630061 | NIP7 | NIP7, nucleolar pre-rRNA processing protein | |
|
2 | 2 | ||||||
| MIRT630127 | ARHGEF5 | Rho guanine nucleotide exchange factor 5 | |
|
2 | 2 | ||||||
| MIRT630155 | ZBTB8A | zinc finger and BTB domain containing 8A | |
|
2 | 2 | ||||||
| MIRT630252 | SMTNL2 | smoothelin like 2 | |
|
2 | 2 | ||||||
| MIRT630278 | PSMB5 | proteasome subunit beta 5 | |
|
2 | 2 | ||||||
| MIRT630347 | NKAP | NFKB activating protein | |
|
2 | 2 | ||||||
| MIRT630497 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | |
|
2 | 2 | ||||||
| MIRT631264 | CENPM | centromere protein M | |
|
2 | 2 | ||||||
| MIRT631403 | IL2RA | interleukin 2 receptor subunit alpha | |
|
2 | 2 | ||||||
| MIRT632470 | RPS15A | ribosomal protein S15a | |
|
2 | 2 | ||||||
| MIRT632596 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT632994 | DUSP18 | dual specificity phosphatase 18 | |
|
2 | 2 | ||||||
| MIRT633082 | CXorf21 | chromosome X open reading frame 21 | |
|
2 | 2 | ||||||
| MIRT633239 | ZNF573 | zinc finger protein 573 | |
|
2 | 2 | ||||||
| MIRT633286 | SLC1A5 | solute carrier family 1 member 5 | |
|
2 | 2 | ||||||
| MIRT633536 | PGBD5 | piggyBac transposable element derived 5 | |
|
2 | 2 | ||||||
| MIRT634338 | SGOL1 | shugoshin 1 | |
|
2 | 2 | ||||||
| MIRT634600 | KIAA1919 | major facilitator superfamily domain containing 4B | |
|
2 | 2 | ||||||
| MIRT635050 | MYH11 | myosin heavy chain 11 | |
|
2 | 2 | ||||||
| MIRT635236 | QPRT | quinolinate phosphoribosyltransferase | |
|
2 | 2 | ||||||
| MIRT635322 | BMS1 | BMS1, ribosome biogenesis factor | |
|
2 | 2 | ||||||
| MIRT636268 | RNF157 | ring finger protein 157 | |
|
2 | 2 | ||||||
| MIRT636450 | LRCH3 | leucine rich repeats and calponin homology domain containing 3 | |
|
2 | 2 | ||||||
| MIRT636516 | FMN1 | formin 1 | |
|
2 | 2 | ||||||
| MIRT636755 | SLC16A5 | solute carrier family 16 member 5 | |
|
2 | 2 | ||||||
| MIRT637134 | BAMBI | BMP and activin membrane bound inhibitor | |
|
2 | 2 | ||||||
| MIRT637188 | ROMO1 | reactive oxygen species modulator 1 | |
|
2 | 2 | ||||||
| MIRT637287 | IBA57 | IBA57 homolog, iron-sulfur cluster assembly | |
|
2 | 2 | ||||||
| MIRT637532 | RGS9BP | regulator of G protein signaling 9 binding protein | |
|
2 | 2 | ||||||
| MIRT637693 | CEP89 | centrosomal protein 89 | |
|
2 | 2 | ||||||
| MIRT637788 | OLA1 | Obg like ATPase 1 | |
|
2 | 2 | ||||||
| MIRT637925 | LILRA2 | leukocyte immunoglobulin like receptor A2 | |
|
2 | 2 | ||||||
| MIRT638449 | PLXDC2 | plexin domain containing 2 | |
|
2 | 2 | ||||||
| MIRT640871 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
|
2 | 2 | ||||||
| MIRT642643 | PTGR2 | prostaglandin reductase 2 | |
|
2 | 2 | ||||||
| MIRT643082 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | |
1 | 1 | |||||||
| MIRT643123 | FAM71F2 | family with sequence similarity 71 member F2 | |
