miRTarBase - #MIRT497776 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIAA0895   
Synonyms -
Description KIAA0895
Transcript NM_001100425   
Other Transcripts NM_015314   
Expression
Putative miRNA Targets on KIAA0895
3'UTR of KIAA0895
(miRNA target sites are highlighted)
>KIAA0895|NM_001100425|3'UTR
   1 TAATTAGCGTTCTGGCAAACATAGCTAAGCTATGCCTCCATGTATATTACCAGTTAGGTGCAGTTAGCACCAGAAGATTT
  81 ATAAAAGAAGAAAGACTACTTGTGTTTTCTGAAGAAGGGTCTTCAGTATTCAGCGGAATTTTTAGGTTAAGTACAGATCT
 161 TAAACTATTTCCCTAAAATGTTTCTATAGGTTGCAGGGGGAAGTTATTCCTATTTTCTGAATCTCGACAGAGTCAGATGA
 241 AAATACTACTGCTGAGCATTTTTGAAGACTCTTGGTCAAATTGCATGATAAATTTCTGCCTGAGCAGTAAGCACTGGCCT
 321 AGTGCTTCTGCCTAAATATGGAGGTCAGCTCCAACTGGAGACTGGCTGAATTCCATTGCTGTTCAGACTCCAAAGTTATA
 401 TTTTATTTGATAAATAATGGTAATTATTCTCCTTTGAAAAATTAGTTTTGTGTTGCTCCAAAAAGCTAGCTATATATCTC
 481 AGCTTTCTTATTTCTTTTATATGTTGAGGGATTTTAAAGGGAGAGGAAAAGCAATTTGAAAATTTTTCATTAAGTGTTTT
 561 ATTTTAACATTATTGTTTCACCTTATCAGCTTATAGGAACTAAATTAGAGAATCACCTCTTTTTGTCCGGTTATCTCTTA
 641 ACTATGTTTTCATTTGCTGAAACATATTGTACCCTTTTAAATTTTTTACAGAGTTTTAACGTCTTTTCCACTGCATCCTT
 721 TATAAAAATAAGTACAAATTCCAGAGAGGTTTTCCTACACAAATACAAAATAATTGGGGAAGGGCTACTCACCTTTTTTA
 801 TGAAACAGAATATGTAACAAGCAGAGGACAAATAGACTGACCTGGTTAAACGTAGGTTCTGGATGTTGATGGGTAGCACC
 881 TGCAGTAAACTTGACCATGCTCTGAAAAAAGAAATTTCTGGGTATTGATGGTTTATAAAGCCAGCTTTGTGCTATTGGTT
 961 CAGTATATTTTATCAAATCTTTGACTTCATCAACCCAGTAATGACATAGTTTAAATTTTAAAATGAGAGTTCTGTTTTGC
1041 TGTATTTCTCCTGCTAGCCTAGCTTTGTATTTTATCATCAGCTTCAGTATATACTTGTATATATATACCTGGATTCAAAT
1121 GGTTCTTCATACAACTTAATGATCAGAAAGAATGCTGCTGTAAACACCCCACTCAAGATTGCTGCTGGAATTTCTACCCA
1201 AAGCTGTCTGAGAGTTTATCTTTACCTCAGTGCAGGCTTAAATAATGGTGCTAATACTGGTAGATATATACTGTGAAGCC
1281 TGGTTCACATTCATGCTAGAAAATGATTTTGGGAAATCTTTTATAGGAGAGGTTACATGATTTTTCTCTTTCACATATCT
1361 AGAAGGACTTGCCTCAAAGAAGAATGTTGCAGCAAACAGGATATACTCTAGCTGGTGCCCAAAGGTTCTTGCAAAACCAT
1441 GAATCTTGCTTTTAGCAGTAAAGGGCCAGACACTTTGGAGCATTGAAAGGCCTTAGCCCCTGCTCCCCAACTACGTGCCA
1521 TGCTGGGTAGTGTGTATCCTGTACATCTGTGTGCCAGGCTGGGGCAGACTGTGCCAATGCTCACCGAACACTAGAATCTG
1601 CTCTTACACCTCTAGCATGTATCTCGTTGTAGCAGAGTTGTGCACTTTCTCAGCATTGTGTAGTGTTTTCTAATTGCATC
1681 TAAAAACTTATCAAAAGTGATTGTGAAAACAGTGTCTTAGAAGTATAAACAGAAATGGCAATATTTATGTCCTGTGATTC
1761 AAGCCCAAAGGTTATAAATTCAACTTTCACAGGGAATAGCACTGCTAATCTTACTTTATGATTTAAATATAAAGGAAAAT
1841 CACAGCAGCCTTAATTTCCTGTTGGTCGGATCATTTGCAGCAGTTCTAGTTCCTGACTTTTAAAATGGATGAAATTTTCT
1921 CTTTGTCTGATTTGGAAAAGGAACTGCTTTTTTGCCTTACTGCTTTGGTATAAGGATGAAAAACATGAGCACTCTGCAGA
2001 CAAAATGACCTTAAATCACATTGATTAAGATATTTTAAAAGTTAGCAGTGAACCAAAAGTAGTTTCAGATTAGCAGAAAT
2081 AAAGAGCTTTAAGTTTTAAAAGTTGAGATTGAATATTTAATGAAAGTTTATTAATTCTTTTTCCAGGAATAGCAGTAAGG
2161 TCAGTTTTTTTCCCTAAAATAAAAAGTTTTAATAAACAGAAAATTATAGCAACAGTACTTAGGAGAATAGTTGAAGATTG
