miRTarBase - #MIRT482581 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ABHD2   
Synonyms HS1-2, LABH2, PHPS1-2
Description abhydrolase domain containing 2
Transcript NM_007011   
Other Transcripts NM_152924   
Expression
Putative miRNA Targets on ABHD2
3'UTR of ABHD2
(miRNA target sites are highlighted)
>ABHD2|NM_007011|3'UTR
   1 GGCCTCCGGACTCTGGCACGCTCCAGCAGCCCTCCTCTGGAAGCTGCGTCCCCTCACCCCCTGTTTCAGGTCTCCCATCT
  81 CCCTCAGTGACCTGGATCTGACCTCACACCATCAGCAGGGGGCACCCACCATGCACACCTGTCTCGGAGTAGGCAGCTCT
 161 TCCTGGGAGCTCCAGGCTATTTTTGTGCTTAGTTACTGGTTTTCTCCATTGCATTGTTAGGCATGGTGACAAGTGACAGA
 241 GTTCTTGCCCTCTGTCCAGTTTCAGCATCTGGTTGCTTTTAAGCCAAGTACATCTAGTTTCCCTATTAAAAATGTGTCTG
 321 AATAGCGATTTTGCTTTGCCACCAAAAGGCTTTTCCCTGAGAACAGTGAAGGATGTATGTCATTTTGTGGTGGTTGTATG
 401 TGTCCTTACATAGACCTTAAAAAGAGCTCACCCTTCCAGGCCAATGCTGAAGACACAGCTCCGCTTGGGAGCCTGAGAAC
 481 CCAGGCTTCCCAGGCCAGAGTGTGGCTTCTTAAACGGCAAAGGAAATTCCTTTGAGTCACAAGCCAAGTTTTCGCCCTGT
 561 CTCCTGAGACCATTTCCCTACGCTTTGCTGCTGCTGAGAGTTACGTGAGGCACTTGTTAAAAATTCAGCCTCCCAGGTCC
 641 CTCCCCTCGGAGAGGCTGATTCACTGGGTCTGGGAAGGAGCCTGGGGATTTTAATTTTTCACAAGTGCCCCAGATGATTC
 721 TCATCACCAAGCAAATTTTGGAAATGCTGTTCAACAGCGCCCTTAAATTGGAAACATCTTTGCAGCTCGTTTTATTGAAA
 801 TTCATAATCAGGGGTGTCCTCTAGCTCCCACGGTCTCCAGAGCAGCAAGGCCGGCTATGGAGCTGCCGTCGTGTGACCAC
 881 AGTGTGATGTCTCAGAAGGGCTCTGGGTGGGCTGAGCATCTGGGCTGTGCCCTGGCTCTGCTTTTCACCCTGGACAAAGT
 961 CGCTGTGGACTTCAATTTCTTCACCTCTAAAATGGGGGACTTGGACCAGGTAGATTGCTGAGCTCACTACCAGGTTCAAA
1041 GTTCAATGACAAACTCAGTTTACTGAGGTTTGAGAGAACATCCCTCCAGGGGAGCCTGGGAGCTGCTCTCCCAGTCTAAG
1121 CATGTAGATATCATCGTTTGCCTTTTGTGTGTGTGTGTCCCTTATTTGATAAAAAGATGTTTTGAGTTGTTTTTTTTTTA
1201 AGCACTCACTTGTAATTTTAGTTTTTAAACCCAAGTCCCTCTAACTTTGCCTTTGATACCAAACAATTCAAAAGTTGGAT
1281 CTGAGTTTGGAGAAAGATATTTCCAACCTAAGTGGGTATTATTTTGAAACCAGATTTTTAATTTAATAGCCTATATTTGT
1361 AGTCTGTTGGATAGGTGTTTCCAAAGTGTGTCTTCTCAAGTGAAAACGCAACTCTAGGTTTCAAGTACTCCTTTTCTCCG
1441 ATCCTGTGGTACTTGAATATCCAAAAACCCTGCACTTTGAACAATCAGCTGTTGCTATCTGGAACTAAACAGAACTATGA
1521 GTAAAATTGCCTGGATACTTTAAAAAGATATTTTTCCTCCTTCATCTCCTTTGACTCCAGGACAGACTGGAATATAAGTA
1601 GTGGGTCTGCATGGATGTTTCAGGGATCAAAGGAGCCACCTGGGCGCCTGAGTGCCAACCCTCAGGGCCACAGGTGGGTG
1681 TGGTTTGGGCACGGGTCCAAGTGACTGTGACGGGACCCGTGGGCATGGGTCCAGGTCTGTAACCTGAAGAAGTTGTTTTC
1761 TGACAATCACCAAATCATCCGAATGACATCAAAAGCAGCCCTTATCTCAGAGACTGAGATTTCTGTGGTCTCAACTTCGC
1841 TTTGGTATAATTTCTGGCACTCACCAGCCTCTATCATTATGACTTTCCCCCCAGTGTATTATTTCTCTAATAGGTTTCCT
1921 TTTCACGTTCTTTTAGCACAGACTGGCACTTTACCCTCTCAGTTTGGAAGTTAGCCCCTCTCCTCTGTTACTTTTCCCTT
2001 CACCCAACTACAGCTGTGATCTAGAACATTCATAGTCATATTTCTGCTACTACTACCTTCATTTATCAAGACTTTTTATG
2081 AGAATAGGTAAACCAAGCAATAACTTCCTAGGACTGAATCACCACCCCAGAAGAGCGAGAGGCTCCTTTCATATGCCTGA
2161 GGCCACACCCCTTAACCTGTTCTGACAAAATAGTGGCTGGCCCATGTACCAGCTCCATTCAGAAATTCAGGAAGAGAAAA
2241 GACAGCCCTGTTGTCACACAAACCGGTGTGGGGGAGGGTGGAGCCTGGTCTGCACGGCAGTCCTGGTGGCCCCTGTGGAG
2321 GACAGGCAGGGCTGGCAGCATAGCCTTTGTTGCCACACAACCGGAATTTGCTCCCCCAGGACTGTGGGAGCCAGTGTCCC
2401 AGCTGAAATCTTTTTAGTGTGTGGCTCTGAATGGCACTCACATTCCATTTTGGCTCACATGAAACTAACTGAAGCCCTTT
2481 GTTCAAGCTTCAGGCTCTTAGGCATGGAAATGAGAATGTGACTGTGGCTGTCTTACAGGAAAATTCTTGTTTGTCCCTGA
2561 ATGAGAGCACAGAGGCATTGAATTCACAGAGCTGCAAACTTGCCTGATAAATGAGGGAGTGGCAGTTTATAGATAGGTCA
2641 TCTTTTTTCCTTCCTCCAGGTGTCCTTGCCTTTCTTCCCAAAGTCATTCATTTCTGATGAGTATATGAATCCCCCTCTTG
2721 CTAGTAAGGTTCTATTTGGGCTAAAACAAGGCTGAATTTTTAAAGAGTATTTGAATATATTTTAGAATCAAATTGAGGCT
2801 ATAAATTGCATCAATCTGGACAATTCCATTGCAGGAATAATATGTTAAAAACCAATGGGGAGAAGCACCCACATCTCTCC
2881 TGTAGCACTCCGTGTCTCATAAGCAATTTGAAGACACTTACAAGTAACTGATTCCAGTCAAATTAGGATTAACTGACTCA
2961 AAAAATGGTGTCAAGTTTCTTTAATGTTTTTATGTTAGAAGTGAGTTTAACAGACTTGAAGAAAACTGTTATCTTTTCCT
3041 GCTGTGAGTTTACACAAATGATTCCAGAGCAGAATGAAAGCAGAAAGCTGTTGGTTACAATATTCTTTTAACCTCTCTGC
3121 AGCATTTTACACTTACTGGGAACCTTATGATTCACCGTAAGAGTGGAAATATACCTGAGTTCGTGTCCTAATGGTCTCTA
3201 ATTCACATTGGATCGTGGGCAAATCACCTCACCTCTCTGAGCCTGTTCCCTCCTCTTAGACCATCTCTAAGACCACTTCA
3281 TCTATTTACACATCATTTGCTTGAACATTGCTGAACATCTGCGTGAACTTGGCCTCTCCAGCCCTTGCAGGTGGAAACAG
3361 CTGTGTCAAGGCTCAAGGCTCACGCTGAGGGGACTTGGAGGGAGGGGGCTTCTGCATTAAGCTTTCCTGGTGAAGACCCT
3441 TGATCTTGTCCAAAGCCCTGTGTCTTTGACTGGCTTCTCTTCAGAGTCCCCGTTGTCATCGTAAGACCCTTGCTGTTTGG
3521 AGGGTGGTCTTGTGACTGTGGCAGCTGCTGGCCGCTGGAATGAGGAGCCTATCTCCATCCTCCAGTGTGACTCAGGCAGA
3601 GCATTGAGAATTCCCAGGGCAGAAATCCTTCCTGCTCAGGCTTTCATTCTAAAACTACAGTCTTCATTAAAGCTGAACTT
3681 TCTGGGTAGCTGAGCTTATATGCCCGGCATCTGAATGAGAGCTCTCTTTGTAACTGTGTGACTTGAGATCTAGTTTGCCA
3761 GCTCCTGGGAAACAATACATGTGTTCTTGTTTGTGTTTGCTCAGCAAGCAGATGTCTGAGATGTAAGAAGCTTTTCTTTT
3841 CCTGTGGCATTGATTCTGACTTAGAGCTGAAGTAAAAGATCACTGAAACATCACGTCAAGTTGAAGTCACTCATAGGTCT
3921 TTGTCCTTTAGGCAGGACAGGAGAGTCATTAAGAAGCATTTCACTGTAGCATTCTATCACAATATCATCTGGAATTGTTT
4001 TCTTTGCCCAGAAAGCCTTAACTTGCCTCTAGAGAATCCCTGGTATTACAACGATATTGCGGCATTAGAATTCCAACTCT
4081 TCTGCTGTGGAAGTTTGAAGCGAAGCTGCAGCAAAACCAGAGAATTTCCTCAAGTGGCCTGTAGGCTCCTTGTTATCTTA
4161 TGCCCCCACCCCTCCCTCAACAATATGAGTGATCCAGAACTGGCCCAAACACCTCAGCTCTGGTCCCTTTTTGCCCTTCT
4241 TGGCCTTACTCTGTTGTTCAAAGCCACTTTGGATTGCTTGGATGCTTCGAACAGCCATGAAAAGTAGCCTGCCTGTGGCA
4321 TTTAGAGGCCAAGCAATTGACAGAAAGGGTTTCTTCTACCTCTGTTATCTAAGCAGAGGGAAGTAAACCTCTCACCGCCC
4401 CCCACCCCTCACTGCCCCCGATTACCCTAGAATTGCTTTCGCCAAATTGTAGTTGAAGCTAAGGAAGGGGAATCTGGCCC
4481 CTGCTGGGAGAGGGAACTGGAATGCCACACAAGGCAAGGCCTGCTTCCTTCCTTCCCCTCTGCTGCTGCTGCCTCGGAAC
4561 GCTGCAGCCCAGGCTTCCTCCCACAGTGGCCCTTGGAAGCAGGCCGCAGAGTAGACAGCTGCTCCTTTTGGAAGAGTCAG
4641 TCCCCTGTGTTTTCTGAACTGTTTTTCCTAGCATGTATGTGGGTAGAGCTTTCATGCATCTCTAGTAATAATAAGCTGAA
