miRTarBase - #MIRT481181 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AVL9   
Synonyms KIAA0241
Description AVL9 cell migration associated
Transcript NM_015060   
Expression
Putative miRNA Targets on AVL9
3'UTR of AVL9
(miRNA target sites are highlighted)
>AVL9|NM_015060|3'UTR
   1 GCAAGGCGTCAGAGGCTGCTATTGCTTTCTGAGGTTTAAGTGTCCCCTGTCTGTCTGCTGCTCCCAGGCTGTTACTAGCC
  81 ACAGATCCACAGCAGGGGACCATATGTCGAACTGTTTACATGGATGTTGCTCTAAGTGAATGTTTCGGGATGCCGAAATG
 161 ATGAAATCACAGCCATAGCAGGGATGGCTTTCCAGGTTGGGGTTTCAATTGACTACTTTTATTTCAGTCTGAGCCTGATT
 241 AAAACATACAGTGAACCTTCTAATGAATTTTGAGTTCTGATATTGTACATTGGTTTACTTTAGAAGAGTTTTTACTTATG
 321 TAAATTTTGTTCTGTTTTGGTGTTTGAATATCTAGATGGTCACTGTAATTTATACTTGCTAAAATTAATTTATATTACCA
 401 TTTTCTCTAAAGTTGGCCTTAAAACGTGCTTATAAAGTGAAGGGGTCATACAGTTGGGCCTTCATTATTTTGCTGAATTA
 481 TGTGATGATTTTTTTGCTTTCTACCCACAAAACATTTATTAATTCACTTCCTCCCAGAAACATGAAAGTTAGAGGTGGTA
 561 GTTCTGAGGATTGGGTGTTTTGTTTTACGTTTTTAGTTTGTTCTTTCCACATCCTTAAAAACTTGGTTTCAGACATCAAG
 641 GAGTATCACTGTGCTTTCCTCCTCTTTATAACTGTGCAGGTGGGTGTGCAGAGAAATAGCAGAGTGATGGTTCGATGATA
 721 CTGAAGCAGTTTAACATGAATGTGTCTGTAGGGCAATACTTTCAAAGAAGACCTATGTGTTTATTTTTCAACCGCAGTCA
 801 TGTTGCAGTCTTACAAGCACTTTTTTTTTATTCCAGAGTTTGTGCCATCTGTTTCTCTTTTTTTTTTTGGGGGGGGGGGG
 881 GGGGCGGGGTCTCACTCTATCGCCCAGGCTGGAGTGCAGTGGTGCCATCTCGGCTCACTGCAACCTCCATCTCCCGGGTT
 961 CAAGCAATTCTTGTACCTCAGCCTCCCAAGTAGCTGGGATTATGGACATGCGCCACCATGCCCAGCTAATTATTGTATTT
1041 TTAGTAGAGACGGGGTTTTGCCATGTTGGCCAGGCTGGTCTTGATCTCCTGGCCTCAAGTGATCTGCCCGCCTCAGCCTC
1121 TCAAAGTGCTGGGACTACAGGCATGAGCCACTGCGCCTGGCCTGTTTCTTTTTTAAACAGTTTTCTATTGGGTGTTTGCA
1201 GACCTACAGCTTTTCTCGTAGTCTTATTCATAAAGCTTTTCAAAGCACTTAGTCTTCTACTTCCCTAACTGAAAGTCCTC
1281 CTATAATCAATCCCTACCCCCTTCTAGAAGTATCTTAAAAGAAAAGCAAGGTGATTGTAAGTATTAAATAGAAATCTCAT
1361 CTTAGTTTATATTCAGCAAAGTAAGAGGCAAGAGAAGAAAACTGCAGCCTTGACATCTGTCATCTGAGAAAGGATATCTG
1441 GTTTCATGTTAGGCACATACATGCATGTGTGTGCCATCTACTGATGATTTGTACACAGCTGGACCTCGTGTGTTTGCCAT
1521 GCTCAGCTCTCATTTGCTTTTCAAGGATACCTGGGATGGCTGTTCTCAGAGAGTACTTACGGGGAACAGACTGCCTTTTA
1601 GTAACAAGGGATACTTGGGAAATACATTGTGAGTATGATCTATCCCAGATTGCTGGGGAAATAAAGGAGGGCCCTGATTA
1681 TATTTGGTTTATTCCTCACTAAATGTTTAAGAAGTAAATGCTCCCAAGGCATTTGAAATGAACATAGAAACATAATCTAA
1761 ATGTCTCTAAATTTTCCACTTTGTGTTTTCTAAACACAAATTGTATTACTCATTTGAGCATAACTCAAGAATTCAGCGAT
1841 GATAAATTGAAGGGCTGAATGTGAGAACTCCATTAATTCCACTTCTTCCAAGAAAGTTAACCTCAGGAAATGCTGTTTGA
1921 AGAGAAGAAAGTAGTACCAAACAAAAACCTTAAACAGTACTTGAATCTTTTTTGCGCTGAGACTATAAAGAATTCATTCT
2001 AACATCTTGTTTCATAAGGGCCACATCATTCGTTGGAGCATGATAGTGTGATTTGTGTACAATTGTTACCTCTCAGCTGC
2081 TGAAGTTCACACTTCAAGGATCTAGGAGCTCTGTGAGGGGTCGTCCAGCAAGATGCTGATTTGTCTTTCAGTTGGTATGG
2161 TTTCTGTGATCGGGGTAAACTCCCGTCTCCCACTATTCAAAAGCAGCCCAACTCATGCTTTGGAATCCACTGAAATAAAA
2241 ATAGTTACATGAAGTTTAACTTTGCTTTAATATCACTTGTTCCTCATTGAATATACACTTTGATCGGACTTTCTATTAAC
2321 ATTTCTAGCTAAGAGTTTGACTCTTAGTGGTCACTTTACTGACTTTCCAACATAAAACAAGTATCTCAGAAGATACAACT
2401 TTCATCATAGAAATGGTCAAAAGACCATAGCTATATTTCCTTCAGGTTCTGGGAGGTGGAGTTTTTCAAGGAACACTGGC
2481 TGTTGTATTGTTGGCAGGGGCCCCAAGGCAGCTCGCACAATCAAAGGCAGGAAGCCTCACCCCTGGTCCTGTGACCCCCC
2561 CCCCCCACACACACACATACTTCAGGCTTGGATTCTAGGCTCCAAGTGGCCAGCATAGAAGCAGCAGCCTCTCTCCAAAC
2641 CCTGGCTCTGTGAGCCATAGGAACCAGCACTAGGTCATCTTCTGACATAGCCCTGGTGAAGGTGTGTGTGTGTTGGTGGC
2721 CACACTTGCTAAGGCTTTTGTGTCTAAGAATTGAGTATTTGTACCTAGGTGTGAGGGAACCAGGGTCAGCCAGCCTTTTT
2801 CAGATGGCGCCAGGCACACACACTACATCAATGGCTTGCTGGTGGCTTCACCACTATCCAGGTGACTTAAAAGAGTGTTT
2881 GGAAAATGTCCCTGGTATACTTCAATTCCTACTAGACATTGTAATGACAATGGTGTAGGTAAGGAAGAGAGAGTTAAAAC
2961 TACCAGTTGTGGAATAGAAATAGTTGCATGTCCAAAGAAGGCTTAGAATGATTGTGCATATGCAGTTGGCTCACATAACC
3041 AGCATGAACAGTCTCTCCCCAAATCCATTAGTGATTCACTACCCCCCGCCAAGCACAGCCCTAAAACAATTCTCGTCCAC
3121 TTTCCTGTTAAGAAACACAGCAGCAATATACTTTGGCAGCAAACCAGAGCATATGATGTAACTTGCTCAACCTTATCTTC
3201 CTTTCCAAATTCTATACTAAGCATCTGATGTTTTTTAGAATAATTTCCTTTGGAAAGCCAACGAGAAAACAAATTAGGAA
3281 GAGAGAGAAGTGAGAAATTGTTGCATGGCTGAGGAACAAGATGCTTAAAATCTGAATGGAAGTATTTTGAGAGCAGTATT
3361 TCATGTGCTAAGGGTTATAAGAATTCTTTTAGAAAGGGATTAGAATTTTACTCTGCTAGTTACAAGTTTTAAAGTCACGC
3441 TACGGCATTATCACCCTGGCAGGTAGGTTTTGTTATTGTTTTACATTTTGTGAAAAAAAGTTTTGTAGAAGTTACAGCTA
3521 GTGGTCTTTTCCCTCCAGAGCCAGTGATGAGTGTGGGAGCACTTCAGCTCTGTAAGGGGCCAGCGTTCTGACCTTTAACC
3601 ACATGAACTAACCTGCGTCAGCAGTTGCAGAAAGTAGCCTGTTAGGACAGCAGCTGCTAAGCGTTGCCTGGTATTTTAGT
3681 GGGGAGAAGGCTGGGACTCTTCATGGCATCAACACTTGCATGCTCTGAATCTTTGATCAGAGATGAGGTGCCATTTTTGG
3761 CATTTCCACCCCGTCTCGTGGTAGCCTTTAAAAGTGGTAGAAGATGCTGCCCTAATTCCCCGAGGATGATTGTCATTCCA
3841 TGCAGCATAATGTGCCGTGAGGAGTTTTCTCATTCCAGTTCTTTGGACTTCGTAACATTGGAATTGTTTTTCCATAATTT
3921 CCGGCATTCCATAAATATTTGTCAAGGACAAAGAAAAGGAATGTGGATGTTTATTCTTTTCATATGAATGACTTTGTACA
