miRTarBase - #MIRT500097 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol L2HGDH   
Synonyms C14orf160, L2HGA
Description L-2-hydroxyglutarate dehydrogenase
Transcript NM_024884   
Expression
Putative miRNA Targets on L2HGDH
3'UTR of L2HGDH
(miRNA target sites are highlighted)
>L2HGDH|NM_024884|3'UTR
   1 ATAATGAAAGGAGCTAGGTATGCACTGTAATCTTCATGTCAGCAACAAGAATGTACTAATTGCATTCTTTAATTTAAAAA
  81 ATGGTTTTTAAACTTTAGTTTTTAGGTCAAAGATAACCACTGCATTGTTAAAATGATGTAACATAGAAATAATAATTTTC
 161 TACAAAAATTAGCCAGGCATGGTGGCGCATGCCTGTAATCTCAGCTACTCAGGAGGCTGAGGCAGGAGAATCAATTGAAC
 241 CGAGCAGACGGAGGTGAGCTGAGAGCTGAGATTGCACCACTGCACTCCAGCCTGGGTGACAGAGCAAGAAAATAATAATA
 321 ATAATAATTTTCAAAATGTTAGGCTGGGGGCCGTGGCCAGCACTTTGGGAAGCCAAGGCAGGTAGATTGTAGCCCAGGAG
 401 TTTGAGAACAGCCTGGGCAACATGGCAAAACCCTGTTTCTACACAAAGTTAGCTGGGTCTGGTGCCTCTGTAGTTCCAGC
 481 TCCTCAGTAGGCTGAGGTGAGAGGATCACTTGAGCCCAGGAGGTCTAGGCTGCAGTGAGCTTATGTTCATGACACTGCAT
 561 TCCAGGCTGGATGATAGAGCAAGATCTTGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAATCCAGCCTGGGCAACATAGTG
 641 AATGAAACCCCATCTCTACAAAAAATACAAAAATTAGCTGGGCATGATGGTGTGTGCCTGTAGTCCCAGCTACTTGGGGG
 721 CTGAGGCAGGAGGATCGCTTGAGCCCGGGAGATCAAGGCTACAGTGAGCTGTGTTCATGCCACTATACCCCAGCCTGGGC
 801 AACAAAGTGAGTCCCTGACTCAAAAAATAAAAACAACAACAAAAAATAAATTCCATGCTTATTTACTTTGCGAATAAAGA
 881 GGCAAGGTACAGTTTTATCTGTCCGAATCCCTGACTTTTATTTATTTTTTTTTTCAGACGGAGTTTCACTCTTGTTGCCC
 961 AGGCTTGAGTGCAATGGTACGATCTTGGCTCACTGCAACCTCTGCCTCCCGGGTTCCAGCGATTCTCTTGCCTCAACCTC
1041 CTGAGTAGCTGGGATTACAGGCGCCCACCACCATGCCTGGCTAATTTTTTGTATTTTTAGTAGAGACGGGGTTTTGCCAT
1121 GTTGGCCAGGCTGGTCTCGAATTCCTGACCTCAGGTGATCCACCTGCCTCAGCCTCCCAAAATGCTGGGATTACAGGTGC
1201 GAGCCATCATGCTCAGCCCTGAATCCCTGACTTTGTTAATGACCTGTCCTTACCAACCATGACCTAGAGAAGATTTGGCT
1281 TTTTAAGAGTTTTGGAGAAAGATGGCATAAAAATAGATTATTTCCTTAAATCAATTTTTTAGCATTACGCTACCTAAGCT
1361 CGTTTGGTCTCTCATAGACAAGAAAATACATTATATTGTAGGTTACATTCTTTTAATTTTGAAGAGTCACAAAACTCACA
1441 TTATTTAGAGCAACAATATTTGTATTTGGAAATTAAAAATTCATGATTTCAAGAAAATACATAAAATTTACATTTTTGAG
1521 TAGTTTGAATAAGTTTCTATCTTAATTATAATATTTGTAGGAAATAACAAAACAAACTCAAAGCCTTTATTATTTCCAGT
1601 CTCTTTGTAACTGATGTGGTATGGTATCATCATGAAATCTAAACAGTGGTACACTGAGTGGTTGTCCTGTTCTTCAATCT
1681 CTGTGGCTGAGAACTGAAATAACTTAGAAGAGACAGATTTTTATGAGAGCAGTTTTAGAATCCTGACACTGATGTATAGA
1761 ACTCCAATTTAAAAAAGTTATTTATCTATTATATCTCTGATCTTTAGTCACACTAAGGCTCTCAAAATGTTGGCCAAGAT
1841 TGGTAATGATTCATACGTACTTGATTTTTCAGGGCTCCTATAAACTTGTATAGGGATATTTTTCCATTTTTGATAAATAT
1921 CTAACTTTGAGGCATTCACTTTTGTAAACCGCGAAAGTGCCTTACATTCACCTCATGAGTATTTTAAGTTGATGCCCAGT
2001 GCTGTGGTATATCCTGTATATATGTGTTTTGTGGTATCTATCGAAATTATTCTTATAATTTAGAAAGTTAGAAAATAGAA
2081 ATTGTAAATGAAAATGTGGCGACCTGACTGCAGAACTTTGAGTACTGAACCACATTTAGGTGAGGCATTTTCATCCATTC
2161 TCTCTGATTTGCTCTCTCAGGATTCATCTTCTACTGTGTATGTCTTCTTTCCTCTTAGCTCTCCAAAGCTGTATGATGGA
2241 TGGGTGAGAAGGATGTGCATTTTGGTTGATAGGAAAAATGTTTCTGTTTTCTTCCTTTTCCCCTCACTTCAAGCATTGAT
2321 GATTACATTGATTGAGCTACCTCATCCATTAATTTGAAAGGCTACACTTCATCAGCTCATGTTTAAGAAGTAGCACATCC
2401 CAGGTAAACAGAGTAGGCCATTATTCAACTCTTAGGATGAGTATATTAAAAGCATTCAGATATCAATGACAGAAGAAACA
2481 AGCCCTAATGTTTCTTTATAACAGCTGATTCCTGCAAGAAATGCAAACACAGGATATTTTTCTGTTCCATTACAAGATTA
2561 CTAAGAGATGGAAAATATTATCATTCTGTATTTTGTCAGTAGTACGATTGCATACATACTAAGTTGTAAACATTGAATTA
2641 CAAAAAATGATTGTCCTAATTGAAGCAGTCCTCAATCCATTTGAGTCTGTACAATACCCTGAAAAGGAAACAACAGGTGC
2721 TGGAGAGGATGTGGAGAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGT
2801 GTGGCGATTCCTCAGGGATCTGGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAAGGGACT
2881 ATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGTGGCACTATTCACAATAGTAAAGACTTGGAACCAA
2961 CCCAAATGTCCAACAACGATAGACTGGATTAAGAAAATGTGGCACATATACACCATGGAATACTATGCAGCCATAAAAAA
3041 TGATGAGTTCATGTCCTTTGTAGGGACATGGATGAAATTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAA
3121 CCAAACACCGCATGTTCTCACTCATAGATGGGAATTGAACAATGAGAACACATGGACACAGGAAGGGGAACATCACACTC
3201 TGGGGACTGTTGTGGGGTGGGGGGAGGGGGGAGGGATAGCATTAGGAGATATACCTAATGCTAAATGACGAGTTAATGGG
3281 TGCAGCACACCAGCACGGCACATGTATACATATGTAACTAACCTGCACATTGTGCACATGTACCCTAAAACTTAAAGTAT
3361 AATAATAAACAATATATATATATATATATATATAAAATACCCTGAAAAATAAAAATGAAAAATTTGTTGAAAGTGTTTTG
3441 AATATGTAGGTTATTCTGCTTGTAAAACGTTTTATATGTATGTCAATAGGGTTTTTTTGTTTAATACTGATATAATAAAG
3521 TTTTATGTATTTCTGACAGAAGAAATGTATATTAATATTTAAAATATTTTAATGAGCCTTGGTGTTGTAGAGAACATATT
3601 TTTTAGTTCCATAAAAACTTTTATGCAAATAAATTTTTTTATGTGTAAAACATAAACTGTTTGCTTTAGATAGATAGCAG