4721 ATTAGTTTTTTTTTTAATTCTCCAATTTAAAACTTTTAATTAAAAAGTAAATTTTAATGTCGAAAATGCAAACTTGGGGA
4801 GGGCAGAAAGATCACACACAAGGCTGTCACTTCATACTTGCAGGATTGCACAGCAGCCGGGCAGAGGCGCTCCTCACTTC
4881 CCAGATGGGGCGGCGGGCAGCAGAGACGCACCTCACTTCCTAGACAGTGCGGCAGCCAGGCACAGGCACACCTCACTTCC
4961 CAGACAGTTGGGCGGCCAGGCAAGCGCTCCTCACTTCCCAGATGGGGCGGCTCCCGGGAAGCGGGGCTCCTCACTTCCCA
5041 GACAGGGTGGCCAGGCAGAGGTGCTCCTCACTTCCCAGAACAATTCTTTATGAATTTGATAAAGGACTGAAGTGCAACTG
5121 AAAGCTGCTAGTGATGATCTGGTAATATACAATTTGTCCAGTAGCCAGTTTGTTTTTATTGTGTTTTCTAACCATAAGAG
5201 ATCATTAAAGGCAAAGCCTGTATGACGCTGTACACACACAAAAAAATGGTCACCGCAGGCCATACTACCAATGAAATGGT
5281 AGGTAAACAAATCTTCTGGTCAAGAGAAAAAAAAAAGAAATAGCACTCTGCATGCTTTGCTCTACAAGACGAATTTCCCT
5361 AGAAAGAATCCAATGAAGGCCGGGCATAGTGGCTCACTCCTGTAATCCCAGCACTTTGGAGGCCGAGGCGGGTAGATCAC
5441 CTGAGGTTAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACCCCTTCTCTACTAAAAATGCAAAAATTAGCTGGGTG
5521 TGGTGGCGGGCGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGTGGGAGAATTGCTTGAACCCAGGAGACGGAGGTTGCA
5601 GTGAGCCGAGATCACGCCTCTGCACTCCAGCCTGGGCAACAAGAGTGAGACTCCGTCTCCAAAAAAAGAAAAGGAATCCA
5681 GTGAAAATGGCTGCAATTACAACAAGAAGTGAAGGAAGAAGACTGGTGACATCTCTGAAGGATGCAGTTGAGGTTGATCC
5761 AGGTTTATCCGAATATGCTACCTTTCTGAGCCTTAAACCTTCATCTCTCAGGTGTTGATTTGCTTCTGATAGCTTCATCA
5841 TTTCTCCCTGAAGTCTTTTACACTCTTCTGTTAGTTTCCTTGTTTCAGTATCATGAAGTGAAGCACTGTGTGGTTGTGGC
5921 GTGGGCCCGTCTTGCTTAGATGCATTCAGTGGGACAGCTTTGCTGGGTTCCATGTCATTCAATTTATCATTTTCATTGGG
6001 GATCTCCATTTGGAATCCATTAATTCATGAGGTTTTGCCTCATTCCACACAGCTTCCATATCTGAAGTGTTTAGTGGAGC
6081 AAAAATTGTACCATAAACTTGTGTTTACTCTTTTCATTCGGATCATAGTCAAAGGGCTGTAGCATTACTGAAACAGTCAC
6161 AGTTGACCCTGGGTCAATAATTCCACTGTTGGGCCTCACACAGTACCGGTGAGGCACGGTAGTCTTCACTTTGAAACACA
6241 CTTTTCTATCCGATGGATTTCGCAATTTAAGATTTGTAGTGACTACATCTGTGAAGGGGCCTTTGAATTTGAGGTCTATG
6321 GGCGGGTCGAGGACCAGGATCTGCTCGTGCTTCGCCGTGGCCCCGGAGGCAGACGCCATTGGAGAGACAGCGCAGAGCAG
6401 GGGGCGGCTTGCTCGCTGGGGGCGGGGGACGATGGCGAGAGGGGAGGGGGAGCGAGTTCGCATCTCTCCTTTTCCTGGTT
6481 AGACTCTGTTCAACCACATTCTTATGTTGGCAGATCTGCTTCCAGATTGATTTTTAGAGCACCATCACTTTCACATTCCT
6561 GATTCTGATTTTGTTTTGTTTTGTTTGGGTTTTCTGAAACTTAAAATGCTGCCCCGAAAATACTATATTTTTGAGTTTGT
6641 GTTCTGAAAGCCTCCGTGCTGCTGGATCTTTGGGGGGAAATACAGGATCCTTCAGCACTGAGGTGTTTAAGATTTGCAAC
6721 TAGCAATGCAATTTTTTCTAAATATGGGGATATTTACCTTTATTAAGAAATTATACTAAACATTGATGTCCTTGATCATT
6801 TTATGTTCTCATATTACTTTTGATTCTACTATGATTGTGTGGTGGTGAACAAAGATCATTACAAACAAAAACTGTAATTT
6881 TGTTATATTTGATTCAATGGAATTTACCTAAAAAATAAAGACTAAAAATGTGGTGTGAAAAAAAAAAAAAAAAAAAAAAA
6961 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUA-----AU---ACACGACGAu 5'
             |:|||||     ||   | ||||||| 
Target 5' ctgAGACCATTTCCCTACGCTTTGCTGCTg 3'
564 - 593 155.00 -15.44
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||:||  |  |||||||| 
Target 5' tgaAAGCC--TCCGTGCTGCTg 3'
6645 - 6664 155.00 -16.70
3
miRNA  3' guguuuGGUAAUAC-ACGACGAu 5'
                ||  | || ||||||| 
Target 5' ttccttCCCCTCTGCTGCTGCTg 3'
4529 - 4551 148.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13646276 20 COSMIC
COSN30190859 21 COSMIC
COSN31594578 21 COSMIC
COSN26578238 36 COSMIC
COSN30110009 42 COSMIC
COSN13646277 60 COSMIC
COSN30489537 61 COSMIC
COSN29468126 62 COSMIC
COSN30105221 81 COSMIC
COSN1181708 287 COSMIC
COSN31591528 459 COSMIC
COSN22443597 472 COSMIC
COSN31582449 478 COSMIC
COSN31514641 516 COSMIC
COSN31532740 627 COSMIC
COSN31555466 650 COSMIC
COSN29530224 1200 COSMIC
COSN30545377 1279 COSMIC
COSN31527969 1364 COSMIC
COSN31488270 1398 COSMIC
COSN31527756 1437 COSMIC
COSN5865403 1557 COSMIC
COSN31490197 1564 COSMIC
COSN31549332 1646 COSMIC
COSN28673644 1720 COSMIC
COSN28674518 1731 COSMIC
COSN31568060 1750 COSMIC
COSN26634561 1816 COSMIC
COSN31548053 1819 COSMIC
COSN31489940 1835 COSMIC
COSN31602789 1889 COSMIC
COSN19041239 2202 COSMIC
COSN9640914 2218 COSMIC
COSN27275319 2257 COSMIC
COSN21590800 3038 COSMIC
COSN23710511 3368 COSMIC
COSN29326876 3572 COSMIC
COSN1688431 3669 COSMIC
COSN20112363 3878 COSMIC
COSN31610519 3916 COSMIC
COSN5402611 4034 COSMIC
COSN20165120 4071 COSMIC
COSN31579539 4077 COSMIC
COSN31541546 4080 COSMIC
COSN27745339 4146 COSMIC
COSN31512880 4204 COSMIC
COSN1688432 4248 COSMIC
COSN23987773 4390 COSMIC
COSN31959437 4390 COSMIC
COSN31571430 4514 COSMIC
COSN25785679 4743 COSMIC
COSN31486589 4993 COSMIC
COSN31490689 5059 COSMIC
COSN20112369 5119 COSMIC
COSN27113723 5137 COSMIC
COSN8590608 5153 COSMIC
COSN31608482 5155 COSMIC
COSN31531885 5214 COSMIC
COSN30518646 5265 COSMIC
COSN31509469 5291 COSMIC
COSN26964523 5329 COSMIC
COSN30517928 5349 COSMIC
COSN27788815 5375 COSMIC
COSN26964525 5383 COSMIC
COSN30478259 5383 COSMIC
COSN2531697 5388 COSMIC
COSN26572375 5389 COSMIC
COSN29239290 5393 COSMIC
COSN30523910 5396 COSMIC
COSN26964519 5399 COSMIC
COSN30485414 5401 COSMIC
COSN30474793 5410 COSMIC
COSN2531700 5420 COSMIC
COSN2531698 5425 COSMIC
COSN30140643 5431 COSMIC
COSN31510107 5431 COSMIC
COSN2531699 5434 COSMIC
COSN30184444 5449 COSMIC
COSN30162807 5459 COSMIC
COSN30119323 5553 COSMIC
COSN30538159 5597 COSMIC
COSN32052671 5620 COSMIC
COSN30512929 5625 COSMIC
COSN31598221 5654 COSMIC
COSN31612662 5655 COSMIC
COSN18738732 5668 COSMIC
COSN24404551 5669 COSMIC
COSN30155835 5669 COSMIC
COSN30178415 5682 COSMIC
COSN31491981 5699 COSMIC
COSN31500183 5722 COSMIC
COSN30478391 5726 COSMIC
COSN30478489 5741 COSMIC
COSN30470925 5770 COSMIC
COSN19736127 5771 COSMIC
COSN28317541 5772 COSMIC
