miRTarBase - #MIRT500014 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ABCF2   
Synonyms ABC28, EST133090, HUSSY-18, HUSSY18
Description ATP binding cassette subfamily F member 2
Transcript NM_007189   
Other Transcripts NM_005692   
Expression
Putative miRNA Targets on ABCF2
3'UTR of ABCF2
(miRNA target sites are highlighted)
>ABCF2|NM_007189|3'UTR
   1 GCCCTCTACCTGGGTTCGGGTCAGGAGCTCCATCTGGGAACTAACAGCTGCTAACCTGACCAGCCGCTCAGGACAGGACC
  81 CTGGGGCTACACTCCTGCATTGCTGCAATACTGCTCCCCCAGCCTCTCCCCTGCCCCTCAACCTGCCTTAGCTGCACTCT
 161 CTTACCTACAGCTGGACAGTACCTGTCTGTTTCCTGTCCTCCTTCCAGTTACATCTGTCCATGTCTGGACTCGGCTGGCC
 241 GTTCCCTCCAGCCCCTTGCTGGTTATCTTACTCTGAGTGTGATGCAGTCAGAGGCACCTGCGGGTTAGCCCAGGGGCCCA
 321 AGCCCTGGATTTGGCCTGCGGAGGAGCTTAGGATCCTCGTTTTCTGGGTTTTGGTGATGTTGGAGGAGTACCCCCCAGCC
 401 CACCGCCCCGATTCCTTTTTGCTTCTGGTTTGGAGCTCCGGACCAGGACCTTCGTCCTGGTCAGTTTTTAAATAATTATT
 481 TAGCAGTGTAACTTTTAGACCTGCGTGACATCTACAAAGCGCCCAATAAAGAAAGAGGAAGCCACGGTCCCTACCTTCCT
 561 TCTCGGGTCTCTGGGGCCTTCTCCTCCCTGCAGTGCCAACATGCACTGCCCACAGCAGGAGCTGGATCCAGCGTCAGTGT
 641 GTCGATGGGAACTGAAGACTAGTCCATAGGAGCTGGAAGAACTTTGTCCCTTTACTTCTGATTTGAAATTGTACCTTTTC
 721 TCAGGCCTGTGATTCACAGACTTTAACATGAATCAGAATCACCTGGAGGGCTCATGCAATCAGATTGCCAGATCTCGCCT
 801 CAGCGTTTCTGGTTCAATAGGTTTTGGGGGAGACCAAGAACGTTAACATTTCTAGCAAGTTTCCAGGTGATGCTGTTGTT
 881 GCTGGTCTAGAGACTATTTTGAGAACCACTGTCCAGGAGCGTGGTTTTCTGATTGTGATCTGAGGTTCTGCCCCAACTGC
 961 ACAGCAGTTGGGCTGCTTGTTAAAAATGCAGGCCAGGTGCGGTGGCTCACACCTGTAATCCCAGCGCTTTGGGAGGCTGA
1041 GGCAGGTGGATCACTTGAGCTCAGGAGTTCAAGACCAGCTTGGGAAACATGGCAAAACCCGTCTTTATGTGCCTGGAATC
1121 CCACCTGCTCAGGTGGCTAGGGTGGATGGATCGCTTGAGCCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATTGCACCACT
1201 GCATTCCAGCCTGGATGACAGAGCAAAACCCTGTCTCAAAAAAATGCAGACTGGCCAGGCACAGTGGCTCACACCTGTAA
1281 TCCGACTGTAAGCTCATCACCTTGGGAGGCCACTGTAGGAGGATCAATTGAGCCTAGAAGTTCAAGACCAGCCTGGGCAA
1361 AGTAGGGAGACCCCTTCTCTACAAATAGTAATAAAATGAACCGGGCATAGTAGCATGTGCCTGCGGTCCCAGCTGCTCTG
1441 ATAAGAGGAGGCTCACTTGAGCCCAGGAGGTTGAGGCTGCAGTGAGCAGAGCGTGCCGCTACACTCCAGCCTGATGACAG
1521 ACCGAGACACTGTCTCAAAAAAATAAAAAAATTCAGATTGCTGAGCATCAGACCTATTGATTAATCGCATTTGGTAGAAT
1601 GAGAGAGGTGCAGAGATGGCCAGGAGTTTGCATTTTCACACCAACGTCTGTGAACCTCTCTTCCTATTGGGATACAGGAA
1681 ATTTTGTATTTTTACCTGTCCACAGCCATAGTTATCATCACTGTTGAATTCACTTCCAGCCCAGGGCTCTGCATACCTTA
1761 TCTGGGTCTTTTGAACTTCAATAGCATTTCACCAGTGGCCATCCTTCCTGGTGTGGATTCATCACTCTGCCTCTGAAATC
1841 AGCCATCCCTATGGGAAGACACAGCCATGATTTTTCAGTACTCATAATACAGCCAGGACTGGCGGGAGCAACTGTCCCAG
1921 ATGGTGCTTAAACCCCTTAGGAGCTCATGATCTTCTTGGAAAGCCAGTAAGACAGAACCATACAGGACACAAATTAGATG