3681 CCAACCTTTTTAAAAAACTCATTTCTGTGTTAGTATATAATACAAAATGAGGTTGAGTCATTTATATTTTGGGTAAAAAG
3761 TGGAGCATTTTAGATTTTAACTTCAGAGTGTTTGTGAGGAACTCTTGATGTACCAGCAAGTATATTTTTGGTGTTTCATG
3841 TTACGTAGCTTAACTCTTTTATCCATACATATATGTGTATATCAAAGTCCTTCCCTTGATCCTCTCAGCATTAGCACTGT
3921 TTGGGGAGTTGCCTTTACTGTTGGCAGAATTCCACTTTCCCTGAGGCCATTTGGAAATCTACCTAGTAGCCTGTGGGATA
4001 ACCTTAACTCTTAGAACTTTCTTCAAAGGATGGTGGTGAGAATGGGGTATACTGCCAGGCCCTGGCCTACGGGAGTTTGT
4081 AGGGCCTACTTTTGGAGGCAATCCAACCCTGATGGCTGTACCTATGAGCTATCCCTGTAAACACAGGAGACATGGTGTCT
4161 ATATTGTTTAAGGACTGGCTCTGCCCTCCTGGGCCCTTAATCTGTGTCTAGACTTCTTGGTCAGAGGTTTCCTCATCTTT
4241 CTGCGCATACACTATTATCTAAAGATCTTGTAAACATTTTTGAGTTGTAATCGTAAAGTCAGTTTCTAAGCTTTTCTAAC
4321 ACACTCAAAGGGAGTTTTTGAAATCTCTTCATCAGGGCTTAAGGTAGAAGGACAGGGTGAAATGGTTGGGAAAGCAAAAG
4401 CTGCCTCGAGATGTTTTCAAATAGTTTGTACTCATTAAATAGCTTAAGAATGGAAATAAACCCTGAAGCCCTGAAGGGAA
4481 GAACAGTGTTGATACCAACCAACTCTACTTTTCTGGCCTCAAATCCTAGAAAGTATTGTGGGTTTGTTGTTGTTGTTGAT
4561 GTTGTTAATTGCTTGTATTTTCTGCTTATGGGAAGGATCTCACATTAAAGTTATCTTATTTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU---UGGUA-AUA-CACGACGAu 5'
            |||   ||:||  ||  ||||||| 
Target 5' ccCAAGGGACTATAAATCATGCTGCTa 3'
2870 - 2896 152.00 -16.20
2
miRNA  3' gugUUUGGUAAUAC----ACGACGAu 5'
             ||| :|||:||    ||:||:| 
Target 5' tagAAAGTATTGTGGGTTTGTTGTTg 3'
4527 - 4552 133.00 -13.20
3
miRNA  3' guGUU--UGGUAAUACACGACGAu 5'
            :||  :|:  ||| | ||||| 
Target 5' gtTAATTGCTTGTATTTTCTGCTt 3'
4564 - 4587 122.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30519987 6 COSMIC
COSN16378854 32 COSMIC
COSN30188053 38 COSMIC
COSN13585526 98 COSMIC
COSN31610391 108 COSMIC
COSN30115951 112 COSMIC
COSN30532742 186 COSMIC
COSN30531262 243 COSMIC
COSN6252986 538 COSMIC
COSN29916951 660 COSMIC
COSN32061321 924 COSMIC
COSN8844060 1082 COSMIC
COSN22747381 1239 COSMIC
COSN6252985 1388 COSMIC
COSN7236026 1526 COSMIC
COSN6252984 1605 COSMIC
COSN8588688 1898 COSMIC
COSN26648778 1952 COSMIC
COSN14484545 2274 COSMIC
COSN17494793 2305 COSMIC
COSN7236025 2615 COSMIC
COSN22755714 2631 COSMIC
COSN20685172 2652 COSMIC
COSN1653018 2945 COSMIC
COSN6637586 3387 COSMIC
COSN23061307 3399 COSMIC
COSN18995100 3714 COSMIC
COSN32058592 4293 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1261502492 4 dbSNP
rs1225579361 9 dbSNP
rs759328143 9 dbSNP
rs757880431 20 dbSNP
rs779550191 21 dbSNP
rs531663775 23 dbSNP
rs764792313 26 dbSNP
rs756867173 31 dbSNP
rs1332571008 32 dbSNP
rs753446191 36 dbSNP
rs1404276614 37 dbSNP
rs764471449 38 dbSNP
rs761154069 40 dbSNP
rs1425318951 41 dbSNP
rs776111184 48 dbSNP
rs373953528 49 dbSNP
rs1051382543 56 dbSNP
rs1257467834 59 dbSNP
rs1204403141 60 dbSNP
rs140029296 61 dbSNP
rs1276574473 82 dbSNP
rs984907253 85 dbSNP
rs891992332 95 dbSNP
rs1393366711 96 dbSNP
rs7143186 97 dbSNP
rs1460837113 98 dbSNP
rs980166800 98 dbSNP
rs971385803 105 dbSNP
rs936113632 112 dbSNP
rs1448556103 120 dbSNP
rs1024726294 122 dbSNP
rs1366291316 127 dbSNP
rs1312615195 129 dbSNP
rs927347496 132 dbSNP
rs1044404755 137 dbSNP
rs1010273187 138 dbSNP
rs956813969 143 dbSNP
rs544937689 175 dbSNP
rs1305527992 179 dbSNP
rs1490977355 187 dbSNP
rs950058993 189 dbSNP
rs867549445 192 dbSNP
rs1030939517 193 dbSNP
rs530690368 195 dbSNP
rs1200765696 200 dbSNP
rs1251212298 211 dbSNP
rs992075837 223 dbSNP
rs575980888 234 dbSNP
rs1192263494 235 dbSNP
rs559196708 241 dbSNP
rs951279425 242 dbSNP
rs748924657 244 dbSNP
rs187431356 249 dbSNP
rs995923371 250 dbSNP
rs1323556104 254 dbSNP
rs901626645 256 dbSNP
rs1476265833 270 dbSNP
rs1436632839 272 dbSNP
rs777415881 277 dbSNP
rs1040430906 279 dbSNP
rs1295183983 279 dbSNP
rs561813773 280 dbSNP
rs1186590485 283 dbSNP
rs769280522 292 dbSNP
rs962508440 295 dbSNP
rs183023998 302 dbSNP
rs1319812809 305 dbSNP
rs886667520 308 dbSNP
rs1288054047 317 dbSNP
rs1184241056 319 dbSNP
rs116458262 324 dbSNP
rs1487559544 329 dbSNP
rs930779059 329 dbSNP
rs1256368407 335 dbSNP
rs1200820612 336 dbSNP
rs955256861 342 dbSNP
rs1424778003 346 dbSNP
rs1340492507 347 dbSNP
rs1479038935 350 dbSNP
rs1029317490 353 dbSNP
rs1412669410 389 dbSNP
rs111251479 406 dbSNP
rs1405626292 417 dbSNP
rs1265159057 418 dbSNP
rs1010521717 420 dbSNP
rs1399319500 425 dbSNP
rs1298798194 431 dbSNP
rs892024822 446 dbSNP
rs1342119067 448 dbSNP
rs1054648948 451 dbSNP
rs1283416366 458 dbSNP