2241 TATTAATTTTAATTATAATAGTTATTTGTCATAGGCTATTGATGATTAGAATTTCATTAGTTTTGTCCACTATAATTTTA
2321 AAAATAGTTGTGTCAAATACAAATTCTGGTAAACTGTTAGGTTTTAACACCAGACAGTATTCAAAGGAAATTAATGTTTG
2401 CAAACATAAATCCATAGTCTTCATTTCTTTATATTGTCACCTTTGTAAAAGTGTTTAAAATTTGTATTGTTTGTTTTGTA
2481 TATCTTTGGGCATCTTGTGTCTAGCTATAATAAAAAGAAACGGTGCCAAGGTTCTCAGATGAAGTGTGTGGCTATGTATG
2561 CATGTAACTTGGTTTCTTTGAAAACCCAATTATATTTGTATTGTGGTGTTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGU-AAUACACGACGAu 5'
             |||::| || ||||:|||| 
Target 5' gaaAAATTAGTTTTGTGTTGCTc 3'
436 - 458 155.00 -13.00
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            | | :||  || ||||||| 
Target 5' ccCCACTCAAGAT-TGCTGCTg 3'
1167 - 1187 151.00 -12.40
3
miRNA  3' guguUUGGUAAUAC--ACGACGAu 5'
              :|:||  | |  ||||||| 
Target 5' taatGATCAGAAAGAATGCTGCTg 3'
1137 - 1160 148.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26981349 8 COSMIC
COSN31582396 9 COSMIC
COSN30129825 30 COSMIC
COSN30457322 36 COSMIC
COSN30512195 39 COSMIC
COSN2528816 57 COSMIC
COSN30447774 71 COSMIC
COSN31517073 87 COSMIC
COSN30100695 102 COSMIC
COSN31566636 129 COSMIC
COSN29643417 1681 COSMIC
COSN14669874 2414 COSMIC
COSN27677830 2526 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1245408088 2 dbSNP
rs1408804069 4 dbSNP
rs373694114 5 dbSNP
rs749418966 7 dbSNP
rs542093919 8 dbSNP
rs199697018 9 dbSNP
rs1288157300 11 dbSNP
rs985340352 12 dbSNP
rs943237373 17 dbSNP
rs1224385923 20 dbSNP
rs1391606731 20 dbSNP
rs564281731 21 dbSNP
rs775271318 22 dbSNP
rs764647615 25 dbSNP
rs1443536720 31 dbSNP
rs1390374181 37 dbSNP
rs370697170 39 dbSNP
rs1486189162 42 dbSNP
rs759542582 44 dbSNP
rs765885287 45 dbSNP
rs377192198 46 dbSNP
rs1261470911 47 dbSNP
rs1195731065 56 dbSNP
rs756555373 57 dbSNP
rs919278092 99 dbSNP
rs541417164 100 dbSNP
rs147763188 103 dbSNP
rs556087991 119 dbSNP
rs1413126396 121 dbSNP
rs1333999485 131 dbSNP
rs1162896544 134 dbSNP
rs1020663531 135 dbSNP
rs1296842278 139 dbSNP
rs542576819 146 dbSNP
rs981042171 154 dbSNP
rs1009492604 157 dbSNP
rs79773296 167 dbSNP
rs556739900 186 dbSNP
rs539126969 190 dbSNP
rs196654 191 dbSNP
rs761932676 197 dbSNP
rs1477438693 198 dbSNP
rs957134738 199 dbSNP
rs1218747657 200 dbSNP
rs1260877559 201 dbSNP
rs760721982 201 dbSNP
rs1200936505 204 dbSNP
rs1476864751 205 dbSNP
rs1171606730 207 dbSNP
rs1449387773 208 dbSNP
rs1288616997 212 dbSNP
rs1409210560 221 dbSNP
rs775373002 226 dbSNP
rs1340433676 227 dbSNP
rs922934791 231 dbSNP
rs1217228340 232 dbSNP
rs1406080578 237 dbSNP
rs1305092596 242 dbSNP
rs1329399779 248 dbSNP
rs998557930 258 dbSNP
rs187077201 269 dbSNP
rs1373816620 274 dbSNP
rs1241976828 276 dbSNP
rs772000629 277 dbSNP
rs746087772 285 dbSNP
rs1352984448 291 dbSNP
rs1223118570 296 dbSNP
rs1329451839 299 dbSNP
rs888960287 301 dbSNP
rs1449336201 306 dbSNP
rs182078934 309 dbSNP
rs1894877 310 dbSNP
rs958855202 317 dbSNP
rs897941701 330 dbSNP
rs1380058255 336 dbSNP
rs1036396111 343 dbSNP
rs939386178 344 dbSNP
rs927944734 346 dbSNP
rs867309170 352 dbSNP
rs1168272704 354 dbSNP
rs1388713081 355 dbSNP
rs927420500 358 dbSNP
rs1379312329 361 dbSNP
rs1444837454 370 dbSNP
rs1236635569 374 dbSNP
rs1429836776 375 dbSNP
rs1375835419 376 dbSNP
rs1045730432 399 dbSNP
rs1285829924 399 dbSNP
rs1353658750 406 dbSNP
rs1178502576 407 dbSNP
rs376961191 417 dbSNP
rs548058257 419 dbSNP
rs1476731270 425 dbSNP
rs1245645609 427 dbSNP
rs1237998700 435 dbSNP
rs981491677 440 dbSNP
rs1190255878 442 dbSNP
rs971418126 445 dbSNP
rs546753537 461 dbSNP
rs1168632841 462 dbSNP
rs1010632165 467 dbSNP
rs149663178 472 dbSNP
rs1032662754 474 dbSNP
rs139486352 477 dbSNP
rs888950801 493 dbSNP
rs34466907 539 dbSNP
rs924396889 542 dbSNP
rs997275045 543 dbSNP
rs1243955713 547 dbSNP
rs150689669 552 dbSNP
rs1036051949 556 dbSNP
rs530816315 556 dbSNP
rs940336101 575 dbSNP
rs966109095 576 dbSNP
rs748667038 592 dbSNP
rs1442408072 594 dbSNP
rs868006038 596 dbSNP
rs1049296533 599 dbSNP
rs1018584505 616 dbSNP
rs1476852918 618 dbSNP
rs1007907404 625 dbSNP
rs1264257736 627 dbSNP
rs1221457488 628 dbSNP
rs191203190 629 dbSNP
rs1027514113 630 dbSNP
rs1399764731 635 dbSNP
rs1274304025 644 dbSNP
rs1298693435 645 dbSNP
rs1341861469 654 dbSNP
rs927471446 655 dbSNP
rs1277189648 661 dbSNP
rs1312480375 663 dbSNP
rs1234944639 668 dbSNP
rs994662985 669 dbSNP
rs1344718658 672 dbSNP
rs981544213 673 dbSNP
rs1443112419 674 dbSNP
rs1487352008 676 dbSNP
rs1193123559 679 dbSNP
rs552879406 681 dbSNP
rs1435178268 682 dbSNP
rs1329582708 688 dbSNP
rs1445677356 700 dbSNP
rs781467927 701 dbSNP
rs1159197462 710 dbSNP
rs1362312163 713 dbSNP
rs1417787072 715 dbSNP
rs1297107080 718 dbSNP
rs1036406106 721 dbSNP
rs1336035665 725 dbSNP
rs1298690071 728 dbSNP
rs866093202 732 dbSNP
rs1003593391 734 dbSNP
rs950157799 749 dbSNP
rs906538936 768 dbSNP
rs1288596224 774 dbSNP
rs1352221497 784 dbSNP
rs527674223 792 dbSNP
rs988857879 800 dbSNP
rs1266149303 801 dbSNP
rs1045097434 812 dbSNP
rs755399767 820 dbSNP
rs1378028830 827 dbSNP
rs1177660283 840 dbSNP
rs750029007 851 dbSNP
rs915532481 852 dbSNP
rs1157945611 865 dbSNP
rs1457561335 871 dbSNP
rs1032300810 872 dbSNP
rs1458940788 875 dbSNP
rs1244107050 879 dbSNP
rs770081597 881 dbSNP
rs1389651395 884 dbSNP
rs1054041103 889 dbSNP
rs367703812 891 dbSNP
rs935489727 895 dbSNP
rs924073360 896 dbSNP
rs1311979335 897 dbSNP
rs1441193025 900 dbSNP
rs1278612374 909 dbSNP
rs1240098941 911 dbSNP
rs1313997731 932 dbSNP
rs1323599421 935 dbSNP
rs1224357049 954 dbSNP
rs979346133 957 dbSNP
rs1264938093 958 dbSNP
rs776688664 963 dbSNP
rs1458432148 964 dbSNP
rs1200735707 965 dbSNP
rs977588371 966 dbSNP
rs1437549773 977 dbSNP
rs1177962721 983 dbSNP
rs1355947138 995 dbSNP
rs1425481444 1011 dbSNP
rs1162156836 1014 dbSNP
rs1367351818 1019 dbSNP
rs562095417 1024 dbSNP
rs965800409 1026 dbSNP
rs1028844470 1031 dbSNP
rs530804593 1034 dbSNP
rs985842105 1035 dbSNP
rs953153402 1040 dbSNP
rs1382052723 1054 dbSNP
rs1227096244 1055 dbSNP
rs1312160876 1058 dbSNP
rs1318663234 1058 dbSNP
rs1027566231 1063 dbSNP
rs142012964 1066 dbSNP
rs994672894 1074 dbSNP
rs1203640807 1082 dbSNP
rs576717206 1086 dbSNP
rs1237824330 1087 dbSNP
rs770609605 1089 dbSNP
rs764987268 1099 dbSNP
rs1004591490 1101 dbSNP
rs576824462 1104 dbSNP
rs188730350 1105 dbSNP
rs887441281 1108 dbSNP
rs906649910 1108 dbSNP
rs1491297442 1109 dbSNP
rs1045550729 1112 dbSNP
rs139652988 1138 dbSNP
rs1358099523 1139 dbSNP
rs1361242180 1150 dbSNP
rs1446513138 1154 dbSNP
rs146370648 1155 dbSNP
rs753344413 1157 dbSNP
rs1444834832 1160 dbSNP
rs935540627 1161 dbSNP
rs563634114 1164 dbSNP
rs575043591 1167 dbSNP
rs760626243 1170 dbSNP
rs1045902007 1172 dbSNP
rs944190140 1188 dbSNP
rs1279109514 1190 dbSNP
rs879542962 1207 dbSNP
rs1313696298 1211 dbSNP
rs184173552 1218 dbSNP
rs775640614 1228 dbSNP
rs1489286292 1233 dbSNP
rs1488336183 1234 dbSNP
rs1260395497 1235 dbSNP
rs1474908520 1257 dbSNP
rs989299846 1259 dbSNP
rs142004611 1264 dbSNP
rs1283948691 1269 dbSNP
rs1427733547 1272 dbSNP
rs1216038514 1282 dbSNP
rs986280306 1292 dbSNP
rs1360434918 1299 dbSNP
rs554157345 1316 dbSNP
rs1175994872 1328 dbSNP
rs936061127 1333 dbSNP
rs925955326 1335 dbSNP
rs1339896790 1336 dbSNP
rs985431000 1339 dbSNP
rs953297786 1342 dbSNP
rs1369478744 1346 dbSNP
rs553412464 1349 dbSNP
rs1378212792 1354 dbSNP
rs931650145 1355 dbSNP
rs1270645393 1359 dbSNP
rs767409222 1372 dbSNP
rs113760738 1377 dbSNP
rs1338387357 1380 dbSNP
rs1218682694 1390 dbSNP
rs1297033913 1397 dbSNP
rs1424807479 1403 dbSNP
rs973305010 1404 dbSNP
rs1351197189 1405 dbSNP
rs961909686 1408 dbSNP
rs1445878001 1411 dbSNP
rs1015244162 1413 dbSNP
rs1162258830 1414 dbSNP
rs982004755 1422 dbSNP
rs1403918237 1432 dbSNP
rs1413556754 1446 dbSNP
rs1248036951 1450 dbSNP
rs970966417 1453 dbSNP
rs1023725015 1454 dbSNP
rs1477248385 1454 dbSNP
rs1381286901 1458 dbSNP
rs966268358 1460 dbSNP
rs542975685 1466 dbSNP
rs372044871 1473 dbSNP
rs563204906 1473 dbSNP
rs759456362 1473 dbSNP
rs887505327 1476 dbSNP
rs760550002 1483 dbSNP
rs866684576 1489 dbSNP
rs1032320184 1490 dbSNP
rs1261742823 1509 dbSNP
rs1377327132 1511 dbSNP
rs999509543 1514 dbSNP
rs371203614 1515 dbSNP
rs1045956228 1520 dbSNP
rs1041685018 1555 dbSNP
rs1321400437 1561 dbSNP
rs191483706 1562 dbSNP
rs1209847011 1565 dbSNP
rs889911180 1577 dbSNP
rs1053258015 1582 dbSNP
rs1212646593 1584 dbSNP
rs196653 1586 dbSNP
rs926004560 1589 dbSNP
rs1220305861 1591 dbSNP
rs1363658479 1598 dbSNP
rs1165134765 1606 dbSNP
rs1473408553 1606 dbSNP
rs1411695455 1608 dbSNP
rs538820595 1618 dbSNP
rs771145774 1625 dbSNP
rs566586078 1626 dbSNP
rs1404956110 1642 dbSNP
rs1326777088 1647 dbSNP
rs773285293 1652 dbSNP
rs973073634 1654 dbSNP
rs932630458 1679 dbSNP
rs1285485864 1680 dbSNP
rs1353591128 1687 dbSNP
rs1232319799 1691 dbSNP
rs1258239124 1694 dbSNP
rs1320450151 1696 dbSNP
rs1250243953 1697 dbSNP
rs747592145 1699 dbSNP
rs1369137746 1702 dbSNP
rs940356079 1710 dbSNP
rs1443549859 1732 dbSNP
rs1291385394 1736 dbSNP
rs1435286299 1738 dbSNP
rs186854001 1741 dbSNP
rs1474895812 1751 dbSNP
rs976407655 1766 dbSNP
rs1425972090 1767 dbSNP
rs181649531 1783 dbSNP
rs970595186 1785 dbSNP
rs1023862004 1792 dbSNP
rs769867357 1798 dbSNP
rs1396565150 1799 dbSNP
rs1336033968 1802 dbSNP
rs983279737 1805 dbSNP
rs1353036472 1809 dbSNP
rs990922210 1819 dbSNP
rs958132900 1822 dbSNP
rs951912421 1824 dbSNP
rs1032414877 1829 dbSNP
rs999560464 1833 dbSNP
rs117192570 1837 dbSNP
rs1251147595 1847 dbSNP
rs1346101602 1848 dbSNP
rs1001193076 1857 dbSNP
rs969695898 1858 dbSNP
rs1485390443 1860 dbSNP
rs1194564287 1861 dbSNP
rs1023886258 1867 dbSNP
rs559905525 1868 dbSNP
rs781706558 1873 dbSNP
rs1372308075 1877 dbSNP
rs892019337 1881 dbSNP
rs1174251835 1894 dbSNP
rs1008860983 1900 dbSNP
rs1434009647 1900 dbSNP
rs1298332725 1902 dbSNP
rs1341804683 1914 dbSNP
rs531865135 1915 dbSNP
rs1053715290 1919 dbSNP
rs1294348530 1923 dbSNP
rs1269529517 1924 dbSNP
rs1235802020 1925 dbSNP
rs889972961 1928 dbSNP
rs1347868851 1930 dbSNP
rs1217948081 1931 dbSNP
rs190076943 1938 dbSNP
rs185709558 1946 dbSNP
rs180875230 1949 dbSNP
rs138857910 1957 dbSNP
rs1435122579 1958 dbSNP
rs1200806317 1966 dbSNP
rs1169965229 1970 dbSNP
rs189620106 1974 dbSNP
rs1159140599 1976 dbSNP
rs1361925688 1991 dbSNP
rs944637653 1993 dbSNP
rs1257296947 1997 dbSNP
rs1224076590 1998 dbSNP
rs907764605 2004 dbSNP
rs907499975 2006 dbSNP
rs780310122 2007 dbSNP
rs1301763261 2020 dbSNP
rs1370661306 2023 dbSNP
rs1218202700 2046 dbSNP
rs1312020121 2049 dbSNP
rs1315199677 2058 dbSNP
rs1373593260 2062 dbSNP
rs1266095268 2077 dbSNP
rs949305691 2086 dbSNP
rs916483543 2087 dbSNP
rs990681740 2094 dbSNP
rs957849773 2121 dbSNP
rs1250943257 2126 dbSNP
rs1467828358 2134 dbSNP
rs951875814 2137 dbSNP
rs925397706 2141 dbSNP
rs1382027309 2142 dbSNP
rs978131577 2161 dbSNP
rs1368521453 2171 dbSNP
rs1323415974 2172 dbSNP
rs920387300 2172 dbSNP
rs966741884 2185 dbSNP
rs1331156521 2188 dbSNP
rs1466977091 2190 dbSNP
rs1379948803 2195 dbSNP