2001 CTAAATTGTGATTTAGATAGGAGACAGAAGTATTCAAAAAGGAGGGAAATTTCTTGTGAGTAGCTGCCCAGAAAGGTGGA
2081 ATTGGTGTGCTCTCACTTGAAAAATGAGTAGGATCTTCTCAGATGGCCACAAAGTCCAGGAGCTGCCCTGGGCAACAGGG
2161 ACAGGAGCCTCCCGTGAGACACTGCAGCTGAGACAGATGGGAGTCCTCTGACCCCAGAGGGTACTGGCTTGACTGCTTTA
2241 TGCCTTAAGTGGGGCCTGGAGCAAAATGGCCCAGGTTAGTCTGTCCTGAGAGTCCAGAGCCTTGGTTCAGGGGAGAATGG
2321 CATCTGGAGAGTGGGCTGCTGGGATAATGGGGACAGTGAGGGACAGAGCCCTTGATACTTAAGGAAGTGCTGGATATTGC
2401 TAAGAATTCAGGTAGTCTCGGGATCTCCAGAGTCTCCATACTAGGACAGGAGATCTTCAGAACCTGGAGGAATGGAAATA
2481 GTCTAGTCAGCTTATTTGTCAAGAAAAATGTCAACCTTGGTAATTTAAATAATGCTTTAAAAGTCCACAAAATACATATT
2561 TCTAAAATTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :|| |::  | :||||||| 
Target 5' agGACCCTGGGGCTACACTCCt 3'
75 - 96 152.00 -15.70
2
miRNA  3' guuUGUGGUA--ACAGUGUGAGGu 5'
             | | |:|   | :||||||| 
Target 5' agcAGAGCGTGCCGCTACACTCCa 3'
1485 - 1508 145.00 -17.00
3
miRNA  3' guUUG--UGGUAACAGUGUGAGGu 5'
            |||  :|| | | ::|||||: 
Target 5' tcAACCTGCCTTAGCTGCACTCTc 3'
138 - 161 126.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30108922 31 COSMIC
COSN30163403 34 COSMIC
COSN30102761 36 COSMIC
COSN30454431 37 COSMIC
COSN20075838 59 COSMIC
COSN20260419 65 COSMIC
COSN26964495 66 COSMIC
COSN30149833 100 COSMIC
COSN30124889 115 COSMIC
COSN30490289 124 COSMIC
COSN31574857 164 COSMIC
COSN30166962 185 COSMIC
COSN31587603 186 COSMIC
COSN31572926 240 COSMIC
COSN6358258 505 COSMIC
COSN24050430 777 COSMIC
COSN6358257 1492 COSMIC
COSN18815095 1784 COSMIC
COSN17911957 2440 COSMIC
COSN14681323 2472 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779443409 1 dbSNP
rs1181517217 2 dbSNP
rs755716495 4 dbSNP
rs1245120013 6 dbSNP
rs749887771 8 dbSNP
rs767247986 17 dbSNP
rs761524129 19 dbSNP
rs752000658 20 dbSNP
rs764501611 21 dbSNP
rs559954525 28 dbSNP
rs1317050540 29 dbSNP
rs775993637 36 dbSNP
rs770202507 38 dbSNP
rs758424431 40 dbSNP
rs759722268 42 dbSNP
rs1452698548 43 dbSNP
rs1400261673 50 dbSNP
rs1303675713 55 dbSNP
rs1032591297 61 dbSNP
rs549296410 65 dbSNP
rs529825225 66 dbSNP
rs1351697335 72 dbSNP
rs560817801 75 dbSNP
rs1284019150 80 dbSNP
rs1361669844 84 dbSNP
rs1223966941 88 dbSNP
rs1268818842 90 dbSNP
rs1473417660 95 dbSNP
rs796884463 96 dbSNP
rs1041695264 103 dbSNP
rs1184465606 107 dbSNP
rs951332198 108 dbSNP
rs1470336903 110 dbSNP
rs1185858134 113 dbSNP
rs905670578 115 dbSNP
rs934008565 117 dbSNP
rs1442262356 122 dbSNP
rs773513688 130 dbSNP
rs1426017325 131 dbSNP
rs1163593457 132 dbSNP
rs1025751272 133 dbSNP
rs992886086 134 dbSNP
rs1263426004 135 dbSNP