4001 CATGACTTCCTGCTTTCATTATGAAGGAGGGGAAACTAGTTCCCTTGTATGGTAACTCCAAAGTTAAAAAATTGTGCATG
4081 TCTGAGGGGTTGAATATATTTTGTAAAACTCTAAATACATTTGTATTTCTGTGCTGTTCTAAAGTTTACCTTTTTACTTA
4161 TATGAAAGATAACTATATATTTAAATCATGTAAGTGGAACACAGTGTAGGGGGTTTTTCCAATCTTATTTTTCATCAGGT
4241 TCTCACACCCACGTAGTATGCTGCTCAAATTTTTTCGTGTGTGCAAATGTGAACATTTGAACATTTCAGTTAGGTACTGA
4321 GCCAGAAAAGGTAATTGAAGTTTTCAGAAAGCTTCTGTGCTTAGAAAATATTTTGTTGTTTTCTTAAAATATTAGTATTT
4401 TGTAGCTGGAAGAATAAGATCAAGGCTTACATGTTTCAGGCCACTTGGTCACTGGTTCCTGAATTTAGAAAACATTGGAT
4481 TAATGAGTTGGTGAAGGCATTTAGTGGTTACAAAAACAGTTTAAATATTTATGATTAAAGGCTTTTCACAAACCTTTTTA
4561 AAGAAAATTTAGCTGAGAAAACTTAAAAAGTTTTCTAAGGAAGTTTAACTGTGGCACATGTTTTGATCAGAAAGGTAGTT
4641 CTCTTTGCTCTGGTAGTTTTAAAGTTTGTACTAGTTCTTTATTTCTGTTGTTTTTTTAAATTGTTAAAATTATAAATCAC
4721 GTCTAATCATACTGAATTGTAAAACTTGAATTGTATCTTTATTTTAAGCATAAATGAGAATAAAATGATCCTGTTCACCC
4801 TGCCTACAGTTGGACTTGACCTGTCCTAGAAGTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUG---GUAAUACACGACGAu 5'
            || ||   |:| :| ||||||| 
Target 5' ctCACACCCACGTAGTATGCTGCTc 3'
4242 - 4266 156.00 -14.50
2
miRNA  3' guguuuGGUA-AUACACGACGAu 5'
                |::| |:| ||||||| 
Target 5' tgtcccCTGTCTGTCTGCTGCTc 3'
41 - 63 152.00 -11.10
3
miRNA  3' guGUUUGGUAA---UAC--ACGACGAu 5'
            |:|||::||   |||  ||:|||| 
Target 5' gtCGAACTGTTTACATGGATGTTGCTc 3'
106 - 132 150.00 -12.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30519303 16 COSMIC
COSN14285330 19 COSMIC
COSN30542882 34 COSMIC
COSN31597262 58 COSMIC
COSN30533106 67 COSMIC
COSN15623249 93 COSMIC
COSN23021179 109 COSMIC
COSN8300331 139 COSMIC
COSN31559407 147 COSMIC
COSN26678831 188 COSMIC
COSN30140510 191 COSMIC
COSN23591205 933 COSMIC
COSN16860089 1166 COSMIC
COSN9941282 1791 COSMIC
COSN4869117 1964 COSMIC
COSN25681698 1976 COSMIC
COSN31848965 2144 COSMIC
COSN2841515 2273 COSMIC
COSN20699413 2294 COSMIC
COSN32062294 2564 COSMIC
COSN28942453 2565 COSMIC
COSN28980187 2565 COSMIC
COSN27388525 2566 COSMIC
COSN8570349 2566 COSMIC
COSN27496663 2567 COSMIC
COSN24988250 2925 COSMIC
COSN2219819 3093 COSMIC
COSN2219820 3109 COSMIC
COSN17890135 3222 COSMIC
COSN8300332 3257 COSMIC
COSN25399854 3784 COSMIC
COSN30434267 4278 COSMIC
COSN1348625 4305 COSMIC
COSN14597770 4513 COSMIC
COSN7977932 4718 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760913165 8 dbSNP
rs536084075 9 dbSNP
rs1299679626 13 dbSNP
rs754619876 14 dbSNP
rs753919297 19 dbSNP
rs765073062 20 dbSNP
rs1198482163 25 dbSNP
rs1343840974 26 dbSNP
rs369599311 27 dbSNP
rs758094352 29 dbSNP
rs777739739 31 dbSNP
rs746609978 34 dbSNP
rs756984063 35 dbSNP
rs1277396433 45 dbSNP
rs1483622093 47 dbSNP
rs765626699 48 dbSNP
rs1002198579 52 dbSNP
rs780777992 53 dbSNP
rs745364377 54 dbSNP
rs1197809853 58 dbSNP
rs751980013 59 dbSNP
rs1260360662 60 dbSNP
rs1255736773 63 dbSNP
rs887403718 64 dbSNP
rs748723825 65 dbSNP
rs1287074329 66 dbSNP
rs772279374 67 dbSNP
rs773583669 68 dbSNP
rs1334686477 76 dbSNP
rs760823591 77 dbSNP
rs142823827 85 dbSNP
rs1399679838 86 dbSNP
rs1175429351 89 dbSNP
rs776898147 91 dbSNP
rs1470187355 93 dbSNP
rs1348382658 99 dbSNP
rs573096293 100 dbSNP
rs1294202901 101 dbSNP
rs1361445528 102 dbSNP
rs765400453 104 dbSNP
rs755488445 106 dbSNP
rs762969830 109 dbSNP
rs1026412070 110 dbSNP
rs539839883 113 dbSNP
rs1323156995 118 dbSNP
rs984978875 121 dbSNP
rs753034016 129 dbSNP
rs1462935608 130 dbSNP
rs781769486 135 dbSNP
rs564493711 136 dbSNP
rs1485619235 139 dbSNP
rs1241151388 140 dbSNP
rs1266732913 147 dbSNP
rs757181884 148 dbSNP
rs1189913635 149 dbSNP
rs576438835 151 dbSNP
rs1443878170 153 dbSNP
rs943651390 155 dbSNP
rs1198071347 156 dbSNP
rs6462385 158 dbSNP
rs1025189451 169 dbSNP
rs1165828108 171 dbSNP
rs1453025593 176 dbSNP
rs755615352 184 dbSNP
rs777456763 193 dbSNP
rs1408056675 196 dbSNP
rs902760070 197 dbSNP
rs1413566094 198 dbSNP
rs1000153451 200 dbSNP
rs1032598570 202 dbSNP
rs748950001 203 dbSNP
rs1052104826 207 dbSNP
rs1224257232 210 dbSNP
rs1184450442 214 dbSNP
rs1462906694 214 dbSNP
rs1246544517 216 dbSNP
rs892235590 218 dbSNP
rs1448072022 221 dbSNP
rs1287039759 223 dbSNP
rs1351189906 226 dbSNP
rs1018301476 227 dbSNP
rs1313858658 228 dbSNP
rs1246298229 232 dbSNP
rs1384593476 237 dbSNP
rs79646432 238 dbSNP
rs1429836072 240 dbSNP
rs1345707445 247 dbSNP
rs975885432 252 dbSNP
rs1403616573 253 dbSNP
rs1365075054 257 dbSNP
rs1282670215 271 dbSNP
rs1186291590 278 dbSNP
rs2060707 278 dbSNP
rs905102768 284 dbSNP
rs1235793351 289 dbSNP
rs549347529 302 dbSNP
rs1489615389 309 dbSNP
rs1178251413 316 dbSNP
rs1290357646 316 dbSNP
rs983732663 319 dbSNP
rs1034949413 320 dbSNP
rs1418200137 327 dbSNP
rs909147998 339 dbSNP
rs1272117645 343 dbSNP
rs578014273 349 dbSNP
rs896457357 365 dbSNP