COSN30155124 5772 COSMIC
COSN28565326 5776 COSMIC
COSN30104361 5798 COSMIC
COSN30459517 5812 COSMIC
COSN30524464 5812 COSMIC
COSN28566398 5816 COSMIC
COSN28571604 5817 COSMIC
COSN26554847 5829 COSMIC
COSN30508615 5849 COSMIC
COSN31584537 5869 COSMIC
COSN30104621 5872 COSMIC
COSN30544079 5920 COSMIC
COSN30501499 5921 COSMIC
COSN26964522 5922 COSMIC
COSN26964526 5930 COSMIC
COSN28564300 5954 COSMIC
COSN31621700 5957 COSMIC
COSN8590609 5965 COSMIC
COSN28567386 5966 COSMIC
COSN28571598 5975 COSMIC
COSN31520301 5985 COSMIC
COSN30148080 6002 COSMIC
COSN30453988 6018 COSMIC
COSN31509702 6019 COSMIC
COSN28570607 6030 COSMIC
COSN28565298 6043 COSMIC
COSN30463034 6047 COSMIC
COSN28567452 6074 COSMIC
COSN30192743 6080 COSMIC
COSN31595204 6087 COSMIC
COSN31526956 6106 COSMIC
COSN31496953 6109 COSMIC
COSN13646297 6120 COSMIC
COSN26964521 6121 COSMIC
COSN31612279 6135 COSMIC
COSN31560526 6182 COSMIC
COSN30487572 6184 COSMIC
COSN31481922 6194 COSMIC
COSN30531380 6197 COSMIC
COSN31597867 6209 COSMIC
COSN5757537 6212 COSMIC
COSN28569471 6216 COSMIC
COSN32057985 6247 COSMIC
COSN31594531 6252 COSMIC
COSN31511978 6253 COSMIC
COSN30111904 6263 COSMIC
COSN30498955 6298 COSMIC
COSN31572452 6301 COSMIC
COSN21292914 6317 COSMIC
COSN30495935 6324 COSMIC
COSN30108194 6327 COSMIC
COSN31499161 6330 COSMIC
COSN30156751 6348 COSMIC
COSN30486392 6354 COSMIC
COSN30540935 6366 COSMIC
COSN26964524 6376 COSMIC
COSN30496849 6377 COSMIC
COSN31612403 6392 COSMIC
COSN13646304 6424 COSMIC
COSN31531080 6429 COSMIC
COSN31547301 6535 COSMIC
COSN31555544 6634 COSMIC
COSN31577584 6732 COSMIC
COSN31568902 6739 COSMIC
COSN5214468 6932 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750849754 2 dbSNP
rs780388252 3 dbSNP
rs756313304 4 dbSNP
rs201481330 5 dbSNP
rs753882529 6 dbSNP
rs1199286513 7 dbSNP
rs754972690 8 dbSNP
rs370285730 9 dbSNP
rs770969637 12 dbSNP
rs3192916 14 dbSNP
rs747515785 14 dbSNP
rs918391724 15 dbSNP
rs1397897653 17 dbSNP
rs781123244 20 dbSNP
rs745709292 21 dbSNP
rs374526376 24 dbSNP
rs1280543644 26 dbSNP
rs769543023 28 dbSNP
rs775246018 31 dbSNP
rs200625948 33 dbSNP
rs773912235 35 dbSNP
rs762218506 39 dbSNP
rs768067340 48 dbSNP
rs371808513 49 dbSNP
rs560579234 50 dbSNP
rs556248347 54 dbSNP
rs376216745 61 dbSNP
rs1008274625 62 dbSNP
rs551874774 63 dbSNP
rs964526574 67 dbSNP
rs974679728 77 dbSNP
rs1294104282 80 dbSNP
rs998402382 86 dbSNP
rs8029539 101 dbSNP
rs892608904 104 dbSNP
rs1185745497 106 dbSNP
rs537915030 111 dbSNP
rs1430344064 119 dbSNP
rs369238058 123 dbSNP
rs1021398721 124 dbSNP
rs949857118 128 dbSNP
rs1308769393 132 dbSNP
rs1291933321 139 dbSNP
rs968860833 147 dbSNP
rs1356710505 148 dbSNP
rs1295483516 152 dbSNP
rs1390090664 155 dbSNP
rs1281690045 157 dbSNP
rs927483203 160 dbSNP
rs1221632919 164 dbSNP
rs1001190048 170 dbSNP
rs937492325 187 dbSNP
rs1164359406 188 dbSNP
rs1474827201 190 dbSNP
rs146738558 193 dbSNP
rs1199269230 197 dbSNP
rs1417088757 207 dbSNP
rs1249321613 209 dbSNP
rs1381373485 210 dbSNP
rs1177457203 212 dbSNP
rs1253006524 217 dbSNP
rs568277718 222 dbSNP
rs1212581647 223 dbSNP
rs544919815 227 dbSNP
rs930196577 228 dbSNP
rs138896117 241 dbSNP
rs918433344 249 dbSNP
rs1406078774 250 dbSNP
rs1008756387 251 dbSNP
rs554037203 252 dbSNP
rs900373583 254 dbSNP
rs879568363 261 dbSNP
rs1369121227 263 dbSNP
rs1302395166 265 dbSNP
rs1462094901 273 dbSNP
rs996000153 278 dbSNP
rs1167031759 288 dbSNP
rs1032811117 293 dbSNP
rs984346174 296 dbSNP
rs1159619956 302 dbSNP
rs909998652 304 dbSNP
rs1250822974 307 dbSNP
rs942757214 311 dbSNP
rs1192387874 317 dbSNP
rs1039732304 318 dbSNP
rs1203929406 319 dbSNP
rs149364091 326 dbSNP
rs534246379 327 dbSNP
rs1330431264 342 dbSNP
rs376443690 346 dbSNP
rs534504960 346 dbSNP
rs1356571590 350 dbSNP
rs1222410576 360 dbSNP
rs1302960903 366 dbSNP
rs981622907 374 dbSNP
rs1316360521 375 dbSNP
rs1373325600 375 dbSNP
rs934246740 388 dbSNP
rs1384232407 390 dbSNP
rs187870077 400 dbSNP
rs111900920 410 dbSNP
rs892694315 411 dbSNP
rs1484276905 412 dbSNP
rs774779210 417 dbSNP
rs1392813098 419 dbSNP
rs1172649747 428 dbSNP
rs1454304048 430 dbSNP
rs1011103407 433 dbSNP
rs958898763 438 dbSNP
rs143721254 439 dbSNP
rs920057002 445 dbSNP
rs1473259169 447 dbSNP
rs930248744 448 dbSNP
rs750620050 453 dbSNP
rs1484904905 456 dbSNP
rs904311004 459 dbSNP
rs544315721 463 dbSNP
rs190153281 464 dbSNP
rs768193990 466 dbSNP
rs1033988935 471 dbSNP
rs959675466 472 dbSNP
rs531246155 476 dbSNP
rs1318905286 483 dbSNP
rs574698975 491 dbSNP
rs1373432631 495 dbSNP
rs148077432 499 dbSNP
rs1444080212 501 dbSNP
rs1434926725 509 dbSNP
rs1025587951 516 dbSNP
rs951364458 517 dbSNP
rs984008286 523 dbSNP
rs1374082637 536 dbSNP
rs1195985001 537 dbSNP
rs1474534467 545 dbSNP
rs1411491242 553 dbSNP
rs1326640914 554 dbSNP
rs1353657792 555 dbSNP
rs776243325 560 dbSNP
rs1486771992 564 dbSNP
rs761403576 571 dbSNP
rs1195244177 579 dbSNP
rs560883740 581 dbSNP
rs549365838 582 dbSNP
rs527972022 588 dbSNP
rs1010599480 589 dbSNP
rs934004439 591 dbSNP
rs988535089 595 dbSNP
rs1020183054 596 dbSNP
rs545810289 596 dbSNP
rs764899664 598 dbSNP
rs946955871 601 dbSNP
rs1002535461 605 dbSNP
rs2283435 606 dbSNP
rs531295831 608 dbSNP
rs142748314 610 dbSNP
rs1408814567 611 dbSNP
rs937109394 613 dbSNP
rs1344902945 614 dbSNP
rs1194530393 617 dbSNP
rs1272753584 623 dbSNP
rs958453859 630 dbSNP
rs1417852397 633 dbSNP
rs973771672 640 dbSNP
rs568115393 642 dbSNP
rs1241513364 647 dbSNP
rs895554943 649 dbSNP
rs377666592 650 dbSNP