rs1218386704 141 dbSNP
rs370478187 144 dbSNP
rs148624345 147 dbSNP
rs1034849940 148 dbSNP
rs1284713542 152 dbSNP
rs1336091705 154 dbSNP
rs1002567562 155 dbSNP
rs1307336055 156 dbSNP
rs905098405 161 dbSNP
rs910013864 162 dbSNP
rs1291085777 163 dbSNP
rs984704888 164 dbSNP
rs1198054259 165 dbSNP
rs575092214 166 dbSNP
rs1437607392 168 dbSNP
rs1010548313 170 dbSNP
rs1235982416 171 dbSNP
rs1446038091 183 dbSNP
rs1282416200 189 dbSNP
rs564841294 193 dbSNP
rs1456364822 194 dbSNP
rs1340943482 196 dbSNP
rs1397015414 204 dbSNP
rs981784241 211 dbSNP
rs1402108859 213 dbSNP
rs1052623725 215 dbSNP
rs970398429 216 dbSNP
rs1453592016 217 dbSNP
rs544876375 221 dbSNP
rs933750679 223 dbSNP
rs1358644182 225 dbSNP
rs1314521810 229 dbSNP
rs1338745985 230 dbSNP
rs1230343832 232 dbSNP
rs1271300145 233 dbSNP
rs1339224633 240 dbSNP
rs572783518 241 dbSNP
rs552775130 247 dbSNP
rs1462412458 252 dbSNP
rs1039855167 259 dbSNP
rs1254949353 267 dbSNP
rs1023336426 271 dbSNP
rs192541577 271 dbSNP
rs1406088770 272 dbSNP
rs539557178 273 dbSNP
rs147217005 283 dbSNP
rs1373583149 295 dbSNP
rs990488579 298 dbSNP
rs1168303308 302 dbSNP
rs557134991 303 dbSNP
rs1470449951 304 dbSNP
rs1302481536 309 dbSNP
rs957789750 314 dbSNP
rs942962941 316 dbSNP
rs1162025979 319 dbSNP
rs1472655324 325 dbSNP
rs1217311948 334 dbSNP
rs1285625882 337 dbSNP
rs564088149 339 dbSNP
rs1195332654 340 dbSNP
rs1223804951 342 dbSNP
rs1476643225 344 dbSNP
rs999782737 346 dbSNP
rs902408850 348 dbSNP
rs1221646582 350 dbSNP
rs1030693092 353 dbSNP
rs984348390 355 dbSNP
rs571639383 358 dbSNP
rs766036183 359 dbSNP
rs1480633389 379 dbSNP
rs866670949 382 dbSNP
rs753312719 389 dbSNP
rs1318276043 393 dbSNP
rs993355174 394 dbSNP
rs1159269110 395 dbSNP
rs66608097 396 dbSNP
rs1220621119 397 dbSNP
rs1386572171 397 dbSNP
rs1035286537 403 dbSNP
rs942729423 404 dbSNP
rs373554417 405 dbSNP
rs1260845912 408 dbSNP
rs778407938 409 dbSNP
rs145275975 410 dbSNP
rs930162523 422 dbSNP
rs1190429529 430 dbSNP
rs1264973756 436 dbSNP
rs1022173497 439 dbSNP
rs370355313 440 dbSNP
rs1379823192 445 dbSNP
rs1047123208 447 dbSNP
rs764496570 453 dbSNP
rs892168526 454 dbSNP
rs763565746 459 dbSNP
rs949638727 465 dbSNP
rs1375948550 467 dbSNP
rs1030665801 478 dbSNP
rs1309515834 480 dbSNP
rs998367131 486 dbSNP
rs2414 498 dbSNP
rs1422445358 502 dbSNP
rs769878110 503 dbSNP
rs549601247 504 dbSNP
rs2415 505 dbSNP
rs1220698753 510 dbSNP
rs957759148 515 dbSNP
rs925047192 519 dbSNP
rs1244501920 520 dbSNP
rs1198015728 521 dbSNP
rs1458165198 522 dbSNP
rs1259986706 526 dbSNP
rs942865300 533 dbSNP
rs569725194 534 dbSNP