rs545211077 366 dbSNP
rs1434176773 367 dbSNP
rs1026382913 384 dbSNP
rs1433710178 385 dbSNP
rs894896888 393 dbSNP
rs1303826970 397 dbSNP
rs1426701976 399 dbSNP
rs574868339 400 dbSNP
rs561621243 405 dbSNP
rs1170025441 409 dbSNP
rs1331851644 410 dbSNP
rs1336988682 411 dbSNP
rs952134497 412 dbSNP
rs1442348089 414 dbSNP
rs1189880306 419 dbSNP
rs949150250 426 dbSNP
rs984968445 427 dbSNP
rs1199501831 432 dbSNP
rs1236139809 439 dbSNP
rs1046188390 442 dbSNP
rs190701044 448 dbSNP
rs902641930 449 dbSNP
rs1346958960 457 dbSNP
rs1307759671 458 dbSNP
rs1274835472 465 dbSNP
rs1221524568 476 dbSNP
rs1322729167 483 dbSNP
rs1283857367 485 dbSNP
rs1406786175 487 dbSNP
rs1348734113 489 dbSNP
rs1297783024 499 dbSNP
rs1200069031 514 dbSNP
rs964909903 514 dbSNP
rs999718605 516 dbSNP
rs976705894 518 dbSNP
rs1174379419 523 dbSNP
rs923560940 526 dbSNP
rs1469669529 538 dbSNP
rs955018739 546 dbSNP
rs987791851 562 dbSNP
rs1430521348 566 dbSNP
rs913641524 572 dbSNP
rs1439595151 577 dbSNP
rs547323480 581 dbSNP
rs946504591 589 dbSNP
rs553941540 590 dbSNP
rs1480749380 604 dbSNP
rs894085211 604 dbSNP
rs1196127654 608 dbSNP
rs572339412 614 dbSNP
rs1460716571 635 dbSNP
rs937869339 644 dbSNP
rs571631263 645 dbSNP
rs896424745 652 dbSNP
rs965423357 654 dbSNP
rs1224460845 661 dbSNP
rs1398219844 662 dbSNP
rs993482979 665 dbSNP
rs772970848 669 dbSNP
rs879229930 675 dbSNP
rs1327612651 680 dbSNP
rs976768508 685 dbSNP
rs1456095547 686 dbSNP
rs146088489 687 dbSNP
rs1157730966 688 dbSNP
rs551032021 692 dbSNP
rs569285643 696 dbSNP
rs1419160553 698 dbSNP
rs1409633841 700 dbSNP
rs1304133733 703 dbSNP
rs1443740832 705 dbSNP
rs1205382812 706 dbSNP
rs887858329 714 dbSNP
rs1260140240 715 dbSNP
rs138851240 723 dbSNP
rs1318824511 738 dbSNP
rs1313123874 743 dbSNP
rs909105711 749 dbSNP
rs1383846510 754 dbSNP
rs765924510 757 dbSNP
rs1017695930 764 dbSNP
rs1289985053 767 dbSNP
rs1453793200 771 dbSNP
rs941999505 780 dbSNP
rs965214090 785 dbSNP
rs997713051 793 dbSNP
rs769823528 794 dbSNP
rs956319456 795 dbSNP
rs923727813 802 dbSNP
rs1185195514 804 dbSNP
rs1216069266 805 dbSNP
rs1260882176 809 dbSNP
rs773482778 809 dbSNP
rs1187058823 813 dbSNP
rs1486864332 816 dbSNP
rs1221922545 821 dbSNP
rs1289639347 821 dbSNP
rs1360438117 824 dbSNP
rs1294225361 826 dbSNP
rs1326234061 830 dbSNP
rs913610495 830 dbSNP
rs554514872 832 dbSNP
rs1254218437 835 dbSNP
rs1384388091 843 dbSNP
rs62467621 845 dbSNP
rs967693077 846 dbSNP
rs1344225535 853 dbSNP
rs1300730978 854 dbSNP
rs1403871734 856 dbSNP
rs1365738407 858 dbSNP
rs1372317969 858 dbSNP
rs1430211317 858 dbSNP
rs1460231948 858 dbSNP
rs368390593 858 dbSNP
rs766018889 858 dbSNP
rs780911929 858 dbSNP
rs1198707238 865 dbSNP
rs1266772809 865 dbSNP
rs1451350413 865 dbSNP
rs1490538882 865 dbSNP
rs1053980176 866 dbSNP
rs1322028163 866 dbSNP
rs1339028237 866 dbSNP
rs61160323 866 dbSNP
rs71559239 866 dbSNP
rs1389286956 867 dbSNP
rs1395383404 867 dbSNP
rs1403729147 867 dbSNP
rs55657575 867 dbSNP
rs769513491 867 dbSNP
rs867669394 867 dbSNP
rs1175646788 868 dbSNP
rs1427048238 868 dbSNP
rs1466999707 868 dbSNP
rs1480782662 868 dbSNP
rs56177100 868 dbSNP
rs1179809139 869 dbSNP
rs1251596334 869 dbSNP
rs1437449676 869 dbSNP
rs55663970 869 dbSNP
rs1419609580 870 dbSNP
rs1224693257 872 dbSNP
rs1460270120 872 dbSNP
rs1374373400 873 dbSNP
rs1267779189 874 dbSNP
rs1448663316 874 dbSNP
rs1475536752 875 dbSNP
rs1167026659 876 dbSNP
rs1420811511 877 dbSNP
rs1462598945 879 dbSNP
rs879158507 880 dbSNP
rs894046344 881 dbSNP
rs1393674293 882 dbSNP
rs1443120493 883 dbSNP
rs1204765658 884 dbSNP
rs1384808864 884 dbSNP
rs1320045535 885 dbSNP
rs879200199 886 dbSNP
rs1349364550 887 dbSNP
rs1279733853 890 dbSNP
rs1228408094 891 dbSNP
rs1380187438 892 dbSNP
rs1277853253 895 dbSNP
rs1316111594 897 dbSNP
rs1342121725 898 dbSNP
rs1235248817 899 dbSNP
rs1274298402 900 dbSNP
rs373894203 902 dbSNP
rs1160572480 903 dbSNP
rs1422947493 905 dbSNP
rs979559858 907 dbSNP
rs926409519 913 dbSNP
rs566333844 915 dbSNP
rs1384907132 916 dbSNP
rs533796960 920 dbSNP
rs937822214 922 dbSNP
rs1240816073 923 dbSNP
rs901139903 927 dbSNP
rs1056326949 932 dbSNP
rs917830433 933 dbSNP
rs1218235610 947 dbSNP
rs376695248 956 dbSNP
rs929246815 957 dbSNP
rs1047679980 958 dbSNP
rs149397799 959 dbSNP
rs1026118974 964 dbSNP
rs951520946 967 dbSNP
rs1192447223 968 dbSNP
rs1260635910 973 dbSNP
rs542829525 975 dbSNP
rs371306719 983 dbSNP
rs1365133395 984 dbSNP
rs1039505995 987 dbSNP
rs1016135477 990 dbSNP
rs78500967 992 dbSNP
rs963554100 995 dbSNP
rs1367751915 997 dbSNP
rs990696498 998 dbSNP
rs916520119 1004 dbSNP
rs1266059322 1006 dbSNP
rs1160284021 1008 dbSNP
rs1195129863 1009 dbSNP
rs1385367968 1012 dbSNP
rs1381479843 1013 dbSNP