rs536675633 462 dbSNP
rs1316403390 465 dbSNP
rs1000730792 468 dbSNP
rs1292029994 469 dbSNP
rs905954080 483 dbSNP
rs950172455 486 dbSNP
rs146073772 487 dbSNP
rs1044906489 497 dbSNP
rs1489456694 501 dbSNP
rs917371120 509 dbSNP
rs1328871929 511 dbSNP
rs1472888567 512 dbSNP
rs779975979 522 dbSNP
rs1405147885 523 dbSNP
rs71420173 525 dbSNP
rs1418617807 532 dbSNP
rs1396788050 534 dbSNP
rs1162384960 536 dbSNP
rs1237127439 537 dbSNP
rs989193421 546 dbSNP
rs1432813731 562 dbSNP
rs1386977286 577 dbSNP
rs550524457 581 dbSNP
rs956076497 584 dbSNP
rs146944830 591 dbSNP
rs1236503278 592 dbSNP
rs1184083321 593 dbSNP
rs1239566720 594 dbSNP
rs1438549536 594 dbSNP
rs1266981246 595 dbSNP
rs1356408546 596 dbSNP
rs950158577 600 dbSNP
rs917272153 607 dbSNP
rs1199257445 612 dbSNP
rs1208400617 613 dbSNP
rs34549700 615 dbSNP
rs79107225 618 dbSNP
rs1030886924 619 dbSNP
rs1171990758 620 dbSNP
rs1178665648 620 dbSNP
rs1236023820 620 dbSNP
rs1274827174 620 dbSNP
rs1309999561 620 dbSNP
rs1336364796 620 dbSNP
rs1338098151 620 dbSNP
rs1381642801 620 dbSNP
rs1398326531 620 dbSNP
rs1402622226 620 dbSNP
rs1438731903 620 dbSNP
rs1476964482 620 dbSNP
rs35924556 620 dbSNP
rs770072958 620 dbSNP
rs1346116881 621 dbSNP
rs1293123640 623 dbSNP
rs1240151493 624 dbSNP
rs1352162477 625 dbSNP
rs979345981 628 dbSNP
rs1256588926 636 dbSNP
rs1456999807 642 dbSNP
rs1306386897 651 dbSNP
rs1443773070 658 dbSNP
rs967995655 661 dbSNP
rs371483457 666 dbSNP
rs1047707179 670 dbSNP
rs1449429433 674 dbSNP
rs1384838285 675 dbSNP
rs1367274923 687 dbSNP
rs1378169991 690 dbSNP
rs1478984724 691 dbSNP
rs141838009 699 dbSNP
rs996052183 700 dbSNP
rs918479324 704 dbSNP
rs1332365993 709 dbSNP
rs973886409 713 dbSNP
rs1385201518 714 dbSNP
rs901571608 714 dbSNP
rs567943485 721 dbSNP
rs1378420213 733 dbSNP
rs1332134322 737 dbSNP
rs1236089944 744 dbSNP
rs1276629230 745 dbSNP
rs116522927 746 dbSNP
rs1470577809 747 dbSNP
rs1259640985 748 dbSNP
rs1004926645 753 dbSNP
rs886114919 754 dbSNP
rs551996239 755 dbSNP
rs560342390 757 dbSNP
rs369263312 759 dbSNP
rs1377263001 764 dbSNP
rs930896350 765 dbSNP
rs985638081 769 dbSNP
rs1490941868 772 dbSNP
rs1171614144 778 dbSNP
rs758805529 785 dbSNP
rs74541550 796 dbSNP
rs988454336 797 dbSNP
rs1162682633 802 dbSNP
rs191936139 815 dbSNP
rs950262133 828 dbSNP
rs1407295580 829 dbSNP
rs1487567812 829 dbSNP
rs148697644 830 dbSNP
rs1340268779 834 dbSNP
rs6572653 834 dbSNP
rs1319498577 837 dbSNP
rs1286997246 843 dbSNP
rs1243627354 847 dbSNP
rs557758861 853 dbSNP
rs1265447350 856 dbSNP
rs1357933310 859 dbSNP
rs1224933175 866 dbSNP
rs1285274039 868 dbSNP
rs368450272 871 dbSNP
rs544182171 872 dbSNP
rs925940850 873 dbSNP
rs1369119587 875 dbSNP
rs1221375216 883 dbSNP
rs1347011384 886 dbSNP
rs1426674390 891 dbSNP
rs1303469569 892 dbSNP
rs906063355 904 dbSNP
rs1023113045 905 dbSNP
rs1014783079 920 dbSNP
rs1358514421 923 dbSNP
rs6572652 924 dbSNP
rs200811286 925 dbSNP
rs565566801 925 dbSNP
rs759614730 925 dbSNP
rs545630394 926 dbSNP
rs965920231 927 dbSNP
rs899165510 928 dbSNP
rs1038733154 929 dbSNP
rs1481511027 934 dbSNP
rs1254027326 935 dbSNP
rs1282377002 935 dbSNP
rs1482840488 936 dbSNP
rs1200073379 937 dbSNP
rs1430276225 939 dbSNP
rs573335164 940 dbSNP
rs1176799381 941 dbSNP
rs1004638752 947 dbSNP
rs1193349111 948 dbSNP
rs941269890 951 dbSNP
rs1405282040 953 dbSNP
rs1357771679 955 dbSNP
rs911075651 957 dbSNP
rs1465890545 968 dbSNP
rs950511713 970 dbSNP
rs985284447 972 dbSNP
rs1964845 979 dbSNP
rs922308960 980 dbSNP
rs988482292 981 dbSNP
rs1225385178 984 dbSNP
rs906109183 986 dbSNP
rs1277210466 988 dbSNP
rs1044663406 992 dbSNP
rs575230639 1010 dbSNP
rs1032673701 1011 dbSNP
rs1325182013 1016 dbSNP
rs760767879 1019 dbSNP
rs752743077 1021 dbSNP
rs979444980 1038 dbSNP
rs1237633486 1057 dbSNP
rs536361142 1062 dbSNP
rs573767161 1063 dbSNP
rs1433139150 1069 dbSNP
rs1177169525 1071 dbSNP
rs556937786 1081 dbSNP
rs1023567555 1084 dbSNP
rs1463733514 1100 dbSNP
rs1014400842 1101 dbSNP
rs895905985 1107 dbSNP
rs1026392145 1108 dbSNP
rs1291314542 1110 dbSNP
rs993540925 1115 dbSNP
rs747475130 1116 dbSNP
rs899196596 1116 dbSNP
rs1284885590 1119 dbSNP
rs1037695221 1120 dbSNP
rs1217017683 1134 dbSNP
rs941290733 1136 dbSNP
rs1206653555 1138 dbSNP
rs1257720443 1138 dbSNP
rs1488401409 1139 dbSNP
rs932658273 1139 dbSNP
rs1271475761 1142 dbSNP
rs1477072772 1149 dbSNP
rs889689182 1161 dbSNP