rs762667514 657 dbSNP
rs769123776 663 dbSNP
rs373021353 677 dbSNP
rs1476365008 679 dbSNP
rs561136070 685 dbSNP
rs1005850330 686 dbSNP
rs1016782769 687 dbSNP
rs1381104982 688 dbSNP
rs944250966 706 dbSNP
rs1039710342 707 dbSNP
rs146068503 711 dbSNP
rs1336040727 715 dbSNP
rs557597799 718 dbSNP
rs139971102 723 dbSNP
rs1394316447 726 dbSNP
rs1166313540 732 dbSNP
rs1403417613 742 dbSNP
rs1029782323 745 dbSNP
rs1451336425 752 dbSNP
rs79471145 755 dbSNP
rs955434719 757 dbSNP
rs988198576 758 dbSNP
rs913852916 759 dbSNP
rs376244361 760 dbSNP
rs1191752248 761 dbSNP
rs1468105747 763 dbSNP
rs1252248657 784 dbSNP
rs1483914296 786 dbSNP
rs892999223 789 dbSNP
rs980069055 790 dbSNP
rs1281865532 795 dbSNP
rs1223066891 800 dbSNP
rs76670995 810 dbSNP
rs1311015622 812 dbSNP
rs79475253 814 dbSNP
rs750066416 815 dbSNP
rs1326042888 819 dbSNP
rs1439196907 820 dbSNP
rs766322388 822 dbSNP
rs182416759 832 dbSNP
rs995247192 833 dbSNP
rs1395737684 838 dbSNP
rs951664459 850 dbSNP
rs1209542967 853 dbSNP
rs1256715935 853 dbSNP
rs1046732203 868 dbSNP
rs1214733605 869 dbSNP
rs755090064 872 dbSNP
rs1287668468 874 dbSNP
rs886749151 878 dbSNP
rs1445288676 883 dbSNP
rs1231585439 892 dbSNP
rs1346762560 898 dbSNP
rs1303487524 903 dbSNP
rs1191022390 919 dbSNP
rs554049929 926 dbSNP
rs1270143908 928 dbSNP
rs1431873902 944 dbSNP
rs1241435571 949 dbSNP
rs1020159350 963 dbSNP
rs1376362282 972 dbSNP
rs1178240797 976 dbSNP
rs965675409 977 dbSNP
rs754176367 983 dbSNP
rs1005488401 990 dbSNP
rs975633776 991 dbSNP
rs1016886536 998 dbSNP
rs921293544 999 dbSNP
rs1185891069 1007 dbSNP
rs1478263623 1009 dbSNP
rs899739204 1011 dbSNP
rs1478129032 1014 dbSNP
rs1208535313 1019 dbSNP
rs1265030516 1019 dbSNP
rs528443419 1024 dbSNP
rs1178290251 1025 dbSNP
rs1256231827 1027 dbSNP
rs1211546441 1032 dbSNP
rs572729476 1036 dbSNP
rs996717257 1047 dbSNP
rs1272878659 1061 dbSNP
rs1029500804 1063 dbSNP
rs936636385 1067 dbSNP
rs755306184 1081 dbSNP
rs1291815618 1088 dbSNP
rs1468976468 1091 dbSNP
rs1159352201 1092 dbSNP
rs1356267923 1096 dbSNP
rs955488072 1104 dbSNP
rs141896541 1105 dbSNP
rs913981176 1108 dbSNP
rs945419487 1109 dbSNP
rs1318301165 1112 dbSNP
rs1171281362 1115 dbSNP
rs564740515 1117 dbSNP
rs968475916 1122 dbSNP
rs1185450560 1123 dbSNP
rs1161081658 1125 dbSNP
rs1256365241 1127 dbSNP
rs752858736 1136 dbSNP
rs756340577 1137 dbSNP
rs1055625901 1146 dbSNP
rs140683030 1146 dbSNP
rs547152612 1153 dbSNP
rs959610670 1154 dbSNP
rs992287202 1170 dbSNP
rs866822218 1174 dbSNP
rs1233000755 1182 dbSNP
rs1322727937 1182 dbSNP
rs886863275 1186 dbSNP
rs918049116 1186 dbSNP
rs1004346079 1190 dbSNP
rs1372944925 1190 dbSNP
rs1449098552 1190 dbSNP
rs1019793597 1203 dbSNP
rs965914863 1205 dbSNP
rs1162733606 1210 dbSNP
rs1460695248 1210 dbSNP
rs1261008473 1220 dbSNP
rs1368801013 1230 dbSNP
rs975684821 1239 dbSNP
rs1028578108 1252 dbSNP
rs1249382931 1262 dbSNP
rs1178651448 1269 dbSNP
rs150761323 1278 dbSNP
rs1266508665 1286 dbSNP
rs949845291 1289 dbSNP
rs543401732 1290 dbSNP
rs908270301 1296 dbSNP
rs958060732 1299 dbSNP
rs753170060 1301 dbSNP
rs1316491119 1304 dbSNP
rs1365157838 1305 dbSNP
rs561805345 1308 dbSNP
rs774922027 1313 dbSNP
rs1038035748 1314 dbSNP
rs528960842 1323 dbSNP
rs1451045397 1324 dbSNP
rs1325357808 1327 dbSNP
rs899789990 1331 dbSNP
rs1451372194 1333 dbSNP
rs1362804831 1347 dbSNP
rs1392696137 1350 dbSNP
rs928517561 1350 dbSNP
rs186760778 1354 dbSNP
rs543434790 1359 dbSNP
rs79741476 1360 dbSNP
rs192692871 1372 dbSNP
rs1270104758 1373 dbSNP
rs915835514 1386 dbSNP
rs551268705 1389 dbSNP
rs890930079 1408 dbSNP
rs1427126180 1409 dbSNP
rs1301766923 1411 dbSNP
rs931189849 1412 dbSNP
rs185380641 1413 dbSNP
rs188699413 1416 dbSNP
rs192840398 1419 dbSNP
rs1331548175 1423 dbSNP
rs1303342101 1424 dbSNP
rs1003994191 1430 dbSNP
rs1359623791 1437 dbSNP
rs565021064 1440 dbSNP
rs369874910 1441 dbSNP
rs1238557357 1447 dbSNP
rs1312420444 1452 dbSNP
rs997010978 1460 dbSNP
rs1266136846 1463 dbSNP
rs1478077755 1463 dbSNP
rs1028461917 1469 dbSNP
rs568566212 1470 dbSNP
rs1428485482 1471 dbSNP
rs747227845 1472 dbSNP
rs1196370994 1475 dbSNP
rs771267589 1485 dbSNP
rs535560702 1487 dbSNP
rs1361591323 1488 dbSNP
rs1224710370 1490 dbSNP
rs139149477 1492 dbSNP
rs1249728884 1498 dbSNP
rs959620538 1500 dbSNP
rs572571049 1509 dbSNP
rs149898040 1513 dbSNP
rs143961318 1514 dbSNP
rs758673946 1515 dbSNP
rs1416962735 1516 dbSNP
rs950975301 1517 dbSNP
rs983627014 1518 dbSNP
rs576798393 1520 dbSNP
rs1414505710 1530 dbSNP
rs1180576047 1532 dbSNP
rs111892818 1533 dbSNP
rs1403684489 1539 dbSNP
rs1165704595 1540 dbSNP
rs879095970 1548 dbSNP
rs982243786 1549 dbSNP
rs908324348 1550 dbSNP
rs928029226 1556 dbSNP
rs941117736 1558 dbSNP
rs373394280 1565 dbSNP
rs1257022431 1569 dbSNP
rs1188465852 1580 dbSNP
rs1248489971 1591 dbSNP
rs1444389665 1591 dbSNP
rs1445920743 1599 dbSNP
rs184984623 1603 dbSNP
rs959413828 1605 dbSNP
rs920897795 1610 dbSNP
rs1220188477 1612 dbSNP
rs1332456322 1613 dbSNP
rs1283425011 1614 dbSNP
rs543488950 1615 dbSNP
rs1448273384 1616 dbSNP
rs1341957941 1622 dbSNP
rs1300303004 1630 dbSNP
rs1394728159 1633 dbSNP
rs1445416005 1638 dbSNP
rs991282956 1640 dbSNP
rs188662948 1642 dbSNP
rs1351627409 1644 dbSNP
rs1460371434 1646 dbSNP
rs931242453 1647 dbSNP
rs1164254820 1653 dbSNP
rs779444864 1656 dbSNP
rs1313696749 1660 dbSNP
rs1385153031 1667 dbSNP
rs1048776306 1669 dbSNP
rs1051031268 1672 dbSNP
rs771201738 1683 dbSNP
rs1243840491 1693 dbSNP
rs1312884010 1694 dbSNP