|
2 | 2 | ||||||
| MIRT644236 | SLC35E3 | solute carrier family 35 member E3 | |
|
2 | 2 | ||||||
| MIRT644665 | TMCO1 | transmembrane and coiled-coil domains 1 | |
|
2 | 2 | ||||||
| MIRT645092 | SLC35E2B | solute carrier family 35 member E2B | |
|
2 | 2 | ||||||
| MIRT645993 | ACP6 | acid phosphatase 6, lysophosphatidic | |
|
2 | 2 | ||||||
| MIRT646508 | FAM217B | family with sequence similarity 217 member B | |
|
2 | 2 | ||||||
| MIRT647013 | ADCY2 | adenylate cyclase 2 | |
|
2 | 2 | ||||||
| MIRT647095 | SEC23B | Sec23 homolog B, coat complex II component | |
|
2 | 2 | ||||||
| MIRT647714 | NFX1 | nuclear transcription factor, X-box binding 1 | |
|
2 | 4 | ||||||
| MIRT648040 | FADS6 | fatty acid desaturase 6 | |
|
2 | 2 | ||||||
| MIRT648510 | PIGG | phosphatidylinositol glycan anchor biosynthesis class G | |
|
2 | 2 | ||||||
| MIRT648865 | ABCA6 | ATP binding cassette subfamily A member 6 | |
|
2 | 2 | ||||||
| MIRT649182 | DNPEP | aspartyl aminopeptidase | |
|
2 | 2 | ||||||
| MIRT649660 | TEP1 | telomerase associated protein 1 | |
|
2 | 2 | ||||||
| MIRT651465 | XIAP | X-linked inhibitor of apoptosis | |
|
2 | 2 | ||||||
| MIRT652398 | TMEM40 | transmembrane protein 40 | |
|
2 | 2 | ||||||
| MIRT653691 | SLC25A33 | solute carrier family 25 member 33 | |
|
2 | 2 | ||||||
| MIRT654122 | RPS6KA5 | ribosomal protein S6 kinase A5 | |
|
2 | 2 | ||||||
| MIRT654577 | PXMP4 | peroxisomal membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT656470 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | |
|
2 | 2 | ||||||
| MIRT658905 | DPY19L4 | dpy-19 like 4 | |
|
2 | 2 | ||||||
| MIRT660878 | ADRBK2 | G protein-coupled receptor kinase 3 | |
|
2 | 4 | ||||||
| MIRT661101 | SPIB | Spi-B transcription factor | |
|
2 | 2 | ||||||
| MIRT661238 | ARL17B | ADP ribosylation factor like GTPase 17B | |
|
2 | 2 | ||||||
| MIRT661291 | LIN52 | lin-52 DREAM MuvB core complex component | |
|
2 | 2 | ||||||
| MIRT662235 | PGBD4 | piggyBac transposable element derived 4 | |
|
2 | 2 | ||||||
| MIRT662544 | MTAP | methylthioadenosine phosphorylase | |
|
2 | 2 | ||||||
| MIRT662736 | LRRC3C | leucine rich repeat containing 3C | |
|
2 | 2 | ||||||
| MIRT662844 | OMD | osteomodulin | |
|
2 | 2 | ||||||
| MIRT662907 | MED18 | mediator complex subunit 18 | |
|
2 | 2 | ||||||
| MIRT662956 | JPH2 | junctophilin 2 | |
|
2 | 2 | ||||||
| MIRT663340 | ZNF74 | zinc finger protein 74 | |
|
2 | 2 | ||||||
| MIRT663496 | IYD | iodotyrosine deiodinase | |
|
2 | 2 | ||||||
| MIRT663523 | MASTL | microtubule associated serine/threonine kinase like | |
|
2 | 2 | ||||||
| MIRT663542 | CCR6 | C-C motif chemokine receptor 6 | |
|
2 | 2 | ||||||
| MIRT663903 | MRI1 | methylthioribose-1-phosphate isomerase 1 | |
|
2 | 2 | ||||||
| MIRT663973 | ZNF786 | zinc finger protein 786 | |