rs571856850 2196 dbSNP
rs1333782717 2198 dbSNP
rs1371880136 2206 dbSNP
rs1008495502 2213 dbSNP
rs1174024074 2216 dbSNP
rs979826564 2222 dbSNP
rs1323541178 2228 dbSNP
rs1231710834 2231 dbSNP
rs1272719814 2236 dbSNP
rs1333893613 2238 dbSNP
rs574200946 2241 dbSNP
rs554095957 2255 dbSNP
rs969746666 2257 dbSNP
rs1024404696 2259 dbSNP
rs1424980038 2260 dbSNP
rs544626603 2260 dbSNP
rs1432683539 2265 dbSNP
rs1416797183 2268 dbSNP
rs1013898945 2278 dbSNP
rs1028526330 2279 dbSNP
rs1381076859 2287 dbSNP
rs995673716 2291 dbSNP
rs185497533 2294 dbSNP
rs1303889033 2295 dbSNP
rs143304862 2306 dbSNP
rs1412940814 2308 dbSNP
rs558221937 2310 dbSNP
rs1220673568 2314 dbSNP
rs1274907848 2327 dbSNP
rs1200868527 2328 dbSNP
rs879844969 2345 dbSNP
rs904694871 2350 dbSNP
rs1256443611 2351 dbSNP
rs1028460542 2356 dbSNP
rs1185235440 2359 dbSNP
rs1256165856 2362 dbSNP
rs777420969 2369 dbSNP
rs886125254 2372 dbSNP
rs538586849 2373 dbSNP
rs1046510949 2378 dbSNP
rs1417843001 2380 dbSNP
rs949068271 2399 dbSNP
rs182506492 2406 dbSNP
rs1310946774 2415 dbSNP
rs1237477386 2418 dbSNP
rs1055043499 2423 dbSNP
rs936492220 2439 dbSNP
rs370691082 2440 dbSNP
rs1312409532 2441 dbSNP
rs1041465280 2449 dbSNP
rs1402118121 2450 dbSNP
rs1268577424 2452 dbSNP
rs190485548 2453 dbSNP
rs1397033785 2455 dbSNP
rs1301700492 2457 dbSNP
rs1350023719 2462 dbSNP
rs1208602105 2464 dbSNP
rs1404903626 2478 dbSNP
rs886390962 2480 dbSNP
rs377182970 2482 dbSNP
rs1239937627 2486 dbSNP
rs1474875664 2489 dbSNP
rs978182489 2490 dbSNP
rs1361267811 2492 dbSNP
rs1397250577 2499 dbSNP
rs1047640703 2512 dbSNP
rs577171292 2521 dbSNP
rs967170650 2521 dbSNP
rs184226148 2522 dbSNP
rs979875891 2528 dbSNP
rs568573127 2531 dbSNP
rs780654413 2536 dbSNP
rs1438034360 2537 dbSNP
rs1372857794 2538 dbSNP
rs1379995674 2539 dbSNP
rs548747637 2540 dbSNP
rs1302517047 2551 dbSNP
rs1187986340 2564 dbSNP
rs1353806237 2570 dbSNP
rs1225037361 2580 dbSNP
rs954070823 2582 dbSNP
rs1446121011 2586 dbSNP
rs1425352048 2587 dbSNP
rs992937329 2588 dbSNP
rs1255324014 2591 dbSNP
rs1028536107 2598 dbSNP
rs955728529 2606 dbSNP
rs866178830 2608 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL35
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1020022. RNA binding protein: AGO2. Condition:EBV B95-8-infected, 4-thiouridine, RNase T1 ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                :||  || ||||||| 
Target 5' ------UCAAGAU-UGCUGCUg 3'
1 - 15
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020022
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL35 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000297063.6 | 3UTR | UCAAGAUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.618 1.8e-3 -0.072 3.8e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.437 1.4e-2 0.247 1.2e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.468 6.2e-2 0.168 3.0e-1 12 Click to see details
GSE21032 Prostate cancer -0.163 7.0e-2 -0.175 5.7e-2 83 Click to see details
GSE26953 Aortic valvular endothelial cells 0.227 1.4e-1 0.049 4.1e-1 24 Click to see details
GSE19536 Breast cancer 0.091 1.8e-1 0.036 3.6e-1 100 Click to see details
GSE17498 Multiple myeloma -0.144 1.9e-1 -0.049 3.8e-1 40 Click to see details
GSE28544 Breast cancer -0.176 2.1e-1 -0.503 6.1e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.177 2.3e-1 -0.143 2.7e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.145 2.5e-1 0.235 1.4e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.197 2.6e-1 -0.236 2.2e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.163 2.7e-1 -0.144 3.0e-1 16 Click to see details
GSE21687 Ependynoma primary tumors 0.075 2.8e-1 0.074 2.8e-1 64 Click to see details
GSE19783 ER- ER- breast cancer 0.064 2.9e-1 0.046 3.4e-1 79 Click to see details
GSE32688 Pancreatic cancer -0.094 3.0e-1 -0.068 3.6e-1 32 Click to see details
GSE17306 Multiple myeloma 0.071 3.1e-1 0.133 1.8e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.049 3.2e-1 0.098 1.8e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.087 3.4e-1 0.250 1.1e-1 25 Click to see details
GSE38226 Liver fibrosis -0.077 3.7e-1 -0.050 4.1e-1 21 Click to see details
GSE38226 Liver fibrosis -0.077 3.7e-1 -0.050 4.1e-1 21 Click to see details
GSE38226 Liver fibrosis -0.077 3.7e-1 -0.050 4.1e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.421 0 -0.353 0 84 Click to see details
BLCA -0.625 0 -0.585 0.01 18 Click to see details
LUAD -0.641 0.01 -0.559 0.03 12 Click to see details
PAAD -0.97 0.02 -0.800 0.1 4 Click to see details
THCA -0.28 0.02 -0.296 0.01 59 Click to see details
HNSC -0.221 0.08 -0.255 0.05 42 Click to see details
KIRP -0.22 0.11 -0.265 0.07 32 Click to see details
STAD -0.158 0.19 -0.143 0.22 32 Click to see details
KIRC -0.104 0.2 -0.097 0.22 68 Click to see details
COAD -0.344 0.2 -0.786 0.01 8 Click to see details
ESCA -0.254 0.23 -0.400 0.11 11 Click to see details
LUSC -0.067 0.34 -0.098 0.28 38 Click to see details
KICH -0.083 0.35 0.044 0.42 25 Click to see details
PCPG -0.46 0.35 -0.500 0.33 3 Click to see details
UCEC -0.088 0.36 -0.072 0.38 19 Click to see details
CHOL 0.077 0.42 0.217 0.29 9 Click to see details
CESC 0.226 0.43 0.500 0.33 3 Click to see details
PRAD -0.001 0.5 0.004 0.49 50 Click to see details
PRAD -0.001 0.5 0.004 0.49 50 Click to see details
PRAD -0.001 0.5 0.004 0.49 50 Click to see details
LIHC 0 0.5 -0.028 0.42 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*