rs1358679114 1695 dbSNP
rs1205085763 1696 dbSNP
rs573547109 1699 dbSNP
rs891031706 1701 dbSNP
rs1228741105 1704 dbSNP
rs1357949392 1706 dbSNP
rs1277427169 1708 dbSNP
rs939678556 1712 dbSNP
rs866885357 1713 dbSNP
rs1332846863 1719 dbSNP
rs8036512 1720 dbSNP
rs1324541557 1727 dbSNP
rs1194929824 1730 dbSNP
rs8042607 1731 dbSNP
rs1158305547 1734 dbSNP
rs1440592498 1735 dbSNP
rs1462297821 1739 dbSNP
rs1191892788 1750 dbSNP
rs1476999573 1759 dbSNP
rs1246062798 1761 dbSNP
rs1221960640 1762 dbSNP
rs903937450 1766 dbSNP
rs1000869558 1767 dbSNP
rs532993535 1781 dbSNP
rs148647924 1782 dbSNP
rs1011194066 1786 dbSNP
rs1021608308 1789 dbSNP
rs1231443440 1791 dbSNP
rs966777318 1793 dbSNP
rs144182259 1797 dbSNP
rs866672293 1799 dbSNP
rs1439004182 1801 dbSNP
rs950990911 1802 dbSNP
rs147781570 1812 dbSNP
rs959464181 1815 dbSNP
rs8042649 1816 dbSNP
rs1413993902 1818 dbSNP
rs915773546 1828 dbSNP
rs952529172 1833 dbSNP
rs549796422 1839 dbSNP
rs962461926 1840 dbSNP
rs1192753362 1848 dbSNP
rs1488374086 1849 dbSNP
rs908446027 1858 dbSNP
rs973790521 1864 dbSNP
rs920995755 1865 dbSNP
rs142594327 1868 dbSNP
rs1278761432 1874 dbSNP
rs922240230 1881 dbSNP
rs1360561841 1884 dbSNP
rs1277962856 1885 dbSNP
rs1342548859 1887 dbSNP
rs1400999608 1887 dbSNP
rs932404818 1892 dbSNP
rs1447340961 1895 dbSNP
rs535810607 1907 dbSNP
rs1450660789 1925 dbSNP
rs1049494584 1927 dbSNP
rs28552510 1928 dbSNP
rs1416094412 1943 dbSNP
rs1365937094 1947 dbSNP
rs1169623295 1950 dbSNP
rs1478038002 1956 dbSNP
rs4932214 1963 dbSNP
rs796748684 1972 dbSNP
rs945271848 1977 dbSNP
rs1297621314 1978 dbSNP
rs1313658582 1979 dbSNP
rs1042524769 1984 dbSNP
rs1482752429 1994 dbSNP
rs878970449 1999 dbSNP
rs1305618424 2005 dbSNP
rs1211704731 2008 dbSNP
rs1316526354 2032 dbSNP
rs1257998627 2037 dbSNP
rs902765332 2039 dbSNP
rs751396460 2050 dbSNP
rs765191476 2051 dbSNP
rs1395653490 2053 dbSNP
rs1304590366 2060 dbSNP
rs1440126542 2070 dbSNP
rs540077904 2071 dbSNP
rs936774453 2080 dbSNP
rs1055163103 2081 dbSNP
rs895223090 2082 dbSNP
rs1034994954 2083 dbSNP
rs1162501209 2084 dbSNP
rs1422876347 2086 dbSNP
rs1414075794 2094 dbSNP
rs1013576007 2101 dbSNP
rs1456088842 2108 dbSNP
rs1012309649 2123 dbSNP
rs1199791753 2128 dbSNP
rs558380182 2136 dbSNP
rs1264040958 2137 dbSNP
rs886693775 2138 dbSNP
rs1485903734 2141 dbSNP
rs1322490913 2146 dbSNP
rs1188874856 2149 dbSNP
rs530004755 2152 dbSNP
rs144926917 2155 dbSNP
rs1177633798 2160 dbSNP
rs552677670 2163 dbSNP
rs78806349 2167 dbSNP
rs868494110 2172 dbSNP
rs974894154 2173 dbSNP
rs1402457715 2179 dbSNP
rs1291508493 2183 dbSNP
rs961610120 2186 dbSNP
rs1350062913 2187 dbSNP
rs1028108864 2197 dbSNP
rs1379436925 2202 dbSNP
rs976668986 2213 dbSNP
rs1437482110 2216 dbSNP
rs953772596 2222 dbSNP
rs1178780996 2225 dbSNP
rs1442011239 2233 dbSNP
rs1389546355 2235 dbSNP
rs932290114 2236 dbSNP
rs572921836 2241 dbSNP
rs181150027 2261 dbSNP
rs1290599963 2265 dbSNP
rs986872579 2266 dbSNP
rs1214697685 2267 dbSNP
rs1353333566 2272 dbSNP
rs912195068 2281 dbSNP
rs879928214 2287 dbSNP
rs1283718014 2288 dbSNP
rs945296925 2289 dbSNP
rs978009356 2295 dbSNP
rs946446109 2296 dbSNP
rs370509147 2303 dbSNP
rs925176308 2307 dbSNP
rs1042967471 2312 dbSNP
rs1262120590 2316 dbSNP
rs1417413435 2319 dbSNP
rs936540424 2329 dbSNP
rs1158713710 2331 dbSNP
rs1421046165 2332 dbSNP
rs1317034032 2340 dbSNP
rs759509390 2345 dbSNP
rs1376398993 2355 dbSNP
rs151292515 2359 dbSNP
rs1434276353 2361 dbSNP
rs1056623295 2363 dbSNP
rs895275430 2364 dbSNP
rs1488083429 2365 dbSNP
rs767570467 2374 dbSNP
rs1046840872 2375 dbSNP
rs549269300 2378 dbSNP
rs1255517426 2381 dbSNP
rs1232375395 2389 dbSNP
rs577315829 2403 dbSNP
rs887862971 2404 dbSNP
rs1004946641 2406 dbSNP
rs1200699501 2411 dbSNP
rs752768765 2420 dbSNP
rs183775907 2426 dbSNP
rs1479653512 2428 dbSNP
rs1005564329 2435 dbSNP
rs1298477130 2436 dbSNP
rs1016543930 2437 dbSNP
rs1399376115 2453 dbSNP
rs1171499013 2458 dbSNP
rs1408945480 2460 dbSNP
rs1432168411 2461 dbSNP
rs1168963287 2464 dbSNP
rs577317895 2465 dbSNP
rs140558079 2476 dbSNP
rs996384595 2483 dbSNP
rs977099567 2484 dbSNP
rs1029584266 2490 dbSNP
rs1255484296 2493 dbSNP
rs1029126235 2497 dbSNP
rs563125433 2498 dbSNP
rs756322001 2503 dbSNP
rs953728455 2504 dbSNP
rs953782360 2513 dbSNP
rs985125863 2516 dbSNP
rs771701934 2517 dbSNP
rs1278635163 2523 dbSNP
rs1452968275 2524 dbSNP
rs1019714655 2537 dbSNP
rs914884789 2547 dbSNP
rs1338341520 2548 dbSNP
rs1332926253 2557 dbSNP
rs1303623883 2558 dbSNP
rs1347244433 2562 dbSNP
rs1396164270 2566 dbSNP
rs1408910304 2575 dbSNP
rs966424808 2580 dbSNP
rs1465587936 2585 dbSNP
rs1424721900 2595 dbSNP
rs1170017954 2596 dbSNP
rs1471933045 2600 dbSNP
rs1308812784 2604 dbSNP
rs1368176431 2608 dbSNP
rs1402842888 2619 dbSNP
rs772911117 2622 dbSNP
rs978150798 2631 dbSNP
rs925240115 2633 dbSNP
rs1196626499 2636 dbSNP
rs1282299752 2637 dbSNP
rs1373638299 2650 dbSNP
rs977854290 2654 dbSNP
rs1225075196 2657 dbSNP
rs1283285053 2661 dbSNP
rs957948290 2681 dbSNP
rs1244841076 2686 dbSNP
rs530582690 2699 dbSNP
rs374074422 2702 dbSNP
rs924126728 2702 dbSNP
rs1446618741 2706 dbSNP
rs1401663481 2707 dbSNP
rs1331280525 2711 dbSNP
rs939532171 2718 dbSNP
rs916382137 2721 dbSNP
rs368301313 2724 dbSNP
rs760272330 2725 dbSNP
rs1390253468 2730 dbSNP
rs1056676439 2733 dbSNP
rs1315750973 2735 dbSNP
rs1164012660 2749 dbSNP
rs916838210 2753 dbSNP
rs1378495868 2757 dbSNP
rs1178106090 2762 dbSNP
rs948268142 2767 dbSNP
rs949515055 2776 dbSNP
rs1183693722 2777 dbSNP
rs1046453425 2787 dbSNP
rs1288916552 2793 dbSNP
rs907933811 2796 dbSNP
rs940735876 2799 dbSNP
rs1361163043 2802 dbSNP
rs549026897 2806 dbSNP
rs899417848 2814 dbSNP
rs1238874280 2824 dbSNP
rs1281823642 2829 dbSNP
rs1489973281 2829 dbSNP
rs1434989969 2835 dbSNP
rs996394769 2844 dbSNP
rs77126743 2853 dbSNP
rs890602183 2854 dbSNP
rs897021542 2856 dbSNP
rs998013920 2863 dbSNP
rs1009459484 2865 dbSNP
rs74029950 2869 dbSNP
rs1006781015 2878 dbSNP
rs1245853676 2881 dbSNP
rs1407363830 2882 dbSNP
rs966856776 2882 dbSNP
rs1490736067 2883 dbSNP
rs1445299017 2884 dbSNP
rs1279055529 2889 dbSNP
rs999240928 2891 dbSNP
rs1031930463 2892 dbSNP
rs764373246 2893 dbSNP
rs187959663 2904 dbSNP
rs978283506 2909 dbSNP
rs78907291 2912 dbSNP
rs753479715 2916 dbSNP
rs1275807346 2918 dbSNP
rs1407205388 2920 dbSNP
rs1338681588 2921 dbSNP
rs1297862985 2922 dbSNP
rs138199716 2923 dbSNP
rs960702117 2929 dbSNP
rs970611468 2943 dbSNP
rs1424451380 2953 dbSNP
rs1296081829 2954 dbSNP
rs982345593 2958 dbSNP
rs768663761 2976 dbSNP
rs1481321057 2980 dbSNP
rs948320484 2982 dbSNP
rs1192423844 2983 dbSNP
rs548220097 2993 dbSNP
rs1485999367 2995 dbSNP
rs1243279305 2999 dbSNP
rs940731620 3005 dbSNP
rs1037712897 3009 dbSNP
rs147594593 3027 dbSNP
rs1264358839 3032 dbSNP
rs920563662 3033 dbSNP
rs1225701569 3034 dbSNP
rs1231124974 3040 dbSNP
rs932237728 3041 dbSNP
rs1050687989 3049 dbSNP
rs182419623 3058 dbSNP
rs1219413753 3066 dbSNP
rs537595198 3073 dbSNP
rs141322282 3086 dbSNP
rs1364354138 3087 dbSNP
rs1245829274 3093 dbSNP
rs574269693 3095 dbSNP
rs1358475536 3099 dbSNP
rs1274151236 3102 dbSNP
rs1470930364 3103 dbSNP
rs1439859638 3104 dbSNP
rs1169703116 3111 dbSNP
rs1428744495 3115 dbSNP
rs909229442 3116 dbSNP
rs890687198 3125 dbSNP
rs1179586757 3132 dbSNP
rs1472201115 3134 dbSNP
rs940701493 3135 dbSNP
rs1206067364 3140 dbSNP
rs1456833471 3141 dbSNP
rs1202760690 3148 dbSNP
rs1257747376 3149 dbSNP
rs1205743231 3152 dbSNP
rs1309465967 3155 dbSNP
rs1009103520 3157 dbSNP
rs901935994 3158 dbSNP
rs757618405 3160 dbSNP
rs997575965 3170 dbSNP
rs1398111807 3173 dbSNP
rs1454446139 3173 dbSNP
rs1330410887 3183 dbSNP
rs187034253 3184 dbSNP
rs1355889117 3191 dbSNP
rs1469382877 3193 dbSNP
rs1162212469 3197 dbSNP
rs552914071 3204 dbSNP
rs1404418614 3205 dbSNP
rs1385248309 3208 dbSNP
rs902264872 3215 dbSNP
rs999649781 3216 dbSNP
rs577350754 3220 dbSNP
rs903550161 3223 dbSNP
rs999208299 3228 dbSNP
rs1264079481 3230 dbSNP
rs544716720 3234 dbSNP
rs1221039237 3243 dbSNP
rs1031044236 3249 dbSNP
rs1294037172 3251 dbSNP
rs1374543144 3253 dbSNP
rs556610190 3253 dbSNP
rs1023537631 3256 dbSNP
rs1411445482 3268 dbSNP
rs1306253381 3270 dbSNP
rs991841819 3275 dbSNP
rs1375193615 3276 dbSNP
rs575098066 3280 dbSNP
rs981968980 3281 dbSNP
rs1015137547 3285 dbSNP
rs969510557 3290 dbSNP
rs1452848660 3296 dbSNP
rs1417371871 3304 dbSNP
rs1380188299 3309 dbSNP
rs985487626 3320 dbSNP
rs191965781 3323 dbSNP
rs144977703 3324 dbSNP
rs733944 3335 dbSNP
rs1490571688 3337 dbSNP
rs1271383734 3344 dbSNP
rs973458929 3359 dbSNP
rs1214503460 3369 dbSNP
rs920658526 3375 dbSNP
rs1353024928 3376 dbSNP
rs115295866 3379 dbSNP
rs1239608920 3382 dbSNP
rs559801538 3384 dbSNP
rs533337599 3385 dbSNP
rs1304621798 3404 dbSNP
rs1341986523 3404 dbSNP
rs1397778461 3407 dbSNP
rs1383543188 3408 dbSNP
rs1288950199 3410 dbSNP
rs1455804595 3417 dbSNP
rs1376493498 3429 dbSNP
rs1175771337 3431 dbSNP
rs181841856 3433 dbSNP
rs933417939 3438 dbSNP
rs912187467 3440 dbSNP
rs1050480903 3442 dbSNP
rs889661661 3446 dbSNP
rs1272687182 3449 dbSNP
rs1324578422 3456 dbSNP
rs369572349 3460 dbSNP
rs1262433790 3472 dbSNP
rs944916450 3478 dbSNP
rs1207038579 3481 dbSNP
rs942502409 3492 dbSNP
rs1043914634 3493 dbSNP
rs1222637676 3501 dbSNP
rs903772084 3502 dbSNP
rs1284977250 3508 dbSNP
rs570124353 3513 dbSNP
rs868368444 3529 dbSNP
rs1030680356 3530 dbSNP
rs896143171 3533 dbSNP
rs1318391974 3544 dbSNP
rs1383466020 3554 dbSNP
rs1400654762 3556 dbSNP
rs1186834833 3561 dbSNP
rs2240588 3569 dbSNP
rs1470601179 3572 dbSNP
rs935100816 3580 dbSNP
rs1053492917 3585 dbSNP
rs1168991634 3586 dbSNP
rs893545182 3587 dbSNP
rs779098557 3594 dbSNP
rs141802766 3597 dbSNP
rs1422174348 3604 dbSNP
rs1202894379 3607 dbSNP
rs1461717608 3616 dbSNP
rs1469996478 3620 dbSNP
rs1196592823 3634 dbSNP
rs906458480 3639 dbSNP
rs1403333812 3645 dbSNP
rs1003841129 3646 dbSNP
rs1270451278 3647 dbSNP
rs1229198053 3655 dbSNP
rs1016807703 3656 dbSNP
rs186028547 3658 dbSNP
rs962206951 3660 dbSNP
rs1385708790 3682 dbSNP
rs1328735426 3687 dbSNP
rs746261262 3701 dbSNP
rs758834621 3703 dbSNP
rs1277973570 3706 dbSNP
rs867224366 3707 dbSNP
rs986247892 3714 dbSNP
rs1238184654 3718 dbSNP
rs144635404 3722 dbSNP
rs953441327 3737 dbSNP
rs563544018 3740 dbSNP
rs910646022 3758 dbSNP
rs1225646340 3764 dbSNP
rs947413812 3794 dbSNP
rs986134905 3797 dbSNP
rs1176511479 3800 dbSNP
rs780548678 3802 dbSNP
rs553352852 3804 dbSNP
rs1205766960 3809 dbSNP
rs1286372272 3812 dbSNP
rs570929163 3815 dbSNP
rs1246148416 3817 dbSNP
rs2079594 3821 dbSNP
rs924870179 3824 dbSNP
rs1362188700 3827 dbSNP
rs1307761676 3855 dbSNP
rs1442155360 3865 dbSNP
rs200947140 3873 dbSNP
rs398028276 3874 dbSNP
rs5814358 3874 dbSNP
rs75639692 3875 dbSNP
rs200878421 3880 dbSNP
rs538198111 3882 dbSNP
rs1052763783 3883 dbSNP
rs556645451 3884 dbSNP
rs190402433 3887 dbSNP
rs148025652 3895 dbSNP
rs554728062 3896 dbSNP
rs1378580016 3899 dbSNP
rs1156695245 3903 dbSNP
rs1469578205 3915 dbSNP
rs1233175408 3924 dbSNP
rs1183803470 3926 dbSNP
rs1201213724 3930 dbSNP
rs1267794528 3934 dbSNP
rs893558843 3939 dbSNP
rs141728329 3943 dbSNP
rs947771424 3946 dbSNP
rs1426729557 3947 dbSNP
rs1283285905 3959 dbSNP
rs904956078 3965 dbSNP
rs765570653 3971 dbSNP
rs1465192033 3982 dbSNP
rs1016460154 3983 dbSNP
rs1303944361 3984 dbSNP
rs769357304 3986 dbSNP
rs1358640388 3987 dbSNP
rs540543004 3991 dbSNP
rs1030578359 3995 dbSNP
rs954907111 4008 dbSNP
rs1160064537 4016 dbSNP
rs1479354679 4018 dbSNP
rs1428371199 4026 dbSNP
rs182673335 4044 dbSNP
rs1490741618 4048 dbSNP
rs533375276 4053 dbSNP
rs910531560 4054 dbSNP
rs1003189578 4060 dbSNP
rs748847448 4061 dbSNP
rs897736215 4062 dbSNP
rs1199274793 4064 dbSNP
rs968843449 4077 dbSNP
rs979241955 4080 dbSNP
rs770652825 4102 dbSNP
rs1330764118 4119 dbSNP
rs1269657803 4123 dbSNP
rs375867543 4126 dbSNP
rs994714565 4127 dbSNP
rs1027452101 4129 dbSNP
rs1281353760 4136 dbSNP
rs140389483 4138 dbSNP
rs1405005649 4140 dbSNP
rs1214430611 4143 dbSNP
rs1007621951 4155 dbSNP
rs1018964844 4161 dbSNP
rs186809584 4163 dbSNP
rs949267660 4164 dbSNP
rs977436911 4166 dbSNP
rs1490462633 4169 dbSNP
rs1044731144 4170 dbSNP
rs1243367661 4173 dbSNP
rs1224477186 4174 dbSNP
rs1266462627 4178 dbSNP
rs1264136176 4180 dbSNP
rs904852899 4186 dbSNP
rs1305963040 4187 dbSNP
rs759421564 4190 dbSNP
rs1272614356 4193 dbSNP
rs758318815 4194 dbSNP
rs144313615 4203 dbSNP
rs1037852585 4204 dbSNP
rs1282512084 4205 dbSNP
rs1450273654 4207 dbSNP
rs957577606 4208 dbSNP
rs990284702 4210 dbSNP
rs1365097401 4213 dbSNP
rs1468154103 4214 dbSNP
rs1169251093 4215 dbSNP
rs1410197234 4217 dbSNP
rs571676673 4227 dbSNP
rs954959549 4235 dbSNP
rs561409610 4250 dbSNP
rs549349334 4251 dbSNP
rs1244346758 4254 dbSNP
rs147339559 4257 dbSNP
rs1045238082 4260 dbSNP
rs1301714473 4263 dbSNP
rs1205411214 4267 dbSNP
rs1390381861 4272 dbSNP
rs1289675953 4274 dbSNP
rs927719339 4279 dbSNP
rs148308475 4280 dbSNP
rs1331113618 4289 dbSNP
rs189690388 4290 dbSNP
rs369482115 4292 dbSNP
rs1397742027 4294 dbSNP
rs1370834950 4298 dbSNP
rs1297399775 4299 dbSNP
rs571566199 4304 dbSNP
rs1355974207 4306 dbSNP
rs1161106400 4308 dbSNP
rs1262220070 4313 dbSNP
rs1308504295 4322 dbSNP
rs1385348182 4324 dbSNP
rs1423494727 4324 dbSNP
rs924683851 4331 dbSNP
rs1417865260 4334 dbSNP
rs1250168397 4340 dbSNP
rs149842217 4349 dbSNP
rs1481729132 4350 dbSNP
rs1248000992 4363 dbSNP
rs775638574 4369 dbSNP
rs1263473311 4371 dbSNP
rs729708 4379 dbSNP
rs1294059083 4381 dbSNP
rs1196086117 4384 dbSNP
rs729707 4390 dbSNP
rs1435621956 4394 dbSNP
rs1019476622 4396 dbSNP
rs1177492458 4397 dbSNP
rs1044940950 4398 dbSNP
rs149014213 4402 dbSNP
rs1037335505 4403 dbSNP
rs1452251748 4404 dbSNP
rs536328900 4405 dbSNP
rs554340933 4407 dbSNP
rs77577349 4409 dbSNP
rs1368309751 4410 dbSNP
rs1051946807 4411 dbSNP
rs1462808290 4412 dbSNP
rs1169904797 4414 dbSNP
rs1394571684 4415 dbSNP
rs1271139654 4416 dbSNP
rs1484838995 4420 dbSNP
rs890615144 4420 dbSNP
rs1260112788 4421 dbSNP
rs6496565 4427 dbSNP
rs532659626 4441 dbSNP
rs1454571747 4442 dbSNP
rs558934994 4443 dbSNP
rs1320935497 4454 dbSNP
rs577209575 4465 dbSNP
rs184118580 4470 dbSNP
rs1252803294 4471 dbSNP
rs1031598322 4484 dbSNP
rs904558220 4487 dbSNP
rs1031633854 4488 dbSNP
rs957629945 4488 dbSNP
rs373232557 4489 dbSNP
rs916144920 4493 dbSNP
rs1480880680 4494 dbSNP
rs1024786179 4495 dbSNP
rs1191070227 4495 dbSNP
rs1462259463 4501 dbSNP
rs729706 4502 dbSNP
rs757379991 4504 dbSNP
rs1256026695 4509 dbSNP
rs981623858 4516 dbSNP
rs980688255 4520 dbSNP
rs927741115 4524 dbSNP
rs939077461 4525 dbSNP
rs926538944 4540 dbSNP
rs1371636016 4546 dbSNP
rs1202862300 4555 dbSNP
rs1323775741 4556 dbSNP
rs1036447388 4557 dbSNP
rs551045872 4562 dbSNP
rs1295678920 4570 dbSNP
rs1437901167 4572 dbSNP
rs1408479179 4574 dbSNP
rs1381301501 4575 dbSNP
rs1336462776 4578 dbSNP
rs930567489 4581 dbSNP
rs1468269565 4584 dbSNP
rs1049031136 4586 dbSNP
rs889023506 4592 dbSNP
rs943232475 4593 dbSNP
rs1040205041 4602 dbSNP
rs569853139 4603 dbSNP
rs1378381424 4604 dbSNP
rs901931407 4606 dbSNP
rs1461680407 4607 dbSNP
rs1373651187 4609 dbSNP
rs998920791 4611 dbSNP
rs973496099 4620 dbSNP
rs1382673252 4622 dbSNP
rs746123545 4624 dbSNP
rs918900072 4625 dbSNP
rs1051492932 4631 dbSNP
rs765500576 4635 dbSNP
rs1338427784 4636 dbSNP
rs943511010 4643 dbSNP
rs1217701950 4644 dbSNP
rs1031650661 4657 dbSNP
rs575519073 4669 dbSNP
rs1011516533 4670 dbSNP
rs1454004214 4676 dbSNP
rs1000431116 4678 dbSNP
rs543126674 4678 dbSNP
rs1325116612 4681 dbSNP
rs76173219 4683 dbSNP
rs188675546 4684 dbSNP
rs1014329719 4690 dbSNP
rs1188748435 4698 dbSNP
rs1384712864 4708 dbSNP
rs982018428 4724 dbSNP
rs1024333327 4726 dbSNP
rs1342186524 4726 dbSNP
rs199969725 4726 dbSNP
rs369738130 4726 dbSNP
rs970080823 4726 dbSNP
rs1035830882 4727 dbSNP
rs1033493904 4731 dbSNP
rs1436845311 4732 dbSNP
rs1206695118 4737 dbSNP
rs1270713604 4738 dbSNP
rs1437233408 4741 dbSNP
rs1250850630 4742 dbSNP
rs1206893586 4745 dbSNP
rs1489608886 4753 dbSNP
rs1477699074 4754 dbSNP
rs1247261530 4757 dbSNP
rs1359156517 4764 dbSNP
rs1278131582 4768 dbSNP
rs1238842290 4770 dbSNP
rs758816264 4771 dbSNP
rs1200469925 4778 dbSNP
rs546779925 4782 dbSNP
rs376627772 4783 dbSNP
rs1175492817 4787 dbSNP
rs1405873281 4788 dbSNP
rs747551325 4792 dbSNP
rs1392860748 4794 dbSNP
rs1156564807 4808 dbSNP
rs1469403840 4818 dbSNP
rs930325281 4820 dbSNP
rs1290545031 4822 dbSNP
rs928953868 4823 dbSNP
rs987253998 4826 dbSNP
rs984448051 4837 dbSNP
rs1222010937 4845 dbSNP
rs193233541 4847 dbSNP
rs1283578798 4848 dbSNP
rs1453810203 4852 dbSNP
rs1347029068 4853 dbSNP
rs550194898 4859 dbSNP
rs549292687 4860 dbSNP
rs535826447 4862 dbSNP
rs548276849 4869 dbSNP
rs185313657 4870 dbSNP
rs534027601 4871 dbSNP
rs936282321 4874 dbSNP
rs755534881 4886 dbSNP
rs558765292 4887 dbSNP
rs1316078545 4890 dbSNP
rs567425677 4892 dbSNP
rs891829489 4893 dbSNP
rs577246889 4895 dbSNP
rs1045667603 4896 dbSNP
rs1011570242 4908 dbSNP
rs1487631743 4909 dbSNP
rs1001596594 4910 dbSNP
rs1193017887 4911 dbSNP
rs1465799800 4912 dbSNP
rs1270401064 4922 dbSNP
rs538157861 4926 dbSNP
rs1323056866 4927 dbSNP
rs1263950377 4930 dbSNP
rs1022881040 4932 dbSNP
rs1452775384 4933 dbSNP
rs1269675325 4937 dbSNP
rs554946907 4938 dbSNP
rs1429929632 4939 dbSNP
rs1190768509 4942 dbSNP
rs556471419 4944 dbSNP
rs575595325 4946 dbSNP
rs542613877 4951 dbSNP
rs1176272296 4956 dbSNP
rs1033958939 4963 dbSNP
rs1416769719 4964 dbSNP
rs1408879287 4965 dbSNP
rs1420952528 4969 dbSNP
rs1160424984 4971 dbSNP
rs906118536 4974 dbSNP
rs1378376589 4975 dbSNP
rs1003099700 4984 dbSNP
rs963225144 4986 dbSNP
rs1418966624 4987 dbSNP
rs534362838 4990 dbSNP
rs995201827 4992 dbSNP
rs1036288814 4995 dbSNP
rs1212423483 4999 dbSNP
rs1306048775 5000 dbSNP
rs1272355486 5004 dbSNP
rs961593373 5008 dbSNP
rs972883785 5010 dbSNP
rs1342748751 5011 dbSNP
rs1299677710 5014 dbSNP
rs9550 5015 dbSNP
rs951774127 5016 dbSNP
rs59684439 5017 dbSNP
rs1292582511 5023 dbSNP
rs1373484038 5024 dbSNP
rs1327570657 5038 dbSNP
rs910190121 5040 dbSNP
rs943298210 5041 dbSNP
rs1306395212 5045 dbSNP
rs911537975 5046 dbSNP
rs1444564442 5051 dbSNP
rs964471678 5053 dbSNP
rs1353662309 5080 dbSNP
rs1247268406 5081 dbSNP
rs1294416625 5085 dbSNP
rs1206176954 5087 dbSNP
rs1484048202 5093 dbSNP
rs974508232 5105 dbSNP
rs569614492 5106 dbSNP
rs1243680220 5108 dbSNP
rs923168108 5109 dbSNP
rs565122433 5113 dbSNP
rs748840229 5115 dbSNP
rs200031745 5118 dbSNP
rs746285426 5118 dbSNP
rs1370954353 5123 dbSNP
rs151100720 5125 dbSNP
rs1176877738 5139 dbSNP
rs1052879624 5145 dbSNP
rs914659476 5149 dbSNP
rs1237597510 5151 dbSNP
rs1439007645 5152 dbSNP
rs1300815288 5153 dbSNP
rs1424567356 5160 dbSNP
rs1351022033 5166 dbSNP
rs566657350 5168 dbSNP
rs1167305878 5180 dbSNP
rs913487519 5182 dbSNP
rs947439443 5195 dbSNP
rs1044390399 5196 dbSNP
rs772073918 5196 dbSNP
rs950277639 5218 dbSNP
rs905841863 5222 dbSNP
rs1415783158 5227 dbSNP
rs1166295961 5228 dbSNP
rs1223712797 5236 dbSNP
rs1314854925 5239 dbSNP
rs200841200 5240 dbSNP
rs1228613795 5241 dbSNP
rs79118417 5247 dbSNP
rs1045720879 5254 dbSNP
rs187349622 5255 dbSNP
rs1057401362 5256 dbSNP
rs897392331 5260 dbSNP
rs562999916 5262 dbSNP
rs1448481609 5267 dbSNP
rs1027117247 5268 dbSNP
rs1295751947 5270 dbSNP
rs1452276899 5271 dbSNP
rs191685010 5272 dbSNP
rs1005949653 5277 dbSNP
rs1459001912 5279 dbSNP
rs770435965 5283 dbSNP
rs1396394862 5285 dbSNP
rs547873949 5286 dbSNP
rs1454035849 5291 dbSNP
rs1269578017 5292 dbSNP
rs767204928 5292 dbSNP
rs745654331 5294 dbSNP
rs1484893065 5298 dbSNP
rs1354734565 5301 dbSNP
rs1228084699 5302 dbSNP
rs1274090026 5305 dbSNP
rs1209170727 5306 dbSNP
rs1302770139 5307 dbSNP
rs1312203224 5307 dbSNP
rs375688536 5307 dbSNP
rs976146001 5307 dbSNP
rs1381010729 5315 dbSNP
rs79178069 5317 dbSNP
rs879262097 5317 dbSNP
rs1365167376 5318 dbSNP
rs1321609178 5327 dbSNP
rs1309513657 5341 dbSNP
rs923249791 5343 dbSNP
rs1018644279 5344 dbSNP
rs1172156919 5345 dbSNP
rs1461825318 5348 dbSNP
rs7179900 5351 dbSNP
rs533858623 5355 dbSNP
rs772495050 5358 dbSNP
rs141277044 5362 dbSNP
rs957316408 5374 dbSNP
rs746481323 5375 dbSNP
rs1466049770 5376 dbSNP
rs1302160698 5378 dbSNP
rs914379948 5380 dbSNP
rs570684220 5382 dbSNP
rs1044484766 5383 dbSNP
rs1257221859 5385 dbSNP
rs989008734 5393 dbSNP
rs1340884818 5396 dbSNP
rs1298926322 5403 dbSNP
rs537990373 5405 dbSNP
rs927359042 5409 dbSNP
rs760640209 5411 dbSNP
rs1396817961 5412 dbSNP
rs1404676153 5413 dbSNP
rs1296488952 5418 dbSNP
rs556428426 5425 dbSNP
rs1057441184 5426 dbSNP
rs568253057 5427 dbSNP
rs913380718 5429 dbSNP
rs183821867 5430 dbSNP
rs1399000745 5431 dbSNP
rs1193739630 5441 dbSNP
rs536695512 5444 dbSNP
rs994388966 5445 dbSNP
rs1048611803 5447 dbSNP
rs1358003644 5453 dbSNP
rs1283946995 5454 dbSNP
rs764121762 5457 dbSNP
rs1342665848 5476 dbSNP
rs888639998 5477 dbSNP
rs75857481 5479 dbSNP
rs554643159 5488 dbSNP
rs1409455790 5493 dbSNP
rs937355627 5496 dbSNP
rs188207112 5505 dbSNP
rs75928307 5510 dbSNP
rs79907874 5512 dbSNP
rs964810694 5513 dbSNP
rs898587404 5517 dbSNP
rs997191734 5517 dbSNP
rs1271138805 5521 dbSNP
rs1369992950 5524 dbSNP
rs930021841 5526 dbSNP
rs1364450556 5528 dbSNP
rs575827113 5529 dbSNP
rs1183778991 5532 dbSNP
rs955967708 5533 dbSNP
rs58137913 5537 dbSNP
rs1210980250 5540 dbSNP
rs886253226 5543 dbSNP
rs577033803 5546 dbSNP
rs1276541009 5552 dbSNP
rs544392218 5554 dbSNP
rs980337456 5568 dbSNP
rs927440880 5579 dbSNP
rs1242549928 5585 dbSNP
rs765360866 5586 dbSNP
rs1330622483 5591 dbSNP
rs576730834 5592 dbSNP
rs1405890328 5593 dbSNP
rs995866761 5596 dbSNP
rs918564056 5601 dbSNP
rs929942401 5608 dbSNP
rs563244032 5609 dbSNP
rs1412302748 5613 dbSNP
rs763269691 5616 dbSNP
rs888692561 5617 dbSNP
rs1245635919 5625 dbSNP
rs942885055 5628 dbSNP
rs957163186 5631 dbSNP
rs138798788 5632 dbSNP
rs1330281882 5637 dbSNP
rs1270195938 5644 dbSNP
rs1221926610 5649 dbSNP
rs1344318987 5652 dbSNP
rs1399348314