rs1170290583 1163 dbSNP
rs1411327924 1172 dbSNP
rs1162026992 1174 dbSNP
rs1050029908 1187 dbSNP
rs537040577 1200 dbSNP
rs568860667 1201 dbSNP
rs983726159 1205 dbSNP
rs7157035 1207 dbSNP
rs1027386470 1212 dbSNP
rs770654055 1218 dbSNP
rs879299972 1227 dbSNP
rs1236255043 1231 dbSNP
rs994431994 1234 dbSNP
rs1462306680 1238 dbSNP
rs558355687 1240 dbSNP
rs566564610 1243 dbSNP
rs1223847158 1247 dbSNP
rs969702570 1248 dbSNP
rs1487609684 1255 dbSNP
rs149513621 1259 dbSNP
rs1014504067 1267 dbSNP
rs1476153237 1268 dbSNP
rs1179826662 1272 dbSNP
rs1412430352 1273 dbSNP
rs896089978 1274 dbSNP
rs1165361102 1280 dbSNP
rs1274792090 1283 dbSNP
rs1419033908 1292 dbSNP
rs1214971175 1294 dbSNP
rs1298512131 1300 dbSNP
rs1346816382 1307 dbSNP
rs1053277028 1310 dbSNP
rs200334388 1312 dbSNP
rs1464704572 1314 dbSNP
rs916125522 1319 dbSNP
rs904583680 1321 dbSNP
rs1317286893 1326 dbSNP
rs1378300131 1333 dbSNP
rs772807385 1334 dbSNP
rs769350454 1341 dbSNP
rs575924225 1348 dbSNP
rs1383692158 1349 dbSNP
rs115255727 1353 dbSNP
rs1026423248 1354 dbSNP
rs1236577863 1358 dbSNP
rs1444897890 1361 dbSNP
rs138082725 1362 dbSNP
rs1377951732 1364 dbSNP
rs1171504458 1374 dbSNP
rs1159238928 1377 dbSNP
rs963401367 1378 dbSNP
rs866041574 1385 dbSNP
rs1333293930 1386 dbSNP
rs1166082962 1390 dbSNP
rs868837922 1396 dbSNP
rs983288169 1402 dbSNP
rs1453677283 1404 dbSNP
rs1007522369 1407 dbSNP
rs950574031 1410 dbSNP
rs1445922262 1411 dbSNP
rs920308872 1413 dbSNP
rs1353248952 1421 dbSNP
rs1177484574 1422 dbSNP
rs188026781 1423 dbSNP
rs1479428053 1424 dbSNP
rs1278377942 1428 dbSNP
rs1049699188 1443 dbSNP
rs973127495 1444 dbSNP
rs1205248829 1446 dbSNP
rs998097576 1448 dbSNP
rs1456967139 1449 dbSNP
rs530515651 1451 dbSNP
rs1052924971 1453 dbSNP
rs182954897 1456 dbSNP
rs1289484727 1457 dbSNP
rs1470424776 1469 dbSNP
rs1178926214 1470 dbSNP
rs866630044 1474 dbSNP
rs925701964 1482 dbSNP
rs960300324 1483 dbSNP
rs764364042 1484 dbSNP
rs545358648 1485 dbSNP
rs1032358398 1488 dbSNP
rs190521927 1499 dbSNP
rs1274624854 1507 dbSNP
rs1324787831 1507 dbSNP
rs559717558 1529 dbSNP
rs1021680397 1531 dbSNP
rs996932625 1533 dbSNP
rs915560240 1539 dbSNP
rs146960572 1544 dbSNP
rs960267941 1555 dbSNP
rs1198164001 1565 dbSNP
rs944062867 1577 dbSNP
rs1481325254 1579 dbSNP
rs919438788 1594 dbSNP
rs890357755 1601 dbSNP
rs1047644349 1604 dbSNP
rs929100378 1610 dbSNP
rs1168501329 1612 dbSNP
rs1425783200 1618 dbSNP
rs17122314 1620 dbSNP
rs78221582 1626 dbSNP
rs1346504880 1632 dbSNP
rs1407101975 1633 dbSNP
rs1016318253 1648 dbSNP
rs879289202 1651 dbSNP
rs1008051120 1653 dbSNP
rs1416834121 1655 dbSNP
rs948484401 1656 dbSNP
rs953443544 1659 dbSNP
rs1227715163 1660 dbSNP
rs1252553451 1661 dbSNP
rs915668105 1662 dbSNP
rs186136934 1672 dbSNP
rs1292462521 1673 dbSNP
rs998128666 1677 dbSNP
rs1191178298 1686 dbSNP
rs901058624 1690 dbSNP
rs1428137719 1698 dbSNP
rs959987448 1699 dbSNP
rs1224456638 1710 dbSNP
rs78256403 1711 dbSNP
rs1163038346 1718 dbSNP
rs1285260491 1727 dbSNP
rs1427122353 1728 dbSNP
rs1296661308 1733 dbSNP
rs977672517 1735 dbSNP
rs998649606 1747 dbSNP
rs904278818 1749 dbSNP
rs1042845083 1753 dbSNP
rs948456915 1755 dbSNP
rs1297339527 1757 dbSNP
rs767234478 1761 dbSNP
rs1243383170 1767 dbSNP
rs879869210 1771 dbSNP
rs1361434930 1779 dbSNP
rs1056697073 1781 dbSNP
rs1285028855 1785 dbSNP
rs1205908506 1786 dbSNP
rs1486099183 1786 dbSNP
rs938955657 1787 dbSNP
rs1422305407 1788 dbSNP
rs746366847 1791 dbSNP
rs779580978 1798 dbSNP
rs1020138071 1799 dbSNP
rs1285531097 1799 dbSNP
rs1008202554 1811 dbSNP
rs1446975275 1823 dbSNP
rs374697653 1825 dbSNP
rs972216203 1832 dbSNP
rs538579174 1845 dbSNP
rs759477268 1856 dbSNP
rs1399552534 1857 dbSNP
rs1451479425 1862 dbSNP
rs942248170 1863 dbSNP
rs73293653 1868 dbSNP
rs1037478784 1870 dbSNP
rs1346518979 1874 dbSNP
rs1306248097 1880 dbSNP
rs1159196558 1882 dbSNP
rs1317478917 1894 dbSNP
rs986255079 1904 dbSNP
rs948577384 1906 dbSNP
rs181104315 1928 dbSNP
rs749702304 1937 dbSNP
rs1030348978 1943 dbSNP
rs992996260 1950 dbSNP
rs976057581 1952 dbSNP
rs879414969 1953 dbSNP
rs1480662106 1954 dbSNP
rs1262359847 1957 dbSNP
rs1161664557 1961 dbSNP
rs924272803 1966 dbSNP
rs778003767 1971 dbSNP
rs1176771023 1973 dbSNP
rs1407613209 1982 dbSNP
rs74984624 1985 dbSNP
rs1261328266 1999 dbSNP
rs1209533992 2004 dbSNP
rs756269656 2007 dbSNP
rs1393067160 2017 dbSNP