|
2 | 2 | ||||||
| MIRT664350 | C16orf45 | chromosome 16 open reading frame 45 | |
|
2 | 2 | ||||||
| MIRT664417 | TIGD6 | tigger transposable element derived 6 | |
|
2 | 2 | ||||||
| MIRT664468 | ZYG11B | zyg-11 family member B, cell cycle regulator | |
|
2 | 2 | ||||||
| MIRT664957 | PTCD3 | pentatricopeptide repeat domain 3 | |
|
2 | 2 | ||||||
| MIRT664970 | TDRD1 | tudor domain containing 1 | |
|
2 | 2 | ||||||
| MIRT665199 | ESF1 | ESF1 nucleolar pre-rRNA processing protein homolog | |
|
2 | 2 | ||||||
| MIRT665359 | XKR4 | XK related 4 | |
|
2 | 2 | ||||||
| MIRT665454 | WDR17 | WD repeat domain 17 | |
|
2 | 2 | ||||||
| MIRT665486 | VPS53 | VPS53, GARP complex subunit | |
|
2 | 2 | ||||||
| MIRT666078 | SSTR2 | somatostatin receptor 2 | |
|
2 | 2 | ||||||
| MIRT666258 | SLC31A1 | solute carrier family 31 member 1 | |
|
2 | 2 | ||||||
| MIRT666324 | SLC16A10 | solute carrier family 16 member 10 | |
|
2 | 2 | ||||||
| MIRT666486 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 2 | ||||||
| MIRT666696 | RBM23 | RNA binding motif protein 23 | |
|
2 | 2 | ||||||
| MIRT666712 | RBL1 | RB transcriptional corepressor like 1 | |
|
2 | 2 | ||||||
| MIRT666762 | RAB10 | RAB10, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT666931 | PNRC1 | proline rich nuclear receptor coactivator 1 | |
|
2 | 2 | ||||||
| MIRT667226 | NFE2L1 | nuclear factor, erythroid 2 like 1 | |
|
2 | 2 | ||||||
| MIRT667359 | MPLKIP | M-phase specific PLK1 interacting protein | |
|
2 | 2 | ||||||
| MIRT667474 | MAPK1 | mitogen-activated protein kinase 1 | |
|
2 | 2 | ||||||
| MIRT667558 | LRAT | lecithin retinol acyltransferase | |
|
2 | 2 | ||||||
| MIRT667748 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | |
|
2 | 2 | ||||||
| MIRT668088 | GMEB1 | glucocorticoid modulatory element binding protein 1 | |
|
2 | 2 | ||||||
| MIRT668119 | GK5 | glycerol kinase 5 (putative) | |
|
2 | 2 | ||||||
| MIRT668166 | GDE1 | glycerophosphodiester phosphodiesterase 1 | |
|
2 | 2 | ||||||
| MIRT668346 | STXBP2 | syntaxin binding protein 2 | |
|
2 | 2 | ||||||
| MIRT668509 | ESYT2 | extended synaptotagmin 2 | |
|
2 | 2 | ||||||
| MIRT669291 | C17orf85 | nuclear cap binding subunit 3 | |
|
2 | 2 | ||||||
| MIRT669547 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | |
|
2 | 2 | ||||||
| MIRT669778 | CNDP1 | carnosine dipeptidase 1 | |
|
2 | 2 | ||||||
| MIRT669858 | BROX | BRO1 domain and CAAX motif containing | |
|
2 | 4 | ||||||
| MIRT670017 | TECPR1 | tectonin beta-propeller repeat containing 1 | |
|
2 | 2 | ||||||
| MIRT670177 | CCDC142 | coiled-coil domain containing 142 | |
|
2 | 2 | ||||||
| MIRT671107 | ZNF841 | zinc finger protein 841 | |
|
2 | 2 | ||||||
| MIRT671351 | SMG1 | SMG1, nonsense mediated mRNA decay associated PI3K related kinase | |
|
2 | 2 | ||||||