rs556210120 1021 dbSNP
rs1323184408 1025 dbSNP
rs1270591227 1027 dbSNP
rs574490287 1027 dbSNP
rs541910609 1028 dbSNP
rs1030491274 1029 dbSNP
rs923666462 1034 dbSNP
rs1280020095 1036 dbSNP
rs935134719 1039 dbSNP
rs1293982103 1042 dbSNP
rs1340007962 1045 dbSNP
rs181600618 1052 dbSNP
rs528710058 1053 dbSNP
rs751926756 1056 dbSNP
rs1010406092 1064 dbSNP
rs1216376114 1066 dbSNP
rs1283372684 1079 dbSNP
rs1021843070 1089 dbSNP
rs373946907 1091 dbSNP
rs998125523 1110 dbSNP
rs1191317115 1111 dbSNP
rs1489248390 1127 dbSNP
rs979142348 1128 dbSNP
rs1047098295 1134 dbSNP
rs1033831415 1135 dbSNP
rs1203468232 1136 dbSNP
rs959184900 1139 dbSNP
rs1201660119 1145 dbSNP
rs1322802432 1151 dbSNP
rs991987937 1152 dbSNP
rs1421592266 1155 dbSNP
rs1183857830 1156 dbSNP
rs185724002 1157 dbSNP
rs917715962 1161 dbSNP
rs190233494 1163 dbSNP
rs760006884 1165 dbSNP
rs983338308 1168 dbSNP
rs909147473 1169 dbSNP
rs745441308 1175 dbSNP
rs1407541013 1178 dbSNP
rs1176144613 1183 dbSNP
rs1434398684 1185 dbSNP
rs1012101234 1188 dbSNP
rs1023545335 1219 dbSNP
rs1439967752 1220 dbSNP
rs1436803666 1222 dbSNP
rs942008472 1225 dbSNP
rs1201602639 1227 dbSNP
rs1460814223 1228 dbSNP
rs1039063893 1233 dbSNP
rs1256523012 1247 dbSNP
rs900577271 1249 dbSNP
rs1313771348 1250 dbSNP
rs970655945 1251 dbSNP
rs982180958 1262 dbSNP
rs1315225278 1266 dbSNP
rs1283775743 1276 dbSNP
rs933461182 1290 dbSNP
rs1051802330 1292 dbSNP
rs11980863 1293 dbSNP
rs989204142 1299 dbSNP
rs183181508 1301 dbSNP
rs755632788 1302 dbSNP
rs1021811974 1306 dbSNP
rs1157801383 1311 dbSNP
rs1239792945 1317 dbSNP
rs1419918894 1318 dbSNP
rs777213883 1323 dbSNP
rs1381855084 1331 dbSNP
rs1181454092 1332 dbSNP
rs1443794906 1338 dbSNP
rs904800137 1338 dbSNP
rs1000930166 1344 dbSNP
rs1033389206 1347 dbSNP
rs1211124651 1353 dbSNP
rs1255087667 1357 dbSNP
rs934280419 1363 dbSNP
rs1481965919 1365 dbSNP
rs1047773303 1369 dbSNP
rs374729931 1371 dbSNP
rs1322718254 1377 dbSNP
rs753393258 1380 dbSNP
rs1439009481 1383 dbSNP
rs756800637 1388 dbSNP
rs1297041831 1406 dbSNP
rs35752488 1408 dbSNP
rs1024742300 1409 dbSNP
rs950507387 1418 dbSNP
rs1400084693 1422 dbSNP
rs1362002472 1423 dbSNP
rs10807861 1436 dbSNP
rs1423722870 1447 dbSNP
rs1368795300 1448 dbSNP
rs753232730 1449 dbSNP
rs1166716140 1461 dbSNP
rs894593175 1467 dbSNP
rs76003102 1470 dbSNP
rs1023511203 1472 dbSNP
rs1358831562 1478 dbSNP
rs532877913 1490 dbSNP
rs745632501 1492 dbSNP
rs1266975644 1500 dbSNP
rs1222062791 1505 dbSNP
rs771905087 1508 dbSNP
rs779955007 1509 dbSNP
rs533763266 1514 dbSNP
rs975147628 1516 dbSNP
rs558412431 1517 dbSNP
rs921918224 1519 dbSNP
rs1373603576 1522 dbSNP
rs59474210 1523 dbSNP
rs1235514421 1525 dbSNP
rs933333771 1527 dbSNP
rs1300787419 1531 dbSNP
rs1385853852 1533 dbSNP
rs1051771263 1534 dbSNP
rs1460277070 1536 dbSNP
rs1422757632 1552 dbSNP
rs1171323048 1553 dbSNP
rs891901596 1554 dbSNP
rs1478819281 1565 dbSNP
rs758889175 1568 dbSNP
rs956372657 1570 dbSNP
rs1310087181 1573 dbSNP
rs1269748917 1574 dbSNP
rs1433981349 1574 dbSNP
rs187767374 1576 dbSNP
rs3801332 1581 dbSNP
rs533047329 1582 dbSNP
rs1201041996 1584 dbSNP
rs904768316 1585 dbSNP
rs551532445 1603 dbSNP
rs1196643732 1606 dbSNP
rs975546401 1608 dbSNP
rs751837377 1615 dbSNP
rs190990785 1616 dbSNP
rs1302967214 1617 dbSNP
rs752429532 1617 dbSNP
rs1331834982 1620 dbSNP
rs1424647336 1620 dbSNP
rs1467111586 1627 dbSNP
rs1431654951 1629 dbSNP
rs983031512 1630 dbSNP
rs1466628321 1639 dbSNP
rs1172878652 1645 dbSNP
rs1379539053 1648 dbSNP
rs763118873 1649 dbSNP
rs1239144926 1651 dbSNP
rs1180959861 1652 dbSNP
rs1460365392 1657 dbSNP
rs1263063232 1662 dbSNP
rs1013276537 1685 dbSNP
rs1199331021 1695 dbSNP
rs941359613 1698 dbSNP
rs1257353445 1712 dbSNP
rs1465200541 1713 dbSNP
rs771016193 1716 dbSNP
rs541523827 1721 dbSNP
rs950476499 1729 dbSNP
rs1004711499 1740 dbSNP
rs1309711215 1743 dbSNP
rs1016138927 1745 dbSNP
rs963547748 1746 dbSNP
rs974654989 1747 dbSNP
rs921860207 1758 dbSNP
rs1415073535 1759 dbSNP
rs1404408806 1760 dbSNP
rs894560318 1767 dbSNP
rs1293310359 1780 dbSNP
rs1381221495 1782 dbSNP
rs948816152 1785 dbSNP
rs1366011271 1786 dbSNP
rs1237362423 1791 dbSNP
rs1045857967 1793 dbSNP
rs1278491010 1794 dbSNP
rs560370359 1799 dbSNP
rs553923990 1804 dbSNP
rs763387806 1805 dbSNP
rs987459066 1807 dbSNP
rs913308917 1808 dbSNP
rs750832174 1810 dbSNP
rs1286303413 1820 dbSNP
rs370191060 1822 dbSNP
rs1043536104 1829 dbSNP
rs559649492 1837 dbSNP
rs540863261 1838 dbSNP
rs937518123 1839 dbSNP
rs1056027254 1848 dbSNP
rs1188471781 1849 dbSNP
rs896080183 1857 dbSNP
rs975095578 1860 dbSNP
rs1013245525 1861 dbSNP
rs759953528 1864 dbSNP
rs565566743 1867 dbSNP
rs1300306882 1880 dbSNP
rs1423086681 1890 dbSNP