rs1031558086 2020 dbSNP
rs968948020 2022 dbSNP
rs914851925 2034 dbSNP
rs753005164 2040 dbSNP
rs904380218 2042 dbSNP
rs1019654272 2043 dbSNP
rs536439640 2067 dbSNP
rs1012681258 2071 dbSNP
rs894193419 2084 dbSNP
rs995488939 2084 dbSNP
rs1056729789 2088 dbSNP
rs899062329 2100 dbSNP
rs567414465 2101 dbSNP
rs1463447439 2129 dbSNP
rs1291768591 2134 dbSNP
rs142774703 2140 dbSNP
rs1344607659 2144 dbSNP
rs138722777 2144 dbSNP
rs571276390 2146 dbSNP
rs1284985966 2161 dbSNP
rs1468860714 2163 dbSNP
rs1213032432 2166 dbSNP
rs1272373271 2166 dbSNP
rs1403401269 2172 dbSNP
rs1207206173 2176 dbSNP
rs897489343 2176 dbSNP
rs1012717346 2179 dbSNP
rs894303113 2180 dbSNP
rs1476632250 2181 dbSNP
rs1036613461 2186 dbSNP
rs1057003468 2189 dbSNP
rs1419587539 2193 dbSNP
rs551325694 2196 dbSNP
rs1162132424 2197 dbSNP
rs1364837752 2198 dbSNP
rs1425239942 2204 dbSNP
rs1304662021 2207 dbSNP
rs1358466314 2214 dbSNP
rs924386030 2217 dbSNP
rs1041387460 2218 dbSNP
rs191612242 2221 dbSNP
rs1216353716 2223 dbSNP
rs947055988 2227 dbSNP
rs1359263750 2233 dbSNP
rs1372224368 2240 dbSNP
rs559953437 2244 dbSNP
rs1294381940 2257 dbSNP
rs976080907 2270 dbSNP
rs986673236 2276 dbSNP
rs1486658094 2286 dbSNP
rs964363518 2286 dbSNP
rs1262381410 2294 dbSNP
rs1384079780 2305 dbSNP
rs912712123 2310 dbSNP
rs751430698 2312 dbSNP
rs1183033402 2315 dbSNP
rs1460077119 2319 dbSNP
rs1378227443 2326 dbSNP
rs765963929 2327 dbSNP
rs932100967 2328 dbSNP
rs1204627567 2332 dbSNP
rs185928940 2340 dbSNP
rs1382197955 2353 dbSNP
rs1249912667 2360 dbSNP
rs181038918 2364 dbSNP
rs1308555083 2365 dbSNP
rs1312684157 2368 dbSNP
rs956724296 2375 dbSNP
rs1451248642 2381 dbSNP
rs1380012269 2391 dbSNP
rs145800000 2391 dbSNP
rs370495702 2394 dbSNP
rs1025701731 2395 dbSNP
rs1338288736 2398 dbSNP
rs1201459202 2402 dbSNP
rs1452839452 2403 dbSNP
rs543527882 2411 dbSNP
rs117854118 2413 dbSNP
rs557871065 2417 dbSNP
rs1165900163 2423 dbSNP
rs962694232 2427 dbSNP
rs140692117 2428 dbSNP
rs1021477166 2429 dbSNP
rs1402648920 2431 dbSNP
rs1013125066 2435 dbSNP
rs1373552840 2439 dbSNP
rs1162921684 2443 dbSNP
rs1338809462 2453 dbSNP
rs894238588 2463 dbSNP
rs1334450446 2466 dbSNP
rs1442856475 2486 dbSNP
rs1244969792 2490 dbSNP
rs1184296301 2495 dbSNP
rs1376058341 2498 dbSNP
rs189247104 2502 dbSNP
rs1002576874 2506 dbSNP
rs1013246912 2516 dbSNP
rs897521372 2517 dbSNP
rs894427094 2523 dbSNP
rs1057355759 2525 dbSNP
rs1270276703 2530 dbSNP
rs1437156246 2531 dbSNP
rs1182502755 2533 dbSNP
rs1035971393 2559 dbSNP
rs1197891314 2577 dbSNP
rs1198463048 2578 dbSNP
rs1428801071 2585 dbSNP
rs1002735062 2591 dbSNP
rs1174326404 2605 dbSNP
rs554587252 2612 dbSNP
rs902912250 2623 dbSNP
rs888000593 2629 dbSNP
rs1403437981 2633 dbSNP
rs1283054558 2634 dbSNP
rs148171467 2635 dbSNP
rs947003671 2641 dbSNP
rs77139946 2647 dbSNP
rs1196271232 2648 dbSNP
rs1244504938 2648 dbSNP
rs762682967 2650 dbSNP
rs923425407 2653 dbSNP
rs567453079 2660 dbSNP
rs1039402737 2661 dbSNP
rs1480886425 2688 dbSNP
rs1246119611 2693 dbSNP
rs374193979 2697 dbSNP
rs935391489 2698 dbSNP
rs1475150175 2719 dbSNP
rs1168602117 2723 dbSNP
rs923952376 2728 dbSNP
rs766954363 2743 dbSNP
rs1326504684 2749 dbSNP
rs1302919810 2751 dbSNP
rs1366640147 2761 dbSNP
rs1392909036 2762 dbSNP
rs557155247 2765 dbSNP
rs1302317505 2770 dbSNP
rs537163082 2781 dbSNP
rs571272741 2785 dbSNP
rs1227462334 2789 dbSNP
rs1271446522 2793 dbSNP
rs918636636 2793 dbSNP
rs914442876 2796 dbSNP
rs1245246616 2800 dbSNP
rs991416190 2804 dbSNP
rs1490793810 2805 dbSNP
rs958572889 2806 dbSNP
rs1438954899 2807 dbSNP
rs1259869490 2813 dbSNP
rs1035471338 2822 dbSNP
rs1446649859 2825 dbSNP
rs1193905648 2846 dbSNP
rs1002604760 2849 dbSNP
rs961739168 2852 dbSNP
rs962808340 2858 dbSNP
rs1163557517 2860 dbSNP
rs1024049704 2861 dbSNP
rs1459730412 2863 dbSNP
rs990866214 2869 dbSNP
rs568540844 2870 dbSNP
rs1362253819 2872 dbSNP
rs1014608269 2873 dbSNP
rs1006259498 2875 dbSNP
rs888042715 2876 dbSNP
rs1051150945 2880 dbSNP
rs996427483 2881 dbSNP
rs539115128 2887 dbSNP
rs1220749676 2891 dbSNP
rs1040536627 2892 dbSNP
rs1293194324 2896 dbSNP
rs1259930485 2905 dbSNP
rs143803653 2914 dbSNP
rs1249951162 2917 dbSNP
rs1460065151 2918 dbSNP
rs1349405487 2935 dbSNP
rs1277409203 2938 dbSNP
rs1244236482 2939 dbSNP
rs923983278 2944 dbSNP
rs1335991485 2958 dbSNP
rs1043741836 2959 dbSNP
rs1453988041 2960 dbSNP
rs946743437 2961 dbSNP