| MIRT671476 | FLYWCH2 | FLYWCH family member 2 | |
|
2 | 2 | ||||||
| MIRT671492 | SLC38A9 | solute carrier family 38 member 9 | |
|
2 | 2 | ||||||
| MIRT671554 | LIMS1 | LIM zinc finger domain containing 1 | |
|
2 | 2 | ||||||
| MIRT671925 | PLEKHS1 | pleckstrin homology domain containing S1 | |
|
2 | 4 | ||||||
| MIRT672196 | F2 | coagulation factor II, thrombin | |
|
2 | 2 | ||||||
| MIRT672217 | DCAF7 | DDB1 and CUL4 associated factor 7 | |
|
2 | 2 | ||||||
| MIRT672252 | SIK2 | salt inducible kinase 2 | |
|
2 | 2 | ||||||
| MIRT672290 | GP2 | glycoprotein 2 | |
|
2 | 2 | ||||||
| MIRT672430 | POLR2D | RNA polymerase II subunit D | |
|
2 | 2 | ||||||
| MIRT672597 | NKPD1 | NTPase KAP family P-loop domain containing 1 | |
|
2 | 2 | ||||||
| MIRT672901 | KRBA2 | KRAB-A domain containing 2 | |
|
2 | 2 | ||||||
| MIRT672958 | ZNF655 | zinc finger protein 655 | |
|
2 | 2 | ||||||
| MIRT673096 | SYNPO2L | synaptopodin 2 like | |
|
2 | 2 | ||||||
| MIRT673171 | TMEM56 | transmembrane protein 56 | |
|
2 | 2 | ||||||
| MIRT673251 | INO80 | INO80 complex subunit | |
|
2 | 2 | ||||||
| MIRT673296 | RNF19B | ring finger protein 19B | |
|
2 | 2 | ||||||
| MIRT673574 | KDELC2 | KDEL motif containing 2 | |
|
2 | 2 | ||||||
| MIRT673586 | KIF1C | kinesin family member 1C | |
|
2 | 2 | ||||||
| MIRT673737 | TCF23 | transcription factor 23 | |
|
2 | 2 | ||||||
| MIRT673767 | MRPL17 | mitochondrial ribosomal protein L17 | |
|
2 | 2 | ||||||
| MIRT674215 | FAM120AOS | family with sequence similarity 120A opposite strand | |
|
2 | 2 | ||||||
| MIRT674283 | NAGK | N-acetylglucosamine kinase | |
|
2 | 2 | ||||||
| MIRT674338 | KCMF1 | potassium channel modulatory factor 1 | |
|
2 | 2 | ||||||
| MIRT674517 | PRR23A | proline rich 23A | |
|
2 | 2 | ||||||
| MIRT675100 | SNTB2 | syntrophin beta 2 | |
|
2 | 2 | ||||||
| MIRT675144 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT675223 | CLK4 | CDC like kinase 4 | |
|
2 | 2 | ||||||
| MIRT675263 | ZNF431 | zinc finger protein 431 | |
|
2 | 2 | ||||||
| MIRT675577 | WWC1 | WW and C2 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT676025 | C9orf69 | transmembrane protein 250 | |
|
2 | 2 | ||||||
| MIRT676430 | PLEKHM3 | pleckstrin homology domain containing M3 | |
|
2 | 2 | ||||||
| MIRT676560 | VSIG1 | V-set and immunoglobulin domain containing 1 | |
|
2 | 2 | ||||||
| MIRT676596 | ARIH2OS | ariadne RBR E3 ubiquitin protein ligase 2 opposite strand | |
|
2 | 2 | ||||||
| MIRT678576 | TMEM168 | transmembrane protein 168 | |
|
2 | 2 | ||||||
| MIRT678756 | ALG1 | ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase | |
|
2 | 2 | ||||||
| MIRT680344 | ZNF281 | zinc finger protein 281 | |
|
2 | 2 | ||||||
| MIRT680467 | C3 | complement C3 | |
|
2 | 2 | ||||||
| MIRT682826 | FLG2 | filaggrin family member 2 | |
|