rs1413484776 1898 dbSNP
rs1046131556 1899 dbSNP
rs1474058461 1908 dbSNP
rs2044828 1913 dbSNP
rs1190806875 1914 dbSNP
rs1487689147 1915 dbSNP
rs1395629388 1918 dbSNP
rs142382995 1920 dbSNP
rs1218308025 1933 dbSNP
rs1004596868 1935 dbSNP
rs983384817 1938 dbSNP
rs1016437023 1953 dbSNP
rs908777064 1956 dbSNP
rs963215285 1957 dbSNP
rs1268354372 1961 dbSNP
rs1341244101 1962 dbSNP
rs1168639555 1964 dbSNP
rs1300159344 1966 dbSNP
rs1420568823 1974 dbSNP
rs769890479 1976 dbSNP
rs996432167 1977 dbSNP
rs1028894613 1978 dbSNP
rs948703096 1979 dbSNP
rs1394907210 1980 dbSNP
rs1170639975 1982 dbSNP
rs1164761264 1984 dbSNP
rs1478459608 1986 dbSNP
rs954658462 1988 dbSNP
rs144803859 1991 dbSNP
rs928715282 1995 dbSNP
rs1221952067 2007 dbSNP
rs913194360 2007 dbSNP
rs3173734 2008 dbSNP
rs1197899227 2010 dbSNP
rs567505228 2019 dbSNP
rs926048300 2022 dbSNP
rs1052721265 2024 dbSNP
rs1397519797 2032 dbSNP
rs182388491 2033 dbSNP
rs748066457 2034 dbSNP
rs537758886 2041 dbSNP
rs187908440 2043 dbSNP
rs1334323179 2044 dbSNP
rs899487828 2045 dbSNP
rs996482209 2048 dbSNP
rs1029355246 2060 dbSNP
rs950320341 2061 dbSNP
rs1047348281 2062 dbSNP
rs1004383311 2063 dbSNP
rs886073277 2064 dbSNP
rs1004970740 2066 dbSNP
rs1191440400 2072 dbSNP
rs1478828942 2073 dbSNP
rs1216260320 2076 dbSNP
rs1016209637 2083 dbSNP
rs962917463 2086 dbSNP
rs148576953 2093 dbSNP
rs35848623 2096 dbSNP
rs916183800 2099 dbSNP
rs1208052826 2101 dbSNP
rs970014895 2104 dbSNP
rs981467874 2110 dbSNP
rs145683875 2123 dbSNP
rs996013877 2124 dbSNP
rs1308988879 2128 dbSNP
rs934779316 2134 dbSNP
rs1379682550 2136 dbSNP
rs1335339358 2137 dbSNP
rs1445116395 2139 dbSNP
rs1358039477 2146 dbSNP
rs1053218366 2159 dbSNP
rs1415805787 2160 dbSNP
rs1029279621 2168 dbSNP
rs570413342 2169 dbSNP
rs1157768342 2172 dbSNP
rs1181751710 2173 dbSNP
rs1043597534 2180 dbSNP
rs946591615 2180 dbSNP
rs1238117463 2181 dbSNP
rs890287699 2181 dbSNP
rs899789485 2182 dbSNP
rs1351701579 2185 dbSNP
rs996451075 2186 dbSNP
rs537706450 2192 dbSNP
rs758186851 2194 dbSNP
rs1356327549 2196 dbSNP
rs1412293260 2208 dbSNP
rs1311075056 2231 dbSNP
rs550064151 2235 dbSNP
rs17462942 2236 dbSNP
rs867757372 2243 dbSNP
rs1302913166 2244 dbSNP
rs1449588943 2248 dbSNP
rs1206181040 2255 dbSNP
rs147129679 2256 dbSNP
rs979194237 2275 dbSNP
rs553888759 2288 dbSNP
rs1381914492 2292 dbSNP
rs1314385461 2302 dbSNP
rs572210527 2306 dbSNP
rs3750085 2307 dbSNP
rs1414455329 2316 dbSNP
rs1446688533 2329 dbSNP
rs959077272 2332 dbSNP
rs192433926 2333 dbSNP
rs1282303965 2345 dbSNP
rs991671058 2347 dbSNP
rs1487360886 2352 dbSNP
rs917383921 2357 dbSNP
rs1262689329 2360 dbSNP
rs1217578993 2361 dbSNP
rs1357655130 2363 dbSNP
rs1264034388 2369 dbSNP
rs898635656 2379 dbSNP
rs1322776583 2381 dbSNP
rs995684846 2382 dbSNP
rs1023207308 2391 dbSNP
rs1337730409 2397 dbSNP
rs950206123 2397 dbSNP
rs1240519234 2398 dbSNP
rs3750084 2399 dbSNP
rs1291510064 2400 dbSNP
rs1457232240 2404 dbSNP
rs1351305386 2408 dbSNP
rs1214697378 2409 dbSNP
rs1166865944 2430 dbSNP
rs1281034877 2434 dbSNP
rs544543764 2441 dbSNP
rs563218651 2443 dbSNP
rs1476821004 2447 dbSNP
rs908815128 2450 dbSNP
rs1422978012 2451 dbSNP
rs940353107 2459 dbSNP
rs1209522691 2461 dbSNP
rs1037803704 2462 dbSNP
rs956069851 2462 dbSNP
rs1209554813 2467 dbSNP
rs371673130 2468 dbSNP
rs1489030160 2479 dbSNP
rs7802977 2482 dbSNP
rs914677789 2486 dbSNP
rs946539100 2487 dbSNP
rs3750083 2488 dbSNP
rs1050139953 2491 dbSNP
rs1218718419 2494 dbSNP
rs1327774813 2495 dbSNP
rs1385970040 2499 dbSNP
rs1380055245 2500 dbSNP
rs890256585 2502 dbSNP
rs115268289 2505 dbSNP
rs1020139328 2510 dbSNP
rs903079887 2515 dbSNP
rs1399545155 2516 dbSNP
rs1000208841 2517 dbSNP
rs527830060 2521 dbSNP
rs932605865 2526 dbSNP
rs1331628358 2531 dbSNP
rs1051028461 2536 dbSNP
rs140287826 2537 dbSNP
rs1355842591 2538 dbSNP
rs905846065 2540 dbSNP
rs1177237960 2547 dbSNP
rs1330646279 2549 dbSNP
rs1374333023 2551 dbSNP
rs1236252496 2553 dbSNP
rs1276771956 2554 dbSNP
rs1457662535 2554 dbSNP
rs1375982265 2555 dbSNP
rs1491475377 2555 dbSNP
rs533341558 2555 dbSNP
rs756419257 2555 dbSNP
rs890746205 2556 dbSNP
rs1037159852 2557 dbSNP
rs1397126753 2557 dbSNP
rs898270170 2558 dbSNP
rs995653809 2558 dbSNP
rs1023176270 2559 dbSNP
rs1345984527 2559 dbSNP
rs1003088672 2560 dbSNP
rs1352674619 2560 dbSNP
rs868475107 2561 dbSNP
rs988859374 2561 dbSNP
rs368251965 2562 dbSNP
rs550398623 2562 dbSNP
rs112590384 2563 dbSNP
rs375773816 2563 dbSNP
rs67037834 2563 dbSNP
rs113949184 2564 dbSNP
rs67401065 2564 dbSNP
rs796937424 2564 dbSNP
rs1385638317 2565 dbSNP
rs375442109 2565 dbSNP
rs7384279 2565 dbSNP
rs115348624 2566 dbSNP
rs34422070 2566 dbSNP
rs1196224071 2567 dbSNP