rs1403227643 2964 dbSNP
rs1468797595 2971 dbSNP
rs796951922 2977 dbSNP
rs566273999 2978 dbSNP
rs1306005788 2985 dbSNP
rs991839876 2988 dbSNP
rs892917781 2996 dbSNP
rs1270201356 2999 dbSNP
rs1039756647 3008 dbSNP
rs1203049786 3011 dbSNP
rs942397141 3014 dbSNP
rs1484525174 3023 dbSNP
rs549638448 3025 dbSNP
rs891343028 3026 dbSNP
rs1482004211 3030 dbSNP
rs1382969519 3031 dbSNP
rs1250237134 3037 dbSNP
rs1051357967 3040 dbSNP
rs1184828195 3041 dbSNP
rs1426712944 3042 dbSNP
rs930105028 3047 dbSNP
rs1176512974 3053 dbSNP
rs1360445930 3058 dbSNP
rs1460382227 3061 dbSNP
rs918752651 3062 dbSNP
rs1470607554 3065 dbSNP
rs1397160033 3067 dbSNP
rs1428896738 3069 dbSNP
rs974247321 3072 dbSNP
rs941437134 3078 dbSNP
rs1302058679 3079 dbSNP
rs916695026 3085 dbSNP
rs991205897 3096 dbSNP
rs1251205948 3104 dbSNP
rs1270221191 3106 dbSNP
rs529513396 3107 dbSNP
rs1445783101 3109 dbSNP
rs1199758449 3112 dbSNP
rs1426624860 3112 dbSNP
rs1281457195 3115 dbSNP
rs1169157748 3121 dbSNP
rs1373513599 3123 dbSNP
rs1035985405 3126 dbSNP
rs1206396836 3129 dbSNP
rs1329369543 3130 dbSNP
rs1262160302 3134 dbSNP
rs1221439654 3141 dbSNP
rs981361322 3141 dbSNP
rs1212833505 3145 dbSNP
rs1370047261 3145 dbSNP
rs1347227807 3148 dbSNP
rs61982730 3152 dbSNP
rs1231328277 3154 dbSNP
rs1290011604 3155 dbSNP
rs1429858386 3159 dbSNP
rs1222807193 3162 dbSNP
rs1324631818 3163 dbSNP
rs967320453 3172 dbSNP
rs1320323227 3182 dbSNP
rs1020114088 3185 dbSNP
rs1451240446 3188 dbSNP
rs1161648961 3191 dbSNP
rs1384346474 3195 dbSNP
rs1425023310 3196 dbSNP
rs1401400679 3198 dbSNP
rs1405595887 3201 dbSNP
rs1174627212 3204 dbSNP
rs1471160139 3206 dbSNP
rs1430341961 3208 dbSNP
rs1437858638 3214 dbSNP
rs1313500200 3215 dbSNP
rs1186314658 3217 dbSNP
rs28758797 3218 dbSNP
rs11849026 3219 dbSNP
rs1244362855 3222 dbSNP
rs1248082982 3225 dbSNP
rs1194653083 3226 dbSNP
rs1464993749 3227 dbSNP
rs1405606803 3229 dbSNP
rs1158699443 3232 dbSNP
rs1399151176 3232 dbSNP
rs1242128358 3238 dbSNP
rs1201458017 3241 dbSNP
rs1011436760 3252 dbSNP
rs1325250938 3252 dbSNP
rs1278998937 3262 dbSNP
rs1382602064 3268 dbSNP
rs1213807624 3269 dbSNP
rs892852814 3270 dbSNP
rs1337332725 3278 dbSNP
rs958603703 3287 dbSNP
rs928482445 3289 dbSNP
rs563562392 3294 dbSNP
rs543563134 3296 dbSNP
rs1006932753 3297 dbSNP
rs890798974 3298 dbSNP
rs1201174012 3309 dbSNP
rs533261353 3313 dbSNP
rs1442933352 3314 dbSNP
rs564597055 3322 dbSNP
rs1469398385 3329 dbSNP
rs984549560 3330 dbSNP
rs1170134507 3336 dbSNP
rs941551207 3337 dbSNP
rs1473697489 3339 dbSNP
rs1408609340 3353 dbSNP
rs1422239071 3354 dbSNP
rs181913425 3358 dbSNP
rs1405512279 3364 dbSNP
rs1169054706 3366 dbSNP
rs1055225055 3368 dbSNP
rs939311151 3369 dbSNP
rs1241910838 3370 dbSNP
rs1028639356 3371 dbSNP
rs996445330 3372 dbSNP
rs1221383042 3373 dbSNP
rs927987002 3373 dbSNP
rs1345156458 3375 dbSNP
rs978113728 3375 dbSNP
rs1181228986 3376 dbSNP
rs1201704494 3376 dbSNP
rs1205523712 3377 dbSNP
rs1437174518 3377 dbSNP
rs967266750 3377 dbSNP
rs111938225 3379 dbSNP
rs1253791072 3379 dbSNP
rs1462338063 3380 dbSNP
rs902074329 3385 dbSNP
rs1057473216 3387 dbSNP
rs56901613 3388 dbSNP
rs999661692 3389 dbSNP
rs1174411606 3390 dbSNP
rs1435924154 3391 dbSNP
rs1429684713 3392 dbSNP
rs750344545 3392 dbSNP
rs771480457 3392 dbSNP
rs11848940 3393 dbSNP
rs549315547 3394 dbSNP
rs757036347 3394 dbSNP
rs760021942 3394 dbSNP
rs1234705814 3395 dbSNP
rs1423073673 3395 dbSNP
rs1423613181 3395 dbSNP
rs200145635 3395 dbSNP
rs35064677 3395 dbSNP
rs913168790 3395 dbSNP
rs1358662813 3396 dbSNP
rs989952522 3397 dbSNP
rs1248295815 3398 dbSNP
rs1388218620 3400 dbSNP
rs957235006 3403 dbSNP
rs1325394636 3421 dbSNP
rs1435682805 3423 dbSNP
rs1297866164 3424 dbSNP
rs1357221515 3425 dbSNP
rs1244899965 3426 dbSNP
rs1265819717 3434 dbSNP
rs1357320507 3438 dbSNP
rs902674521 3440 dbSNP
rs1440449973 3441 dbSNP
rs1356709103 3449 dbSNP
rs1282221471 3458 dbSNP
rs1464464759 3463 dbSNP
rs1044241524 3468 dbSNP
rs1309021648 3469 dbSNP
rs1018400607 3479 dbSNP
rs1383947327 3482 dbSNP
rs148981915 3483 dbSNP
rs1369466116 3484 dbSNP
rs1006637999 3492 dbSNP
rs1156485147 3494 dbSNP
rs1387495242 3498 dbSNP
rs1321988461 3499 dbSNP
rs955333621 3499 dbSNP
rs946804898 3502 dbSNP
rs1395454383 3503 dbSNP
rs1405475499 3504 dbSNP
rs1342095822 3521 dbSNP
rs1029272097 3525 dbSNP
rs1277949565 3526 dbSNP
rs895168790 3547 dbSNP