2 | 2 | ||||||
| MIRT682881 | SAR1A | secretion associated Ras related GTPase 1A | |
|
2 | 2 | ||||||
| MIRT684404 | TMEM180 | major facilitator superfamily domain containing 13A | |
|
2 | 2 | ||||||
| MIRT685275 | KIAA1143 | KIAA1143 | |
|
2 | 2 | ||||||
| MIRT686061 | KCNA7 | potassium voltage-gated channel subfamily A member 7 | |
|
2 | 2 | ||||||
| MIRT687526 | NASP | nuclear autoantigenic sperm protein | |
|
2 | 2 | ||||||
| MIRT691760 | BCL2L15 | BCL2 like 15 | |
|
2 | 2 | ||||||
| MIRT693890 | C3orf62 | chromosome 3 open reading frame 62 | |
|
2 | 2 | ||||||
| MIRT699342 | SLC35E1 | solute carrier family 35 member E1 | |
|
2 | 2 | ||||||
| MIRT699909 | RUNDC1 | RUN domain containing 1 | |
|
2 | 2 | ||||||
| MIRT700536 | PTPDC1 | protein tyrosine phosphatase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT701807 | MRPS25 | mitochondrial ribosomal protein S25 | |
|
2 | 2 | ||||||
| MIRT702174 | LYRM4 | LYR motif containing 4 | |
|
2 | 2 | ||||||
| MIRT706205 | ACOT9 | acyl-CoA thioesterase 9 | |
|
2 | 2 | ||||||
| MIRT706659 | RNF216 | ring finger protein 216 | |
|
2 | 2 | ||||||
| MIRT706682 | COL13A1 | collagen type XIII alpha 1 chain | |
|
2 | 2 | ||||||
| MIRT706705 | GPR155 | G protein-coupled receptor 155 | |
|
2 | 2 | ||||||
| MIRT706777 | ANKRD36 | ankyrin repeat domain 36 | |
|
2 | 2 | ||||||
| MIRT706844 | DNAJB13 | DnaJ heat shock protein family (Hsp40) member B13 | |
|
2 | 2 | ||||||
| MIRT706863 | MAFF | MAF bZIP transcription factor F | |
|
2 | 2 | ||||||
| MIRT706896 | ST3GAL1 | ST3 beta-galactoside alpha-2,3-sialyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT706916 | THAP6 | THAP domain containing 6 | |
|
2 | 2 | ||||||
| MIRT706962 | FANCC | Fanconi anemia complementation group C | |
|
2 | 2 | ||||||
| MIRT706980 | XPO5 | exportin 5 | |
|
2 | 2 | ||||||
| MIRT707015 | RRP36 | ribosomal RNA processing 36 | |
|
2 | 2 | ||||||
| MIRT707032 | ACTR5 | ARP5 actin related protein 5 homolog | |
|
2 | 2 | ||||||
| MIRT707072 | MED29 | mediator complex subunit 29 | |
|
2 | 2 | ||||||
| MIRT709368 | SPECC1 | sperm antigen with calponin homology and coiled-coil domains 1 | |
|
2 | 2 | ||||||
| MIRT720092 | SPTLC3 | serine palmitoyltransferase long chain base subunit 3 | |
|
2 | 2 | ||||||
| MIRT721330 | IFNAR2 | interferon alpha and beta receptor subunit 2 | |
|
2 | 2 | ||||||
| MIRT724198 | MED7 | mediator complex subunit 7 | |
|
2 | 2 | ||||||
| MIRT725403 | KIF6 | kinesin family member 6 | |
|
2 | 2 | ||||||
| MIRT733035 | COL4A2 | collagen type IV alpha 2 chain | |
1 | 0 | |||||||
| MIRT733036 | COL26A1 | collagen type XXVI alpha 1 chain | |
1 | 0 | |||||||
| MIRT733426 | PLK1 | polo like kinase 1 | |
|
|
3 | 0 | |||||
| MIRT734484 | PLD1 | phospholipase D1 | |
|
|
3 | 0 | |||||
| MIRT736044 | CBL | Cbl proto-oncogene | |
|
|
3 | 0 | |||||