rs868366502 2567 dbSNP
rs879010778 2567 dbSNP
rs1020553461 2568 dbSNP
rs1218933089 2569 dbSNP
rs1276578559 2570 dbSNP
rs1459186355 2571 dbSNP
rs1199791444 2572 dbSNP
rs1238130500 2574 dbSNP
rs1456680394 2576 dbSNP
rs59903390 2578 dbSNP
rs1195907613 2579 dbSNP
rs1309056002 2582 dbSNP
rs77780694 2586 dbSNP
rs184599434 2587 dbSNP
rs992016455 2589 dbSNP
rs1299317526 2594 dbSNP
rs1024381039 2596 dbSNP
rs971577929 2600 dbSNP
rs1313143215 2604 dbSNP
rs1436243326 2605 dbSNP
rs568377945 2606 dbSNP
rs982923134 2617 dbSNP
rs1420998199 2623 dbSNP
rs1419534222 2625 dbSNP
rs535095183 2632 dbSNP
rs1410089896 2635 dbSNP
rs547461889 2646 dbSNP
rs1465726278 2647 dbSNP
rs1169813900 2657 dbSNP
rs1398045399 2666 dbSNP
rs1472529184 2673 dbSNP
rs1258371484 2675 dbSNP
rs908805372 2685 dbSNP
rs1442745930 2689 dbSNP
rs1213265949 2692 dbSNP
rs987097913 2698 dbSNP
rs565681636 2699 dbSNP
rs1216958858 2702 dbSNP
rs1330365559 2702 dbSNP
rs1319189005 2704 dbSNP
rs539500542 2706 dbSNP
rs774697954 2710 dbSNP
rs1226077450 2714 dbSNP
rs557904071 2719 dbSNP
rs746155667 2720 dbSNP
rs1273340500 2724 dbSNP
rs1358235626 2726 dbSNP
rs1297291838 2727 dbSNP
rs1454142346 2735 dbSNP
rs1346855424 2736 dbSNP
rs1162564510 2742 dbSNP
rs931655643 2756 dbSNP
rs535289243 2761 dbSNP
rs1257908833 2762 dbSNP
rs1316596091 2766 dbSNP
rs1212220526 2786 dbSNP
rs1476923856 2803 dbSNP
rs577339366 2806 dbSNP
rs944556181 2809 dbSNP
rs1487071553 2810 dbSNP
rs1264093662 2825 dbSNP
rs1221442798 2828 dbSNP
rs187474576 2834 dbSNP
rs556566037 2852 dbSNP
rs1234609706 2855 dbSNP
rs1337900676 2859 dbSNP
rs1294446864 2861 dbSNP
rs1382477809 2865 dbSNP
rs1363793881 2867 dbSNP
rs1264912925 2868 dbSNP
rs906008724 2872 dbSNP
rs1491401307 2873 dbSNP
rs1167118140 2876 dbSNP
rs1464149744 2877 dbSNP
rs1423131057 2899 dbSNP
rs1430568982 2901 dbSNP
rs1477830164 2901 dbSNP
rs867683050 2906 dbSNP
rs575120445 2917 dbSNP
rs1265690076 2924 dbSNP
rs1191047607 2931 dbSNP
rs11439830 2938 dbSNP
rs1255468371 2938 dbSNP
rs1214972928 2946 dbSNP
rs903103090 2949 dbSNP
rs1315497044 2951 dbSNP
rs1250321543 2952 dbSNP
rs1227691363 2954 dbSNP
rs1308964212 2956 dbSNP
rs1462939970 2967 dbSNP
rs541820403 2976 dbSNP
rs1371575967 2979 dbSNP
rs1389715109 2981 dbSNP
rs1444521642 2986 dbSNP
rs1054370376 2987 dbSNP
rs560070866 2996 dbSNP
rs1403431886 3005 dbSNP
rs1321770024 3012 dbSNP
rs369020374 3013 dbSNP
rs1395832352 3017 dbSNP
rs1298876601 3022 dbSNP
rs1463716950 3023 dbSNP
rs1057502045 3025 dbSNP
rs1342621652 3027 dbSNP
rs892071549 3036 dbSNP
rs1455005308 3046 dbSNP
rs1397317373 3049 dbSNP
rs1461761770 3050 dbSNP
rs1010651581 3052 dbSNP
rs375205283 3052 dbSNP
rs1249209091 3056 dbSNP
rs1277637481 3075 dbSNP
rs1021663085 3076 dbSNP
rs968699865 3080 dbSNP
rs1029051244 3082 dbSNP
rs996176119 3082 dbSNP
rs1348283896 3083 dbSNP
rs953849841 3084 dbSNP
rs772426740 3086 dbSNP
rs373379177 3088 dbSNP
rs1356040644 3089 dbSNP
rs1208446723 3092 dbSNP
rs1287634750 3094 dbSNP
rs545862996 3097 dbSNP
rs201885486 3104 dbSNP
rs1377636713 3109 dbSNP
rs1215519417 3110 dbSNP
rs116507088 3111 dbSNP
rs1004389592 3112 dbSNP
rs1425085742 3115 dbSNP
rs549988430 3116 dbSNP
rs1420391678 3124 dbSNP
rs1253517986 3137 dbSNP
rs1367838659 3140 dbSNP
rs2290218 3144 dbSNP
rs1485828775 3150 dbSNP
rs761122159 3152 dbSNP
rs962904905 3156 dbSNP
rs974761870 3168 dbSNP
rs1361001729 3173 dbSNP
rs1214183225 3179 dbSNP
rs1349805501 3183 dbSNP
rs1261271322 3184 dbSNP
rs1420522663 3186 dbSNP
rs1241146672 3187 dbSNP
rs192763985 3188 dbSNP
rs921508649 3192 dbSNP
rs1297872177 3194 dbSNP
rs1415619793 3210 dbSNP
rs953181688 3223 dbSNP
rs1358668656 3226 dbSNP
rs1397890753 3227 dbSNP
rs927058718 3229 dbSNP
rs1313991445 3231 dbSNP
rs1340403942 3243 dbSNP
rs1400519156 3259 dbSNP
rs2290219 3263 dbSNP
rs1456887314 3266 dbSNP
rs1186687056 3278 dbSNP
rs565646779 3278 dbSNP
rs1057342808 3283 dbSNP
rs1259196564 3302 dbSNP
rs1190708137 3304 dbSNP
rs1446180289 3305 dbSNP
rs911650477 3307 dbSNP
rs777245476 3309 dbSNP
rs373490336 3315 dbSNP
rs1041445385 3318 dbSNP
rs924472749 3321 dbSNP
rs1215405379 3326 dbSNP
rs1206808042 3338 dbSNP
rs1010455774 3339 dbSNP
rs376618148 3345 dbSNP
rs1272548597 3352 dbSNP
rs904507372 3354 dbSNP
rs1337156530 3357 dbSNP
rs532980366 3365 dbSNP
rs1483920734 3367 dbSNP
rs184883468 3368 dbSNP
rs1430333112 3374 dbSNP
rs894366677 3375 dbSNP
rs569769458 3378 dbSNP
rs1320759589 3379 dbSNP
rs1255300144 3380 dbSNP
rs1385592029 3382 dbSNP
rs1394402837 3392 dbSNP
rs151163947 3397 dbSNP
rs1163509078 3415 dbSNP
rs1461537161 3418 dbSNP
rs1419439430 3421 dbSNP
rs1165769875 3424 dbSNP
rs1474910083 3426 dbSNP
rs2392078 3439 dbSNP
rs1195062938 3440 dbSNP
rs1467035682 3444 dbSNP
rs764795320 3445 dbSNP
rs1214361190 3451 dbSNP
rs907202495 3452 dbSNP
rs1256294817 3457 dbSNP
rs1180491074 3464 dbSNP
rs1340404550 3472 dbSNP
rs1272226275 3477 dbSNP
rs954815979 3493 dbSNP
rs1370845144 3495 dbSNP
rs1327127135 3497 dbSNP
rs879793395 3498 dbSNP
rs1004337067 3499 dbSNP
rs1015667430 3500 dbSNP
rs6947444 3504 dbSNP
rs1362303598 3513 dbSNP
rs535713972 3525 dbSNP
rs1326356319 3526 dbSNP
rs1408938049 3527 dbSNP
rs1019477141 3547 dbSNP
rs376191451 3561 dbSNP
rs1029006531 3566 dbSNP
rs1452372238 3574 dbSNP
rs201972506 3580 dbSNP
rs1194165586 3587 dbSNP
rs1469815355 3591 dbSNP
rs1231248832 3614 dbSNP
rs1203921993 3615 dbSNP
rs1438553839 3618 dbSNP
rs972654246 3620 dbSNP
rs1303495580 3629 dbSNP
rs575576036 3633 dbSNP
rs1304699933 3634 dbSNP
rs919854745 3639 dbSNP
rs1237133539 3640 dbSNP
rs4345468 3646 dbSNP
rs1375330960 3649 dbSNP
rs1401662296 3652 dbSNP
rs1277202426 3653 dbSNP
rs952345712 3663 dbSNP
rs954262295 3664 dbSNP
rs377652413 3665 dbSNP
rs577597983 3667 dbSNP
rs1334003290 3668 dbSNP
rs1330442031 3682 dbSNP
rs1432537002 3685 dbSNP
rs751924618 3698 dbSNP
rs1374615018 3699 dbSNP
rs1378065121 3704 dbSNP
rs985762778 3714 dbSNP
rs1455482741 3721 dbSNP
rs911596532 3722 dbSNP
rs117337952 3728 dbSNP
rs977169315 3744 dbSNP
rs1233601994 3748 dbSNP
rs924365165 3749 dbSNP
rs1254886859 3754 dbSNP
rs1342321254 3770 dbSNP
rs935849787 3773 dbSNP
rs1238748302 3774 dbSNP
rs572084050 3778 dbSNP
rs114668312 3779 dbSNP
rs1373406102 3784 dbSNP
rs1289745897 3803 dbSNP
rs1043258502 3806 dbSNP
rs1354436882 3807 dbSNP
rs904810348 3817 dbSNP
rs560259706 3823 dbSNP
rs557959952 3831 dbSNP
rs1177121524 3832 dbSNP
rs948576703 3836 dbSNP
rs1377112179 3841 dbSNP
rs1401274050 3848 dbSNP
rs140232920 3852 dbSNP
rs1045671651 3857 dbSNP
rs1050425348 3858 dbSNP
rs1258511901 3860 dbSNP
rs1190459584 3862 dbSNP
rs1485077693 3873 dbSNP
rs1241950655 3876 dbSNP
rs780966578 3879 dbSNP
rs907233608 3884 dbSNP
rs370533628 3886 dbSNP
rs748170103 3892 dbSNP
rs1401685414 3893 dbSNP
rs1037542449 3899 dbSNP
rs1269410755 3903 dbSNP
rs898552851 3905 dbSNP
rs1230939315 3910 dbSNP
rs1446416686 3919 dbSNP
rs1008948675 3920 dbSNP
rs1370248420 3923 dbSNP
rs1015424041 3924 dbSNP
rs1397459764 3926 dbSNP
rs896959152 3929 dbSNP
rs1288137724 3948 dbSNP
rs1386965584 3950 dbSNP
rs1431299316 3954 dbSNP
rs996087799 3967 dbSNP
rs1028452985 3968 dbSNP
rs543555631 4000 dbSNP
rs527384431 4002 dbSNP
rs1008467973 4006 dbSNP
rs1167339365 4008 dbSNP
rs1019810470 4019 dbSNP
rs1427025310 4030 dbSNP
rs372833795 4031 dbSNP
rs977089938 4037 dbSNP
rs1487105225 4038 dbSNP
rs1031849473 4041 dbSNP
rs1317219848 4047 dbSNP
rs1467613668 4050 dbSNP
rs959979716 4056 dbSNP
rs115761494 4062 dbSNP
rs879541938 4073 dbSNP
rs1305406615 4080 dbSNP
rs1294512578 4081 dbSNP
rs1420526702 4085 dbSNP
rs990389532 4089 dbSNP
rs189345652 4090 dbSNP
rs912984645 4097 dbSNP
rs946220880 4100 dbSNP
rs1440138652 4105 dbSNP
rs978920383 4109 dbSNP
rs1295434933 4112 dbSNP
rs1372737835 4119 dbSNP
rs926205731 4119 dbSNP
rs915782296 4121 dbSNP
rs779068918 4122 dbSNP
rs932270021 4127 dbSNP
rs1430698169 4129 dbSNP
rs1393699888 4135 dbSNP
rs1191955155 4136 dbSNP
rs1193535891 4142 dbSNP
rs948524545 4144 dbSNP
rs1253007834 4151 dbSNP
rs1211123682 4160 dbSNP
rs1479425348 4162 dbSNP
rs180897979 4163 dbSNP
rs183518909 4169 dbSNP
rs1036436352 4170 dbSNP
rs1479466121 4174 dbSNP
rs1195934733 4175 dbSNP
rs1424501362 4177 dbSNP
rs1465548867 4179 dbSNP
rs1389772350 4191 dbSNP
rs928514010 4197 dbSNP
rs1395993779 4199 dbSNP
rs1298932171 4208 dbSNP
rs940017814 4214 dbSNP
rs1374013419 4215 dbSNP
rs1173409951 4228 dbSNP
rs745957558 4229 dbSNP
rs149922490 4235 dbSNP
rs1397451974 4236 dbSNP
rs1200319249 4243 dbSNP
rs898577289 4246 dbSNP
rs1458762007 4248 dbSNP
rs931454526 4253 dbSNP
rs1050263832 4254 dbSNP
rs1277847547 4260 dbSNP
rs888290408 4263 dbSNP
rs889980729 4267 dbSNP
rs532942007 4269 dbSNP
rs775811434 4277 dbSNP
rs1257721183 4278 dbSNP
rs1001414976 4280 dbSNP
rs1335226113 4295 dbSNP
rs1034699787 4302 dbSNP
rs1411825714 4303 dbSNP
rs1353811092 4323 dbSNP
rs1312601803 4331 dbSNP
rs551399095 4336 dbSNP
rs1404845532 4338 dbSNP
rs1216691099 4340 dbSNP
rs1453743458 4352 dbSNP
rs569649170 4358 dbSNP
rs577889550 4371 dbSNP
rs1220578653 4373 dbSNP
rs530583536 4374 dbSNP
rs1265020009 4383 dbSNP
rs1159268631 4386 dbSNP
rs1473337000 4392 dbSNP
rs1254992713 4399 dbSNP
rs1186912865 4402 dbSNP
rs1258068107 4415 dbSNP
rs1485858957 4415 dbSNP
rs1203302641 4422 dbSNP
rs1489918582 4429 dbSNP
rs1219140395 4433 dbSNP
rs763722865 4441 dbSNP
rs1261325212 4470 dbSNP
rs548816575 4476 dbSNP
rs992930892 4484 dbSNP
rs1415673477 4485 dbSNP
rs1342619857 4496 dbSNP
rs1020011398 4498 dbSNP
