miRTarBase - #MIRT488848 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UBTF   
Synonyms NOR-90, UBF, UBF-1, UBF1, UBF2
Description upstream binding transcription factor, RNA polymerase I
Transcript NM_001076683   
Other Transcripts NM_001076684 , NM_014233   
Putative miRNA Targets on UBTF
(miRNA target sites are highlighted)
2241 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guuugugguaacagUGUGAGGu 5'
Target 5' gaggcctgggggggACACTCCc 3'
1689 - 1710 140.00 -12.60
            |:| ||    |:|||| ||| 
1206 - 1228 120.00 -12.10
            :| :||||| ||  |::||:| 
988 - 1011 118.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30455912 11 COSMIC
COSN4622666 20 COSMIC
COSN30473083 27 COSMIC
COSN7812720 47 COSMIC
COSN30524122 51 COSMIC
COSN23843802 87 COSMIC
COSN1197233 127 COSMIC
COSN26548197 526 COSMIC
COSN26563639 548 COSMIC
COSN31579000 605 COSMIC
COSN31555700 607 COSMIC
COSN30543969 730 COSMIC
COSN29036550 810 COSMIC
COSN9669445 887 COSMIC
COSN18972964 926 COSMIC
COSN22024291 1488 COSMIC
COSN7435858 1666 COSMIC
COSN7435857 1703 COSMIC
COSN31490284 1915 COSMIC
COSN31515775 1915 COSMIC
COSN31563280 2003 COSMIC
COSN31608808 2047 COSMIC
COSN31577382 2142 COSMIC
rs9910055 1573 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs572638952 1 dbSNP
rs1265946955 2 dbSNP
rs906051185 4 dbSNP
rs770607035 5 dbSNP
rs1185159203 6 dbSNP
rs760152795 7 dbSNP
rs1044566914 9 dbSNP
rs770642757 11 dbSNP
rs377318867 13 dbSNP
rs138321189 14 dbSNP
rs1326593392 18 dbSNP
rs200826893 20 dbSNP
rs748055414 26 dbSNP
rs991881928 27 dbSNP
rs755405644 35 dbSNP
rs1299111150 36 dbSNP
rs1336906138 41 dbSNP
rs1381408521 44 dbSNP
rs1386090475 44 dbSNP
rs1394973396 51 dbSNP
rs1407861849 52 dbSNP
rs768525090 54 dbSNP
rs749128923 55 dbSNP
rs191365085 57 dbSNP
rs747564580 57 dbSNP
rs1388247613 58 dbSNP
rs1159358193 59 dbSNP
rs756454628 67 dbSNP
rs1375930444 69 dbSNP
rs1198789598 71 dbSNP
rs1455046583 74 dbSNP
rs745931206 75 dbSNP
rs1295206884 78 dbSNP
rs966720238 78 dbSNP
rs1198473391 79 dbSNP
rs781265823 80 dbSNP
rs145623357 87 dbSNP
rs1283202685 89 dbSNP
rs1205286374 92 dbSNP
rs752054456 93 dbSNP
rs552987056 94 dbSNP
rs753105726 95 dbSNP
rs765999022 97 dbSNP
rs776106868 99 dbSNP
rs146797528 100 dbSNP
rs569660738 102 dbSNP
rs1432712005 104 dbSNP
rs772748372 105 dbSNP
rs1037256676 108 dbSNP
rs1386207819 109 dbSNP
rs2229285 109 dbSNP
rs992321212 110 dbSNP
rs1434634002 113 dbSNP
rs1285308881 114 dbSNP
rs1343839232 119 dbSNP
rs1232869319 121 dbSNP
rs1255191595 123 dbSNP
rs1351830417 126 dbSNP
rs1283738260 127 dbSNP
rs1324381589 127 dbSNP