rs1237803130 535 dbSNP
rs966979689 537 dbSNP
rs1185526720 545 dbSNP
rs1385922940 546 dbSNP
rs1423790064 550 dbSNP
rs1048684841 553 dbSNP
rs1462828604 558 dbSNP
rs529458759 562 dbSNP
rs1030246757 563 dbSNP
rs138085673 563 dbSNP
rs930204175 564 dbSNP
rs186621515 565 dbSNP
rs964632389 566 dbSNP
rs1227726529 574 dbSNP
rs80135613 576 dbSNP
rs879391373 581 dbSNP
rs1199068448 584 dbSNP
rs1273166852 587 dbSNP
rs1440727778 588 dbSNP
rs1301420773 590 dbSNP
rs760985399 593 dbSNP
rs1472502204 600 dbSNP
rs1334010950 602 dbSNP
rs1180133495 604 dbSNP
rs1006916631 605 dbSNP
rs1429575877 613 dbSNP
rs758762762 615 dbSNP
rs1421896925 616 dbSNP
rs1463795939 617 dbSNP
rs530447669 622 dbSNP
rs1359315400 623 dbSNP
rs994352184 625 dbSNP
rs201087908 630 dbSNP
rs1415830506 631 dbSNP
rs897357886 632 dbSNP
rs564571650 633 dbSNP
rs1439838893 643 dbSNP
rs969203544 644 dbSNP
rs1239915148 647 dbSNP
rs1279619591 654 dbSNP
rs915070226 672 dbSNP
rs1441994313 680 dbSNP
rs2608288 686 dbSNP
rs1243896268 689 dbSNP
rs139773446 696 dbSNP
rs1193571025 698 dbSNP
rs1261553336 698 dbSNP
rs1481629118 702 dbSNP
rs1237864756 707 dbSNP
rs572846544 711 dbSNP
rs751999478 714 dbSNP
rs1031112971 719 dbSNP
rs758243096 724 dbSNP
rs1444348654 725 dbSNP
rs1054739036 726 dbSNP
rs965394570 729 dbSNP
rs183442778 731 dbSNP
rs1425466403 734 dbSNP
rs1413502559 739 dbSNP
rs1052717699 742 dbSNP
rs925064745 744 dbSNP
rs1006608939 747 dbSNP
rs1400612741 759 dbSNP
rs542816023 765 dbSNP
rs573707659 766 dbSNP
rs745451261 772 dbSNP
rs1312044953 774 dbSNP
rs1344637925 775 dbSNP
rs557448504 777 dbSNP
rs35833042 778 dbSNP
rs778742873 780 dbSNP
rs578133904 785 dbSNP
rs1215908442 794 dbSNP
rs1284504164 796 dbSNP
rs994443023 797 dbSNP
rs964645412 798 dbSNP
rs1017507751 799 dbSNP
rs897390097 804 dbSNP
rs1057497178 805 dbSNP
rs1450711631 816 dbSNP
rs534178045 817 dbSNP
rs1311947601 820 dbSNP
rs753353547 821 dbSNP
rs927254175 824 dbSNP
rs1381661596 826 dbSNP
rs1156715006 828 dbSNP
rs1358585215 829 dbSNP
rs1026987026 830 dbSNP
rs1324010247 831 dbSNP
rs1330294832 834 dbSNP
rs77397984 836 dbSNP
rs947474934 841 dbSNP
rs915102613 842 dbSNP
rs34770061 846 dbSNP
rs1283910142 850 dbSNP
rs1362278283 851 dbSNP
rs1183375448 852 dbSNP
rs1471716170 858 dbSNP
rs1210928879 859 dbSNP
rs555745924 867 dbSNP
rs1289702251 876 dbSNP
rs1450228217 884 dbSNP
rs1206998553 886 dbSNP
rs558526108 887 dbSNP
rs895416085 897 dbSNP
rs1177492473 898 dbSNP
rs1055270021 899 dbSNP
rs1377911645 902 dbSNP
rs1473774104 903 dbSNP
rs1163758269 906 dbSNP
rs977037052 920 dbSNP
rs965080596 921 dbSNP
rs1214997975 923 dbSNP
rs1316836870 933 dbSNP
rs1314142642 934 dbSNP
rs114249490 935 dbSNP
rs377280023 941 dbSNP
rs952421836 945 dbSNP
rs570125059 948 dbSNP
rs945146889 952 dbSNP
rs550668409 956 dbSNP
rs530546345 962 dbSNP
rs1361833733 964 dbSNP
rs975930003 970 dbSNP
rs147398074 976 dbSNP
rs910477296 977 dbSNP
rs868154952 978 dbSNP
rs1003530407 979 dbSNP
rs905905157 986 dbSNP
rs1044359142 991 dbSNP
rs1350375563 992 dbSNP
rs551000496 997 dbSNP
rs752826656 1000 dbSNP
rs893236298 1001 dbSNP
rs1416921444 1008 dbSNP
rs1187417612 1010 dbSNP
rs1053109693 1013 dbSNP
rs1465364487 1017 dbSNP
rs935183260 1020 dbSNP
rs972742567 1025 dbSNP
rs923735133 1026 dbSNP
rs1333543718 1043 dbSNP
rs1339250548 1061 dbSNP
rs976729771 1075 dbSNP
rs528034272 1088 dbSNP
rs961779492 1089 dbSNP
rs1024987421 1092 dbSNP
rs1265696409 1099 dbSNP
rs1191575340 1100 dbSNP
rs372633241 1101 dbSNP
rs542529465 1105 dbSNP
rs1200553881 1107 dbSNP
rs985109572 1107 dbSNP
rs373768512 1116 dbSNP
rs1195750765 1125 dbSNP
rs149301113 1128 dbSNP
rs763258629 1129 dbSNP
rs972854107 1130 dbSNP
rs1379620662 1142 dbSNP
rs1341986925 1146 dbSNP
rs776015876 1152 dbSNP
rs901604835 1153 dbSNP
rs1040110727 1157 dbSNP
rs1377258215 1159 dbSNP
rs1367731051 1161 dbSNP
rs1340380114 1162 dbSNP
rs1398573745 1164 dbSNP
rs1285526457 1167 dbSNP
rs1332508793 1170 dbSNP
rs1295166712 1175 dbSNP
rs190801649 1176 dbSNP
rs765675147 1179 dbSNP
rs1393368300 1182 dbSNP
rs1171114998 1191 dbSNP
rs910423524 1195 dbSNP
rs984629914 1196 dbSNP
rs1487901304 1199 dbSNP
rs930581284 1206 dbSNP
rs1191265759 1214 dbSNP
rs919159457 1216 dbSNP
rs1434025838 1217 dbSNP
rs973158969 1219 dbSNP
rs1376074770 1223 dbSNP
rs1427955701 1225 dbSNP
rs1159287242 1229 dbSNP
rs1003151939 1233 dbSNP
rs1360470832 1242 dbSNP
rs1025017088 1245 dbSNP
rs1368740680 1245 dbSNP
rs367854416 1245 dbSNP
rs759620140 1247 dbSNP
rs1193371389 1248 dbSNP
rs992241581 1262 dbSNP
rs959440160 1273 dbSNP
rs1300186565 1274 dbSNP
rs1467532526 1277 dbSNP
rs568899738 1283 dbSNP
rs776915626 1284 dbSNP
rs1001022204 1287 dbSNP
rs1352959793 1290 dbSNP
rs1023144656 1292 dbSNP
rs1267067002 1294 dbSNP
rs1011552181 1295 dbSNP
rs550375462 1298 dbSNP
rs535551524 1299 dbSNP
rs1208946762 1306 dbSNP
rs747280305 1307 dbSNP
rs558274591 1308 dbSNP
rs1021176207 1312 dbSNP
rs902382583 1320 dbSNP
rs901467498 1321 dbSNP
rs1438456528 1322 dbSNP
rs541448964 1327 dbSNP
rs572425736 1328 dbSNP
rs1226265458 1356 dbSNP
rs7806825 1359 dbSNP
rs568116186 1366 dbSNP
rs1384635943 1369 dbSNP
rs372113204 1378 dbSNP
rs138203986 1388 dbSNP
rs1332010459 1391 dbSNP
rs1391865454 1395 dbSNP
rs930465703 1401 dbSNP
rs76833570 1402 dbSNP
rs919585544 1403 dbSNP
rs1222064271 1405 dbSNP
rs1314773985 1406 dbSNP
rs1065071 1409 dbSNP
rs1243819444 1411 dbSNP
rs768545245 1413 dbSNP
rs1459291156 1416 dbSNP
rs1035894343 1417 dbSNP
rs73169654 1424 dbSNP
rs1456513616 1425 dbSNP
rs187485186 1426 dbSNP
rs75114719 1441 dbSNP
rs1423692862 1443 dbSNP
rs1163184210 1447 dbSNP
rs1426194495 1447 dbSNP
rs1466926097 1452 dbSNP
rs1331597276 1453 dbSNP
rs1399010383 1454 dbSNP
rs1439428467 1455 dbSNP
rs565505085 1457 dbSNP
rs548946837 1458 dbSNP
rs1395351509 1463 dbSNP
rs183541696 1466 dbSNP
rs563597976 1477 dbSNP
rs117219356 1481 dbSNP
rs750038443 1484 dbSNP
rs926703488 1492 dbSNP
rs780729540 1493 dbSNP
rs1238103912 1497 dbSNP
rs901911661 1501 dbSNP
rs1040428203 1502 dbSNP
rs1483368687 1504 dbSNP
rs968208078 1505 dbSNP
rs1265871760 1509 dbSNP
rs1230404858 1513 dbSNP
rs1346581884 1516 dbSNP
rs1309844388 1518 dbSNP
rs191274348 1519 dbSNP
rs564578135 1520 dbSNP
rs541512297 1522 dbSNP
rs897917 1523 dbSNP
rs1396460678 1524 dbSNP
rs1049680444 1528 dbSNP
rs765768648 1531 dbSNP
rs1311006760 1536 dbSNP
rs760176370 1539 dbSNP
rs931217079 1542 dbSNP
rs1342225808 1544 dbSNP
rs1400420256 1545 dbSNP
rs1277280095 1548 dbSNP
rs1202146576 1552 dbSNP
rs1221129000 1552 dbSNP
rs201866568 1552 dbSNP
rs1018647624 1555 dbSNP
rs919618045 1569 dbSNP
rs1304861857 1570 dbSNP
rs200211120 1573 dbSNP
rs866905475 1586 dbSNP
rs888882220 1587 dbSNP
rs186314843 1588 dbSNP
rs1193454371 1602 dbSNP
rs1240685727 1603 dbSNP
rs1474260681 1604 dbSNP
rs879883295 1607 dbSNP
rs1171157913 1608 dbSNP
rs1442088974 1608 dbSNP
rs1362402699 1611 dbSNP
rs1048770053 1624 dbSNP
rs1297399145 1627 dbSNP
rs1438952105 1628 dbSNP
rs753942926 1642 dbSNP
rs1181516603 1644 dbSNP
rs111921561 1645 dbSNP
rs1036597290 1646 dbSNP
rs180895470 1646 dbSNP
rs928392735 1648 dbSNP
rs1056408500 1655 dbSNP
rs1453697856 1660 dbSNP
rs1222683928 1662 dbSNP
rs1286128486 1666 dbSNP
rs1218619481 1667 dbSNP
rs760865158 1670 dbSNP
rs1246959201 1675 dbSNP
rs1348452693 1686 dbSNP
rs753433440 1689 dbSNP
rs773429903 1692 dbSNP
rs1278948247 1694 dbSNP
rs1381593730 1694 dbSNP
rs1245217541 1697 dbSNP
rs556396188 1698 dbSNP
rs1157964342 1699 dbSNP
rs539645264 1702 dbSNP
rs1342085888 1703 dbSNP
rs74448901 1706 dbSNP
rs1406885684 1710 dbSNP
rs970208728 1715 dbSNP
rs979498766 1719 dbSNP
rs1374854602 1721 dbSNP
rs916072993 1728 dbSNP
rs968533303 1733 dbSNP
rs914105221 1737 dbSNP
rs1278298265 1738 dbSNP
rs190020927 1739 dbSNP
rs1229274333 1746 dbSNP
rs372438246 1746 dbSNP
rs1383407704 1747 dbSNP
rs386719420 1749 dbSNP
rs114917054 1751 dbSNP
rs1467783446 1751 dbSNP
rs116159713 1752 dbSNP
rs185309403 1753 dbSNP
rs1458700597 1754 dbSNP
rs1180381851 1758 dbSNP
rs999274964 1759 dbSNP
rs1007240821 1760 dbSNP
rs758454002 1761 dbSNP
rs1163662688 1762 dbSNP
rs1370590905 1764 dbSNP
rs953035971 1773 dbSNP
rs1019447344 1780 dbSNP
rs752171110 1781 dbSNP
rs1173108930 1786 dbSNP
rs994631418 1794 dbSNP
rs1446169984 1801 dbSNP
rs897555615 1817 dbSNP
rs535423101 1823 dbSNP
rs895748928 1827 dbSNP
rs1333138226 1829 dbSNP
rs889664886 1831 dbSNP
rs34129956 1839 dbSNP
rs995454055 1847 dbSNP
rs34821030 1851 dbSNP
rs1358130365 1860 dbSNP
rs1247766244 1862 dbSNP
rs568276728 1864 dbSNP
rs1232524653 1865 dbSNP
rs1355042497 1878 dbSNP
rs749265112 1903 dbSNP
rs1256645274 1905 dbSNP
rs950665582 1907 dbSNP
rs1195521739 1909 dbSNP
rs1036927115 1911 dbSNP
rs946847417 1915 dbSNP
rs1028086909 1919 dbSNP
rs76235121 1921 dbSNP
rs928287792 1927 dbSNP
rs1324791069 1931 dbSNP
rs1415602065 1936 dbSNP
rs1318197700 1939 dbSNP
rs1334105393 1944 dbSNP
rs1387879011 1946 dbSNP
rs1402279306 1947 dbSNP
rs1045491710 1948 dbSNP
rs779998348 1953 dbSNP
rs1393247166 1958 dbSNP
rs1163221979 1963 dbSNP
rs769244986 1964 dbSNP
rs916102393 1966 dbSNP
rs1461304974 1969 dbSNP
rs1334497780 1971 dbSNP
rs986420854 1973 dbSNP
rs1200461450 1974 dbSNP
rs1279559786 1975 dbSNP
rs1263593569 1977 dbSNP
rs1484621108 1977 dbSNP
rs953750537 1977 dbSNP
rs1428210874 1978 dbSNP
rs1191287377 1980 dbSNP
rs574080767 1981 dbSNP
rs1027351246 1982 dbSNP
rs1478401870 1984 dbSNP
rs564241461 1986 dbSNP
rs1374197535 1993 dbSNP
rs1241029962 2000 dbSNP
rs750772839 2014 dbSNP
rs182016013 2018 dbSNP
rs1299260767 2019 dbSNP
rs1453248571 2029 dbSNP
rs780829809 2030 dbSNP
rs1293000264 2043 dbSNP
rs1251125489 2044 dbSNP
rs1014597415 2046 dbSNP
rs1332424283 2048 dbSNP
rs1212812458 2056 dbSNP
rs1014048582 2067 dbSNP
rs924873626 2069 dbSNP
rs1345694636 2079 dbSNP
rs1218703207 2089 dbSNP
rs1318384260 2090 dbSNP
rs73169652 2091 dbSNP
rs1216576436 2105 dbSNP
rs1203093575 2109 dbSNP
rs562200749 2112 dbSNP
rs1452357484 2120 dbSNP
rs1018936963 2122 dbSNP
rs1193145416 2131 dbSNP
rs1393338637 2138 dbSNP
rs986239718 2145 dbSNP
rs1001438379 2152 dbSNP
rs1159795184 2159 dbSNP
rs904422796 2167 dbSNP
rs953431758 2168 dbSNP
rs115969868 2173 dbSNP
rs995360725 2174 dbSNP
rs532631700 2175 dbSNP
rs576336810 2188 dbSNP
rs562864293 2189 dbSNP
rs1441146885 2209 dbSNP
rs1324714589 2218 dbSNP
rs1368133909 2221 dbSNP
rs765431741 2223 dbSNP
rs1440589283 2228 dbSNP