rs967569625 4500 dbSNP
rs1386335861 4501 dbSNP
rs1320588404 4507 dbSNP
rs1477558136 4520 dbSNP
rs1163732677 4526 dbSNP
rs747314628 4534 dbSNP
rs796154805 4536 dbSNP
rs978891386 4541 dbSNP
rs926088929 4542 dbSNP
rs1248601365 4544 dbSNP
rs998933122 4551 dbSNP
rs1031293672 4553 dbSNP
rs957256403 4554 dbSNP
rs1272682487 4555 dbSNP
rs1234122398 4560 dbSNP
rs1358740650 4564 dbSNP
rs1268729859 4573 dbSNP
rs1424700603 4579 dbSNP
rs986321846 4581 dbSNP
rs989947041 4583 dbSNP
rs1300410047 4585 dbSNP
rs1186793397 4588 dbSNP
rs11555148 4602 dbSNP
rs76460581 4614 dbSNP
rs912160778 4619 dbSNP
rs1324714666 4621 dbSNP
rs944705984 4627 dbSNP
rs1164524185 4642 dbSNP
rs1022705101 4643 dbSNP
rs756770057 4644 dbSNP
rs1421118238 4646 dbSNP
rs1298475261 4651 dbSNP
rs373895063 4651 dbSNP
rs1359308337 4655 dbSNP
rs969899712 4670 dbSNP
rs373908905 4672 dbSNP
rs1452576316 4675 dbSNP
rs1252376490 4686 dbSNP
rs919342127 4688 dbSNP
rs1453495851 4690 dbSNP
rs1271191134 4691 dbSNP
rs1195488546 4695 dbSNP
rs535676912 4702 dbSNP
rs1227733921 4716 dbSNP
rs961280262 4721 dbSNP
rs554026654 4722 dbSNP
rs973059154 4731 dbSNP
rs1355644968 4746 dbSNP
rs566069985 4756 dbSNP
rs1001383852 4758 dbSNP
rs1055700787 4794 dbSNP
rs895743628 4797 dbSNP
rs1013916913 4804 dbSNP
rs1370929984 4811 dbSNP
rs1170255883 4813 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUA-AUACACGACGAu 5'
                |::| |:| ||||||| 
Target 5' --ucccCUGUCUGUCUGCUGCUc 3'
1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUA-AUACACGACGAu 5'
                |::| |:| ||||||| 
Target 5' ugucccCUGUCUGUCUGCUGCUc 3'
1 - 23
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000318709.4 | 3UTR | uccccugucugucugcugcuccc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000318709.4 | 3UTR | uccccugucugucugcugcuccc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000318709.4 | 3UTR | uguccccugucugucugcugcucccag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.7 3.0e-4 0.782 2.3e-5 20 Click to see details
GSE21687 Ependynoma primary tumors -0.31 6.3e-3 -0.284 1.1e-2 64 Click to see details
GSE38226 Liver fibrosis 0.43 2.6e-2 0.208 1.8e-1 21 Click to see details
GSE28260 Renal cortex and medulla -0.495 4.3e-2 -0.456 5.9e-2 13 Click to see details
GSE32688 Pancreatic cancer 0.239 9.4e-2 0.102 2.9e-1 32 Click to see details
GSE27834 Pluripotent stem cells -0.331 1.1e-1 -0.356 8.8e-2 16 Click to see details
GSE42095 Differentiated embryonic stem cells -0.22 1.6e-1 -0.308 7.6e-2 23 Click to see details
GSE28544 Breast cancer -0.187 1.9e-1 -0.520 4.6e-3 24 Click to see details
GSE14794 Lymphoblastoid cells 0.093 1.9e-1 0.099 1.8e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.128 2.7e-1 0.262 1.0e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.119 2.9e-1 -0.142 2.5e-1 24 Click to see details
GSE21849 B cell lymphoma 0.096 3.1e-1 0.265 8.2e-2 29 Click to see details
GSE19350 CNS germ cell tumors 0.151 3.2e-1 0.042 4.5e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.093 3.3e-1 0.177 2.0e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.092 3.5e-1 -0.147 2.7e-1 20 Click to see details
GSE17306 Multiple myeloma -0.051 3.6e-1 -0.087 2.8e-1 49 Click to see details
GSE21032 Prostate cancer 0.028 4.0e-1 0.018 4.4e-1 83 Click to see details
GSE19783 ER- ER- breast cancer 0.025 4.1e-1 0.005 4.8e-1 79 Click to see details
GSE19536 Breast cancer -0.003 4.9e-1 -0.038 3.5e-1 100 Click to see details
GSE19536 Breast cancer -0.003 4.9e-1 -0.038 3.5e-1 100 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.447 0.01 0.484 0 32 Click to see details
LUSC -0.399 0.01 -0.387 0.01 38 Click to see details
CHOL -0.613 0.04 -0.417 0.13 9 Click to see details
THCA -0.221 0.05 -0.274 0.02 59 Click to see details
COAD 0.582 0.07 0.310 0.23 8 Click to see details
LUAD 0.436 0.08 0.322 0.15 12 Click to see details
KIRP -0.251 0.08 -0.331 0.03 32 Click to see details
HNSC 0.18 0.13 0.102 0.26 42 Click to see details
PAAD 0.63 0.19 0.400 0.3 4 Click to see details
ESCA 0.272 0.21 0.036 0.46 11 Click to see details
PRAD 0.111 0.22 0.093 0.26 50 Click to see details
BLCA -0.173 0.25 -0.071 0.39 18 Click to see details
LIHC 0.086 0.28 0.119 0.21 49 Click to see details
PCPG -0.56 0.31 -0.500 0.33 3 Click to see details
CESC 0.49 0.34 0.500 0.33 3 Click to see details
BRCA -0.046 0.34 -0.060 0.29 84 Click to see details
KIRC 0.026 0.42 -0.036 0.39 68 Click to see details
UCEC 0.035 0.44 -0.054 0.41 19 Click to see details
KICH 0.013 0.48 0.103 0.31 25 Click to see details
KICH 0.013 0.48 0.103 0.31 25 Click to see details
KICH 0.013 0.48 0.103 0.31 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1