rs1176335515 3549 dbSNP
rs897389553 3551 dbSNP
rs1460360709 3564 dbSNP
rs1200436402 3570 dbSNP
rs1468287463 3578 dbSNP
rs1337553767 3581 dbSNP
rs1257261426 3585 dbSNP
rs1055102410 3587 dbSNP
rs1234340949 3590 dbSNP
rs1425881376 3596 dbSNP
rs1180136835 3602 dbSNP
rs1410694541 3604 dbSNP
rs1205640864 3605 dbSNP
rs1472717219 3605 dbSNP
rs937276331 3616 dbSNP
rs1403343545 3621 dbSNP
rs146834966 3622 dbSNP
rs8008033 3623 dbSNP
rs1404291897 3624 dbSNP
rs1389398847 3635 dbSNP
rs1055743031 3641 dbSNP
rs1322461328 3641 dbSNP
rs536833278 3642 dbSNP
rs1222210038 3645 dbSNP
rs1229304617 3647 dbSNP
rs940562082 3651 dbSNP
rs939435839 3652 dbSNP
rs1321556077 3656 dbSNP
rs566890645 3661 dbSNP
rs1257052029 3662 dbSNP
rs1194371264 3664 dbSNP
rs1251634391 3670 dbSNP
rs907697585 3671 dbSNP
rs1289322566 3678 dbSNP
rs928060253 3679 dbSNP
rs1042385729 3685 dbSNP
rs1432055116 3696 dbSNP
rs1404756663 3697 dbSNP
rs1364230416 3701 dbSNP
rs945370938 3703 dbSNP
rs984969715 3719 dbSNP
rs573952558 3735 dbSNP
rs990068719 3740 dbSNP
rs951815442 3743 dbSNP
rs772857032 3744 dbSNP
rs974368721 3746 dbSNP
rs1365781703 3756 dbSNP
rs1386226922 3762 dbSNP
rs985726379 3763 dbSNP
rs188774283 3765 dbSNP
rs537200130 3766 dbSNP
rs1019242405 3782 dbSNP
rs1274344294 3785 dbSNP
rs1157754850 3788 dbSNP
rs184335157 3805 dbSNP
rs955133010 3808 dbSNP
rs192690270 3809 dbSNP
rs993766640 3817 dbSNP
rs537744549 3826 dbSNP
rs1022450328 3838 dbSNP
rs551325984 3840 dbSNP
rs1268911255 3844 dbSNP
rs1011422801 3845 dbSNP
rs76710192 3848 dbSNP
rs1431349905 3853 dbSNP
rs141321371 3859 dbSNP
rs895424787 3861 dbSNP
rs548544356 3872 dbSNP
rs1294180773 3875 dbSNP
rs1055048939 3877 dbSNP
rs1266664336 3880 dbSNP
rs1201586681 3881 dbSNP
rs35041706 3896 dbSNP
rs1297466792 3904 dbSNP
rs1366592708 3907 dbSNP
rs765118130 3908 dbSNP
rs535748937 3910 dbSNP
rs1004135714 3920 dbSNP
rs906585336 3931 dbSNP
rs1266663688 3933 dbSNP
rs1042502176 3935 dbSNP
rs945318581 3937 dbSNP
rs1269065353 3939 dbSNP
rs1451260365 3944 dbSNP
rs1223267047 3947 dbSNP
rs146570195 3953 dbSNP
rs893808589 3955 dbSNP
rs1285586051 3960 dbSNP
rs1053821142 3968 dbSNP
rs1045663969 3971 dbSNP
rs537832160 3981 dbSNP
rs1319972967 3983 dbSNP
rs907729070 3986 dbSNP
rs1387793236 3992 dbSNP
rs935920485 4007 dbSNP
rs1437970310 4008 dbSNP
rs761364227 4013 dbSNP
rs930391692 4026 dbSNP
rs921669524 4038 dbSNP
rs1229280495 4040 dbSNP
rs1287737169 4042 dbSNP
rs974483361 4046 dbSNP
rs1314372410 4047 dbSNP
rs1326656377 4047 dbSNP
rs911152820 4048 dbSNP
rs149991928 4056 dbSNP
rs564449747 4063 dbSNP
rs1469100601 4065 dbSNP
rs776405371 4067 dbSNP
rs767997067 4068 dbSNP
rs547853691 4070 dbSNP
rs568385528 4071 dbSNP
rs1416161165 4073 dbSNP
rs966960761 4075 dbSNP
rs1471769664 4081 dbSNP
rs1158496671 4090 dbSNP
rs1022901723 4096 dbSNP
rs527749873 4101 dbSNP
rs1332725921 4103 dbSNP
rs1011032996 4115 dbSNP
rs1359116913 4121 dbSNP
rs959727262 4122 dbSNP
rs562131823 4124 dbSNP
rs984214992 4131 dbSNP
rs746526047 4135 dbSNP
rs1227464514 4136 dbSNP
rs1003580357 4143 dbSNP
rs1330657479 4147 dbSNP
rs1433654660 4150 dbSNP
rs906566109 4152 dbSNP
rs1260994516 4155 dbSNP
rs1184824997 4161 dbSNP
rs774963638 4169 dbSNP
rs139234286 4177 dbSNP
rs1211963158 4178 dbSNP
rs1249416653 4179 dbSNP
rs1482182716 4184 dbSNP
rs1248875452 4189 dbSNP
rs573991768 4200 dbSNP
rs150594036 4203 dbSNP
rs114140881 4210 dbSNP
rs577755253 4216 dbSNP
rs930529265 4235 dbSNP
rs1424999898 4239 dbSNP
rs921760269 4240 dbSNP
rs1415610720 4242 dbSNP
rs1038827776 4244 dbSNP
rs142643567 4245 dbSNP
rs1408806221 4246 dbSNP
rs911575701 4251 dbSNP
rs1380017625 4252 dbSNP
rs977764363 4258 dbSNP
rs534741357 4259 dbSNP
rs1320648682 4260 dbSNP
rs1220919307 4276 dbSNP
rs1272171735 4286 dbSNP
rs1341143679 4292 dbSNP
rs967365171 4293 dbSNP
rs915459797 4301 dbSNP
rs1439781588 4308 dbSNP
rs188423821 4313 dbSNP
rs749860001 4318 dbSNP
rs201186466 4320 dbSNP
rs3841295 4320 dbSNP
rs1478630816 4325 dbSNP
rs922430372 4327 dbSNP
rs959603782 4329 dbSNP
rs1429462822 4343 dbSNP
rs972578572 4345 dbSNP
rs939752104 4351 dbSNP
rs1033789403 4364 dbSNP
rs1403300195 4371 dbSNP
rs1372416566 4373 dbSNP
rs571999551 4386 dbSNP
rs1451259046 4388 dbSNP
rs1295246630 4405 dbSNP
rs970757709 4408 dbSNP
rs1390800992 4409 dbSNP
rs746357070 4411 dbSNP
rs865917664 4423 dbSNP
rs1015552179 4439 dbSNP
rs983783498 4441 dbSNP