rs1316233481 2242 dbSNP
rs892561462 2249 dbSNP
rs73169651 2254 dbSNP
rs548174719 2258 dbSNP
rs111583577 2267 dbSNP
rs906903951 2269 dbSNP
rs1213281710 2274 dbSNP
rs1251304908 2283 dbSNP
rs1418432530 2284 dbSNP
rs1459144647 2286 dbSNP
rs755202827 2290 dbSNP
rs1172641232 2297 dbSNP
rs879225769 2300 dbSNP
rs1478751173 2301 dbSNP
rs912098413 2305 dbSNP
rs1192960997 2312 dbSNP
rs1167400053 2314 dbSNP
rs1369406383 2321 dbSNP
rs1461693634 2323 dbSNP
rs948250943 2328 dbSNP
rs577104977 2358 dbSNP
rs1391745786 2360 dbSNP
rs1045354052 2362 dbSNP
rs948500595 2364 dbSNP
rs754353027 2375 dbSNP
rs1298204891 2382 dbSNP
rs73169650 2383 dbSNP
rs1389577697 2393 dbSNP
rs1054107404 2399 dbSNP
rs868363782 2407 dbSNP
rs760814381 2411 dbSNP
rs1272641367 2417 dbSNP
rs558467688 2419 dbSNP
rs924768735 2420 dbSNP
rs572088754 2422 dbSNP
rs1320210507 2423 dbSNP
rs961978363 2429 dbSNP
rs555399953 2434 dbSNP
rs2608289 2440 dbSNP
rs1479982096 2444 dbSNP
rs1184098058 2446 dbSNP
rs944959516 2450 dbSNP
rs189412360 2453 dbSNP
rs959772766 2463 dbSNP
rs141412459 2473 dbSNP
rs1056724 2483 dbSNP
rs1170587099 2485 dbSNP
rs1281631723 2486 dbSNP
rs1034171941 2489 dbSNP
rs1440538028 2490 dbSNP
rs1459970078 2492 dbSNP
rs1304516358 2500 dbSNP
rs539780376 2503 dbSNP
rs1355965698 2506 dbSNP
rs1413963587 2507 dbSNP
rs1291184419 2515 dbSNP
rs17173732 2526 dbSNP
rs953335423 2532 dbSNP
rs1215377975 2533 dbSNP
rs1027746499 2536 dbSNP
rs973453801 2538 dbSNP
rs1305851644 2539 dbSNP
rs1212251331 2542 dbSNP
rs1435992999 2544 dbSNP
rs962899258 2545 dbSNP
rs1485604790 2547 dbSNP
rs1209244656 2553 dbSNP
rs1265761373 2556 dbSNP
rs370748746 2562 dbSNP
rs111247377 2564 dbSNP
rs1015426734 2568 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000287844.2 | 3UTR | ACCCUGGGGCUACACUCCUGCAUUGCUGCAAUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000287844.2 | 3UTR | CUACACUCCUGCAUUGCUGCAAUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000287844.2 | 3UTR | ACCCUGGGGCUACACUCCUGCAUUGCUGCAAUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000287844.2 | 3UTR | CUACACUCCUGCAUUGCUGCAAUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000287844.2 | 3UTR | ACCCUGGGGCUACACUCCUGCAUUGCUGCAAUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000287844.2 | 3UTR | ACCCUGGGGCUACACUCCUGCAUUGCUGCAAUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000287844.2 | 3UTR | CUACACUCCUGCAUUGCUGCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000287844.2 | 3UTR | ACCCUGGGGCUACACUCCUGCAUUGCUGCAAUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*