rs1487942132 133 dbSNP
rs1199474248 137 dbSNP
rs75104069 140 dbSNP
rs1431085797 141 dbSNP
rs1197806076 142 dbSNP
rs1360404189 142 dbSNP
rs1455613633 142 dbSNP
rs374363130 142 dbSNP
rs1425890145 143 dbSNP
rs1400196264 144 dbSNP
rs1388738411 145 dbSNP
rs956877320 147 dbSNP
rs918229577 152 dbSNP
rs1307907862 153 dbSNP
rs1337776894 154 dbSNP
rs886128047 156 dbSNP
rs536050870 163 dbSNP
rs1412486599 166 dbSNP
rs962584698 176 dbSNP
rs1198412360 181 dbSNP
rs1223213347 182 dbSNP
rs1018092575 184 dbSNP
rs1293318842 189 dbSNP
rs1487179002 192 dbSNP
rs1476867978 196 dbSNP
rs1208736308 203 dbSNP
rs1248112427 205 dbSNP
rs1250726153 208 dbSNP
rs1177124951 213 dbSNP
rs1221766555 214 dbSNP
rs985252589 216 dbSNP
rs955495278 221 dbSNP
rs1367251767 223 dbSNP
rs1038826495 226 dbSNP
rs565700500 233 dbSNP
rs944550960 237 dbSNP
rs1030164735 243 dbSNP
rs1398874056 249 dbSNP
rs750548177 254 dbSNP
rs547888617 255 dbSNP
rs891805822 258 dbSNP
rs1032991739 260 dbSNP
rs1000476443 261 dbSNP
rs906103526 262 dbSNP
rs1314705417 264 dbSNP
rs1044621655 268 dbSNP
rs532524933 273 dbSNP
rs1243377365 275 dbSNP
rs950197825 277 dbSNP
rs1458798783 280 dbSNP
rs966689049 285 dbSNP
rs895949646 292 dbSNP
rs1056628569 293 dbSNP
rs1462001904 294 dbSNP
rs989970877 298 dbSNP
rs929717460 299 dbSNP
rs959448498 300 dbSNP
rs1034189829 306 dbSNP
rs1003683329 309 dbSNP
rs970887398 311 dbSNP
rs1015778184 312 dbSNP
rs866503221 315 dbSNP
rs117467674 316 dbSNP
rs1175543432 317 dbSNP
rs772763701 323 dbSNP
rs1304401294 326 dbSNP
rs1048758664 327 dbSNP
rs770968010 328 dbSNP
rs1376843043 333 dbSNP
rs994912716 342 dbSNP
rs911135706 344 dbSNP
rs1191437568 346 dbSNP
rs985306201 355 dbSNP
rs955216334 356 dbSNP
rs944538817 357 dbSNP
rs573747907 359 dbSNP
rs149845965 362 dbSNP
rs989321188 368 dbSNP
rs1042322005 369 dbSNP
rs1212648456 371 dbSNP
rs945316672 380 dbSNP
rs915166647 389 dbSNP
rs989464660 398 dbSNP
rs959647722 410 dbSNP
rs956133517 421 dbSNP
rs1033458402 422 dbSNP
rs1263067480 424 dbSNP
rs531692944 425 dbSNP
rs1000193031 429 dbSNP
rs970004952 433 dbSNP
rs1471099473 435 dbSNP
rs1177939783 442 dbSNP
rs1023229949 451 dbSNP
rs1014484692 454 dbSNP
rs1465479231 455 dbSNP
rs1279755764 458 dbSNP
rs895990181 463 dbSNP
rs1015747233 466 dbSNP
rs561579481 467 dbSNP
rs1345727678 478 dbSNP
rs1220658072 480 dbSNP
rs1276947392 482 dbSNP
rs766876829 482 dbSNP
rs982992608 484 dbSNP
rs1047871838 485 dbSNP
rs1299981965 490 dbSNP
rs1192996360 491 dbSNP
rs1435919501 494 dbSNP
rs994351175 496 dbSNP
rs1027657933 511 dbSNP
rs896895217 515 dbSNP
rs543312323 516 dbSNP
rs941033561 519 dbSNP
rs1159604213 523 dbSNP
rs1362345603 527 dbSNP
rs910854545 528 dbSNP
rs1417839460 532 dbSNP
rs1297030603 534 dbSNP
rs527908125 534 dbSNP
rs1437995495 536 dbSNP
rs1272661686 538 dbSNP
rs1366493608 539 dbSNP
rs1224643237 544 dbSNP
rs1311965842 551 dbSNP
rs1352115528 559 dbSNP
rs1382044839 560 dbSNP
rs994489816 565 dbSNP
rs900190969 566 dbSNP
rs3169720 572 dbSNP
rs1008686595 579 dbSNP
rs1360735973 595 dbSNP
rs1481105297 598 dbSNP
rs1179000323 600 dbSNP
rs751894350 603 dbSNP
rs545569262 605 dbSNP
rs1042208342 606 dbSNP
rs1157909358 607 dbSNP
rs922453557 607 dbSNP
rs1385806047 612 dbSNP
rs1348903033 615 dbSNP
rs1406555364 615 dbSNP
rs988650162 618 dbSNP
rs377177156 632 dbSNP
rs1333767771 633 dbSNP
rs1428784439 634 dbSNP
rs956355954 637 dbSNP
rs1375230715 638 dbSNP
rs893700806 644 dbSNP
rs1054128162 647 dbSNP
rs1387923425 648 dbSNP
rs938006679 649 dbSNP
rs926643705 653 dbSNP
rs1438597712 654 dbSNP
rs979521220 655 dbSNP
rs536804421 656 dbSNP
rs982209429 660 dbSNP
rs1456238293 661 dbSNP
rs1177802478 662 dbSNP
rs949509556 665 dbSNP
rs1324341025 666 dbSNP
rs1160926423 667 dbSNP
rs908635058 667 dbSNP
rs1412514542 669 dbSNP
rs576906358 679 dbSNP
rs1465813423 681 dbSNP
rs1172286674 683 dbSNP
rs926059169 690 dbSNP
rs978804303 693 dbSNP
rs1449575915 696 dbSNP
rs1337849624 699 dbSNP
rs571411225 705 dbSNP
rs558226223 706 dbSNP
rs1340079923 710 dbSNP
rs1027221047 722 dbSNP
rs976100493 725 dbSNP
rs964402512 729 dbSNP
rs776096598 731 dbSNP
rs1317554312 733 dbSNP
rs1017729421 734 dbSNP
rs1014537212 742 dbSNP
rs1008572085 747 dbSNP
rs1484506479 750 dbSNP
rs527327773 751 dbSNP
rs1204250298 754 dbSNP
rs1026933494 758 dbSNP
rs1477828260 761 dbSNP
rs1195241022 763 dbSNP
rs762887268 766 dbSNP
rs1229365946 772 dbSNP
rs1464823982 773 dbSNP
rs773021175 779 dbSNP
rs1009377012 781 dbSNP
rs199695548 783 dbSNP
rs1413128923 788 dbSNP
rs1053695177 796 dbSNP
rs937958199 800 dbSNP
rs1401882301 803 dbSNP
rs762234503 804 dbSNP
rs905189237 804 dbSNP
rs1198527170 806 dbSNP
rs1275212310 806 dbSNP
rs755556498 806 dbSNP
rs1218139296 808 dbSNP
rs1277769177 808 dbSNP
rs1381250423 808 dbSNP
rs1046341245 810 dbSNP
rs1477289817 810 dbSNP
rs59928879 810 dbSNP
rs1303272860 811 dbSNP
rs111482977 812 dbSNP
rs1360050189 812 dbSNP
rs1491104383 812 dbSNP
rs949394281 814 dbSNP
rs1329584582 816 dbSNP
rs1368426545 816 dbSNP
rs908603930 816 dbSNP
rs982853548 817 dbSNP
rs1005231001 818 dbSNP
rs754891507 823 dbSNP
rs879160621 827 dbSNP
rs1209939090 829 dbSNP
rs149970908 829 dbSNP
rs3837836 829 dbSNP
rs58481905 829 dbSNP
rs1388808482 832 dbSNP
rs1367423760 840 dbSNP
rs554457992 848 dbSNP
rs1049368210 851 dbSNP
rs1377280678 852 dbSNP
rs1448738832 853 dbSNP
rs1162082613 855 dbSNP
rs1316305095 861 dbSNP
rs1244848471 864 dbSNP
rs1353800434 865 dbSNP
rs1208936742 866 dbSNP
rs920123251 872 dbSNP
rs933932979 880 dbSNP
rs1426133321 883 dbSNP
rs922539285 884 dbSNP
rs1415169850 888 dbSNP
rs1238058945 889 dbSNP
rs1053404713 893 dbSNP
rs1166973168 894 dbSNP
rs1182002272 902 dbSNP
rs1482298495 903 dbSNP
rs1457474857 905 dbSNP
rs1171582833 911 dbSNP
rs1402762662 915 dbSNP
rs1448673410 917 dbSNP
rs934517930 928 dbSNP
rs925746490 930 dbSNP
rs1206201912 931 dbSNP
rs775534610 934 dbSNP
rs534903450 935 dbSNP
rs1396591024 938 dbSNP
rs915941766 939 dbSNP
rs1314238886 943 dbSNP
rs1338121690 947 dbSNP
rs1232162982 948 dbSNP
rs369557079 951 dbSNP
rs765585314 956 dbSNP
rs1197106112 957 dbSNP
rs1257874615 960 dbSNP
rs987108405 962 dbSNP
rs1184039072 972 dbSNP
rs960607592 980 dbSNP
rs758918610 981 dbSNP
rs1426016534 984 dbSNP
rs1020695843 986 dbSNP
rs972692357 988 dbSNP
rs565653627 994 dbSNP
rs1353773051 1001 dbSNP
rs1466361660 1002 dbSNP
rs957887343 1005 dbSNP
rs1032628776 1012 dbSNP
rs1413583779 1018 dbSNP
rs548939952 1020 dbSNP
rs1341963694 1022 dbSNP
rs963592287 1029 dbSNP
rs1313352456 1032 dbSNP
rs1216475961 1038 dbSNP
rs1016364539 1039 dbSNP
rs1294413892 1040 dbSNP
rs372006844 1044 dbSNP
rs1212712069 1045 dbSNP
rs565939352 1047 dbSNP
rs770309861 1048 dbSNP
rs1410123249 1050 dbSNP
rs1389546729 1071 dbSNP
rs1013522090 1074 dbSNP
rs1476959325 1075 dbSNP
rs1291369109 1080 dbSNP
rs997862138 1081 dbSNP
rs900798109 1097 dbSNP
rs368250400 1117 dbSNP
rs920026337 1124 dbSNP
rs776222291 1125 dbSNP
rs538816508 1127 dbSNP
rs1434078716 1138 dbSNP
rs904379521 1139 dbSNP
rs1471886661 1142 dbSNP
rs761930872 1145 dbSNP
rs1287876834 1149 dbSNP
rs1042897646 1155 dbSNP
rs1183349141 1156 dbSNP
rs1221266957 1159 dbSNP
rs948816157 1160 dbSNP
rs151087663 1162 dbSNP
rs746671795 1165 dbSNP
rs1288783168 1169 dbSNP
rs993283010 1176 dbSNP
rs987072329 1201 dbSNP
rs1215180342 1203 dbSNP
rs938704521 1207 dbSNP
rs1489610918 1209 dbSNP
rs954346228 1219 dbSNP
rs913601877 1221 dbSNP
rs1159118732 1223 dbSNP
rs1382124140 1224 dbSNP
rs1417277812 1227 dbSNP
rs1157786546 1235 dbSNP
rs1265552149 1253 dbSNP
rs1350089350 1255 dbSNP
rs371691378 1259 dbSNP
rs1488860799 1266 dbSNP
rs972362476 1270 dbSNP
rs1292147022 1271 dbSNP
rs1370624056 1271 dbSNP
rs142928957 1276 dbSNP
rs1447996792 1280 dbSNP
rs12449732 1283 dbSNP
rs1312032635 1288 dbSNP
rs1260196776 1294 dbSNP
rs1223265376 1296 dbSNP
rs531757311 1297 dbSNP
rs1290743651 1298 dbSNP
rs567639156 1301 dbSNP
rs957986543 1307 dbSNP
rs566600577 1308 dbSNP
rs772908913 1310 dbSNP
rs1179056477 1313 dbSNP
rs1239900070 1317 dbSNP
rs1290041331 1321 dbSNP
rs1228789789 1322 dbSNP
rs986256538 1338 dbSNP
rs1298776553 1344 dbSNP
rs529254626 1345 dbSNP
rs1388104649 1352 dbSNP
rs71651947 1358 dbSNP
rs768987798 1360 dbSNP
rs953838436 1364 dbSNP
rs1024835425 1365 dbSNP
rs368843991 1366 dbSNP
rs887108639 1372 dbSNP
rs186897947 1373 dbSNP
rs1375302918 1374 dbSNP
rs1442193803 1382 dbSNP
rs1449441868 1390 dbSNP
rs1381344475 1395 dbSNP
rs1226704436 1397 dbSNP
rs1391456944 1405 dbSNP
rs1272736244 1406 dbSNP
rs1318920699 1407 dbSNP
rs1199013800 1410 dbSNP
rs1259814074 1413 dbSNP
rs900853121 1415 dbSNP
rs528010946 1419 dbSNP
rs560830882 1420 dbSNP
rs1201340668 1429 dbSNP
rs1185203875 1431 dbSNP
rs80038530 1439 dbSNP
rs140353172 1443 dbSNP
rs912761781 1446 dbSNP
rs1394871771 1447 dbSNP
rs948537343 1451 dbSNP
rs894280479 1453 dbSNP
rs1051338236 1455 dbSNP
rs946318942 1458 dbSNP
rs1057230062 1461 dbSNP
rs913487327 1462 dbSNP
rs1269944041 1463 dbSNP
rs1292798194 1464 dbSNP
rs1341343602 1467 dbSNP
rs147595057 1478 dbSNP
rs780499501 1480 dbSNP
rs1205602011 1491 dbSNP
rs1344058547 1493 dbSNP
rs988177675 1500 dbSNP
rs1208075679 1501 dbSNP
rs1256264269 1503 dbSNP
rs1254005342 1520 dbSNP
rs1477941758 1521 dbSNP
rs938742524 1522 dbSNP
rs1370997890 1524 dbSNP
rs1475268288 1524 dbSNP
rs1235014687 1529 dbSNP
rs919289060 1530 dbSNP
rs1312410440 1539 dbSNP
rs1427839105 1541 dbSNP
rs533314347 1542 dbSNP
rs1312344207 1549 dbSNP
rs1432280667 1560 dbSNP
rs543079106 1561 dbSNP
rs9910055 1573 dbSNP
rs969619676 1574 dbSNP
rs781326107 1575 dbSNP
rs953558452 1579 dbSNP
rs923408335 1580 dbSNP
rs761260024 1583 dbSNP
rs976549827 1585 dbSNP
rs1279529122 1588 dbSNP
rs965486668 1591 dbSNP
rs560575146 1592 dbSNP
rs541295042 1593 dbSNP
rs1446115882 1599 dbSNP
rs1248884615 1601 dbSNP
rs772422849 1601 dbSNP
rs1452964275 1602 dbSNP
rs1173495343 1605 dbSNP
rs1031368818 1611 dbSNP
rs1030017369 1622 dbSNP
rs1421552284 1629 dbSNP
rs1156945506 1630 dbSNP
rs1384502173 1634 dbSNP
rs1025531465 1635 dbSNP
rs1193876209 1637 dbSNP
rs1372826714 1650 dbSNP
rs1438459467 1664 dbSNP
rs1441740937 1664 dbSNP
rs995891788 1690 dbSNP
rs1241653623 1697 dbSNP
rs898521957 1697 dbSNP
rs998518735 1698 dbSNP
rs542590858 1702 dbSNP
rs879037954 1706 dbSNP
rs1273473577 1710 dbSNP
rs1225682730 1716 dbSNP
rs757337389 1717 dbSNP
rs1343710049 1719 dbSNP
rs1012811285 1720 dbSNP
rs1467379413 1725 dbSNP
rs1193441324 1727 dbSNP
rs1239292059 1730 dbSNP
rs1442140975 1731 dbSNP
rs183279698 1742 dbSNP
rs1363366689 1744 dbSNP
rs1244782588 1749 dbSNP
rs1057350823 1750 dbSNP
rs1392583942 1755 dbSNP
rs1459647431 1756 dbSNP
rs1336651924 1757 dbSNP
rs1396973391 1759 dbSNP
rs1377534093 1760 dbSNP
rs1002989154 1764 dbSNP
rs1393135487 1765 dbSNP
rs891299323 1766 dbSNP
rs1051227337 1784 dbSNP
rs553988004 1787 dbSNP
rs1274617101 1804 dbSNP
rs192552176 1810 dbSNP
rs764448429 1811 dbSNP
rs942040872 1814 dbSNP
rs758222505 1818 dbSNP
rs538466653 1819 dbSNP
rs1459481038 1822 dbSNP
rs909186115 1825 dbSNP
rs577735934 1835 dbSNP
rs1472462370 1839 dbSNP
rs1366662878 1840 dbSNP
rs73316181 1841 dbSNP
rs923490748 1843 dbSNP
rs1424422376 1845 dbSNP
rs936316715 1851 dbSNP
rs1485894381 1860 dbSNP
rs1475036467 1861 dbSNP
rs568543384 1871 dbSNP
rs1163937938 1872 dbSNP
rs1400671941 1877 dbSNP
rs1463341802 1882 dbSNP
rs1296328253 1886 dbSNP
rs1395717547 1889 dbSNP
rs367796281 1890 dbSNP
rs1396072323 1901 dbSNP
rs976647211 1905 dbSNP
rs1294653230 1906 dbSNP
rs925006019 1910 dbSNP
rs763232106 1915 dbSNP
rs1232376261 1919 dbSNP
rs1202635444 1930 dbSNP
rs1278447588 1932 dbSNP
rs1309574976 1933 dbSNP
rs965196672 1940 dbSNP
rs980926521 1952 dbSNP
rs947767773 1956 dbSNP
rs924357379 1964 dbSNP
rs991923436 1967 dbSNP
rs951233618 1974 dbSNP
rs1273166526 1975 dbSNP
rs1426074897 1980 dbSNP
rs1430037516 1992 dbSNP
rs1168102974 1993 dbSNP
rs1025961573 1995 dbSNP
rs977286809 1998 dbSNP
rs538371018 2005 dbSNP
rs144994852 2008 dbSNP
rs1413647337 2009 dbSNP
rs1286494646 2014 dbSNP
rs1007307287 2018 dbSNP
rs1208933335 2022 dbSNP
rs549441402 2022 dbSNP
rs891183297 2024 dbSNP
rs1029766068 2026 dbSNP
rs1010386030 2031 dbSNP
rs1237056082 2046 dbSNP
rs1012563082 2047 dbSNP
rs1278828145 2050 dbSNP
rs1347177561 2053 dbSNP
rs1217475813 2058 dbSNP
rs747118278 2061 dbSNP
rs891992371 2070 dbSNP
rs1350303925 2075 dbSNP
rs1035410107 2076 dbSNP
rs1003036797 2077 dbSNP
rs1433565555 2078 dbSNP
rs897610711 2093 dbSNP
rs1175375462 2097 dbSNP
rs1393220106 2099 dbSNP
rs368968434 2104 dbSNP
rs1433518023 2109 dbSNP
rs1411984776 2113 dbSNP
rs1371390377 2119 dbSNP
rs1428293077 2129 dbSNP
rs1036927504 2154 dbSNP
rs906110534 2157 dbSNP
rs118019638 2158 dbSNP
rs1403681994 2162 dbSNP
rs947735320 2175 dbSNP
rs1392919919 2177 dbSNP
rs759526399 2186 dbSNP
rs1164956562 2197 dbSNP
rs1475482465 2201 dbSNP
rs1056163286 2203 dbSNP
rs200146260 2203 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuugugguaacagUGUGAGGu 5'
Target 5' --------------ACACUCCc 3'
1 - 8
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000343638.5 | 3UTR | ACACUCCCCACUCCCAUUCCCCUUCCUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
Your e-Mail*