rs529295969 4443 dbSNP
rs1208339129 4448 dbSNP
rs888439096 4452 dbSNP
rs370313500 4455 dbSNP
rs116626348 4458 dbSNP
rs971007902 4461 dbSNP
rs1021116353 4462 dbSNP
rs1201361213 4468 dbSNP
rs1189611990 4469 dbSNP
rs1313944117 4487 dbSNP
rs1375187254 4491 dbSNP
rs1471586005 4501 dbSNP
rs1480546793 4505 dbSNP
rs1250127359 4511 dbSNP
rs995146474 4513 dbSNP
rs1343518153 4514 dbSNP
rs1387810610 4520 dbSNP
rs560252574 4522 dbSNP
rs1299518636 4525 dbSNP
rs1038860381 4528 dbSNP
rs781479704 4533 dbSNP
rs1380083561 4536 dbSNP
rs184260546 4554 dbSNP
rs911603226 4556 dbSNP
rs1395419735 4559 dbSNP
rs771246826 4559 dbSNP
rs998054075 4559 dbSNP
rs1464821292 4562 dbSNP
rs1042452743 4568 dbSNP
rs111993945 4588 dbSNP
rs1371119453 4590 dbSNP
rs1187297943 4592 dbSNP
rs1368616143 4597 dbSNP
rs939877900 4602 dbSNP
rs909595352 4606 dbSNP
rs550039105 4607 dbSNP
rs539677949 4609 dbSNP
rs1410649100 4613 dbSNP
rs1457675472 4616 dbSNP
rs1370407635 4623 dbSNP
rs1290518157 4624 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000267436.4 | 3UTR | ACUAUAAAUCAUGCUGCUAUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000267436.4 | 3UTR | ACUAUAAAUCAUGCUGCUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000267436.4 | 3UTR | GACUAUAAAUCAUGCUGCUAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000267436.4 | 3UTR | ACUAUAAAUCAUGCUGCUAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000267436.4 | 3UTR | GACUAUAAAUCAUGCUGCUAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000267436.4 | 3UTR | ACUAUAAAUCAUGCUGCUAUAAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis 0.434 2.5e-2 0.455 1.9e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.416 3.4e-2 0.185 2.2e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.411 3.6e-2 -0.329 7.8e-2 20 Click to see details
GSE21032 Prostate cancer 0.161 7.3e-2 0.173 5.9e-2 83 Click to see details
GSE27834 Pluripotent stem cells -0.258 1.7e-1 -0.168 2.7e-1 16 Click to see details
GSE28260 Renal cortex and medulla 0.269 1.9e-1 0.187 2.7e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.1 1.9e-1 0.137 1.1e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.171 2.1e-1 0.186 1.9e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.175 2.1e-1 -0.263 1.1e-1 23 Click to see details
GSE14794 Lymphoblastoid cells 0.082 2.2e-1 0.076 2.4e-1 90 Click to see details
GSE17306 Multiple myeloma 0.11 2.3e-1 0.114 2.2e-1 49 Click to see details
GSE17498 Multiple myeloma -0.102 2.7e-1 -0.100 2.7e-1 40 Click to see details
GSE32688 Pancreatic cancer -0.087 3.2e-1 0.003 4.9e-1 32 Click to see details
GSE28544 Breast cancer 0.072 3.7e-1 0.465 1.1e-2 24 Click to see details
GSE19536 Breast cancer 0.024 4.1e-1 0.054 3.0e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells 0.039 4.3e-1 0.056 4.0e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.02 4.4e-1 0.020 4.4e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.039 4.5e-1 -0.329 1.5e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.011 4.8e-1 -0.053 4.0e-1 25 Click to see details
GSE21849 B cell lymphoma 0.006 4.9e-1 0.311 5.0e-2 29 Click to see details
GSE21849 B cell lymphoma 0.006 4.9e-1 0.311 5.0e-2 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA -0.737 0 -0.718 0.01 11 Click to see details
KIRP -0.449 0 -0.454 0 32 Click to see details
THCA -0.305 0.01 -0.337 0 59 Click to see details
LIHC -0.23 0.06 -0.236 0.05 49 Click to see details
LUAD -0.438 0.08 -0.378 0.11 12 Click to see details
KIRC -0.153 0.11 -0.120 0.16 68 Click to see details
KICH -0.126 0.27 -0.068 0.37 25 Click to see details
PCPG -0.617 0.29 -0.500 0.33 3 Click to see details
PAAD 0.413 0.29 0.200 0.4 4 Click to see details
CHOL -0.207 0.3 -0.117 0.38 9 Click to see details
BLCA 0.124 0.31 -0.026 0.46 18 Click to see details
STAD -0.08 0.33 -0.079 0.33 32 Click to see details
CESC 0.412 0.36 0.500 0.33 3 Click to see details
PRAD 0.048 0.37 -0.021 0.44 50 Click to see details
UCEC -0.052 0.42 -0.126 0.3 19 Click to see details
COAD 0.084 0.42 -0.024 0.48 8 Click to see details
BRCA 0.012 0.46 -0.074 0.25 84 Click to see details
LUSC 0.017 0.46 0.035 0.42 38 Click to see details
HNSC -0.006 0.48 0.059 0.36 42 Click to see details
HNSC -0.006 0.48 0.059 0.36 42 Click to see details
HNSC -0.006 0.48 0.059 0.36 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase