miRTarBase - #MIRT500953 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SREK1   
Synonyms SFRS12, SRrp508, SRrp86
Description splicing regulatory glutamic acid and lysine rich protein 1
Transcript NM_001077199   
Other Transcripts NM_139168   
Expression
Putative miRNA Targets on SREK1
3'UTR of SREK1
(miRNA target sites are highlighted)
>SREK1|NM_001077199|3'UTR
   1 GACCGACAAGTGTACCTCTGCACTCAATGCTGGAATCAAATCCAAAGCTTTTAATTCTCTCAACAAGATGTAAACAGGAA
  81 AGAAATCTAGTTGAGCATGAAGATAGGATCTAACAGCTTTTCCAGTTGTTAGATGACTTTGTGGCCATCTTGTTATTGAG
 161 TAAGAAAATAAAGCATGGACATCATGAAAATAACAGATGTTACCCAAACTCATCTTCTAAAATCTGTGCATTTCCATGGT
 241 GGCTGACACACTTGTCATGTGGTCTGTTAGTGTTTGCCAAGAACCATTGCAAATAAATTGAACATCAAAGATCCAAGTTT
 321 GTACTATCCCTAAAGACTGGAGATAAGCATTGGAGGCTCTTTTAAAAAATGCTAGTTACTGAATTTTGTATTGTTTTACT
 401 TTTTTTTTTATTTCAATATATACAGTTTGATGATGTGCTTGAAATTGGTGCAAATATATACACACCCTTGTAAGTGCAAA
 481 GTATGTAAGAAGTTTTAACATTTACTTCACAGGACTTGTGATTGTGTTAAATTCTCACTATTGTGTTTTCTTTTGCTCAC
 561 TGTTTAGGACAATTTTTCTTTAAAATAGTTTTGCAGATTAAAATTGCTTAAATAAGTGGATTAAAAAACTGACAATGCAT
 641 GCTACTGTTCTCTTTCAAAAGGAAGAGCAACCGTGTTGAATACTAATAATGATGAATTAGTATTCAGTGTTTAGAATCAT
 721 TGGGACTACCCACAAAGTGAGCATTTCTTTTTAAATTTTCTTGACATTTCCAAGCTTATTATGAATAATATTGCAGTGTG
 801 TCTTGTCAGCTGTAGGTGGCAAAGGTGCCCTTATAAAAAAGGAAACTGGCTTTTCAAAATGGGCTATGGGAGCACAAGCT
 881 GAAGCTTTAGTGCCTTCTACAATGTGGTATACTGTTTTCTAGAATTTTATATGTGCTAGTCATTCTCAATTCATATGGAA
 961 TCTAGATGGATATTTCATGCATACCCATAGAGAAGTGTGTAAGTGATATGTCAGAAGAGCTTCTTACTGATTTCACCTAA
1041 AATGAGAAGGAAGTCCTGTTTTCAAGAATGACATTAGAGTCATGCAGCTTTGGGACCATCAGTTTTATACTGTGATAATT
1121 GAAAATGAAACATGTTCTTATTTTCCTTAAATTGAAGAAAACCCTTTAGTTGTCTACATTGGATGGCCTTATTACCTCTC
1201 AATCATCTTTTCATAAATGATGTGCAGAAATTGTACTTAAGGACTTAGGAGTATATGGGAGGTTATTGGTTTTATGTTTA
1281 AGGATACGTTTACTTGAGTTTAAGATACAGGTCATCCATCATTCTTAGGCTCACTTTTTACAGAAAGTATGCAAATAGTA
1361 AAGTGACAGCACTGCTAATGTTTTTCCCCAGTACTATAACTTGTGGTTTCTGAACTCATTATTGTTGTATTTCCAAAAAA
1441 GTAATACCTTTTAATTAGTGTATTAAAAGTTAAGTATAATTATTTTAATGCAATCTAATACAATCAGATTACTCAGTTGC
1521 CTTACCTCATGGGAAGAGTTACTTTTTTAGATCTAAAAAGCTGAATAGCATGTTAGTTACTTGGTTTCAACTTGAGTTTT
1601 CTTTTAATGTTAATAAGATTGAAACTTTAGTATTTAGTGGGGAATGGAAAGAGTTGCCCTTGTTGCAAGTAATGAAGCCT
1681 GATTTGATTATGAAGCTGCTTAATCACTCTTCATGTGTTCAGAATTACTGTTTTTTTTGTTTGTTTTTCCTTTTTGTCAC
1761 TGTGTACATTAAAATTTTGGAAGATGCTTTACTATGTAAAGTATAGATGGTCATTTTAATCATTCAGCCACATACGGTTG
1841 GCTGGTAAACAGCTTATTCTGATACAAGAATGCTTGGGTGCATATGGAAAGATTGTGAAAGAGTGTGTCTTGCATCAACA
1921 GCTGTCTTATTTATGATATATAAGTAGAAATAGAGCAAATGTTGGAATCTGTTATTTTTAGTACCATGTCTTTAATAAAG
2001 CTAAGTATTTTAGAGGAAAATGTTTGTTTATGCATTTCAAAAAAGCATTTTAGTTTTATCCTGCTCATTTTAGTTGTCAT
2081 AGAGATTGTTGTGACGTGGAGAGTGCATGTTTGTGTGGTGTCTATAAAACAAGTCATTTAAAGTATGAGTGTTTTCTTGT
2161 ACTCTGGACCTATTACATGTTTCTTTATGTTGGTAATTAACATTTAATTTGGTTCTTGCTGCTAATTATTTTCTCTGCTG
2241 ATATTTATTAAGCTTTAAAATAATCGTACTATAATCTTGAAACACTGATTTGTAAAAACTAAGAATGAGTAGGAATACAA
2321 GAGATCTGGAGGAACAAATCAGATTGTTATTAGGGTTTGACTTTTTTTTTACATGGGCTTATGGAAGCAAGGCATTCTAG
2401 GGTCTAGAGGGATGTGTGTGTGTGCTTGTGTGTCCATGTGTGCGCATGCGCACGTGTGTATCTGTTTGAGACATACTTTC
2481 TCTGTTCACTTAAAAGAGCTCATGTTTTCATTTGTTTATTCTTTTCTTTCAGGGTATTTTGTTTTTTTCTTTAAGACTTC
2561 TTTTTTTAAATCCCAGGTAGATGTTGTCAGATAAACTTGAGGTAAGGCCAAGAAGACAGACATTTTATGCTTCATACTTT
2641 CTGTAATTATCTTTTGTAGCTTGATTACATAGAGTACCCTCTCTTCCTTAAGTTGTAGTTGCTATTTATCATTGTAGACA
2721 AATTCTGTTGCCTTTCAGCAACGTATGCTGAACTAGTATCATAAGATGGTGCATCAGTTCATAAGCTAGTGCATAAGTTT
2801 TGTGTCAAAACTTTTAAATCCTGAAGTTCTGCAGTTATCATCTTAGTTATTTTCTATCTAATTAGCTTATAATTGCAAAC
2881 ACTAGTCAGCTTGTGATCTCTGTGTTTCAAGTTCTTTTCTTCACGAGGTTCAGTACCTGCTATGTTGATCTTTGGCAGTG
2961 CCAGAGGCTTAAATTTTGACCTGCTCAATTAAAAATAAACACTGGCGTTTATAATGAAAAGGTTTTTTTGTCGGGGGGGG
3041 GGGGGTCAAGAGAATTTATTTTGTGATAGTAATAATTTTCAAGACCTTCAGTCATTCCTATGTCTATGTTGCTATCTTTA
3121 TTTTAAAACTTAGAACCCTGATCTAACTCCCTTCTCAAGTGAAGATACTGTGTAGATTCAAGAATTATAATGTAGAGTAA
3201 TAGGCCTTTAAGTTTTTTTTTAATCTGTTAGAAATAAAGAGCATGATTTAATTATTGTTGAATTAACAATTAAAATGAAT
3281 CCCTTTGGAGGGATGGCATTGAATAACTTATAATTTCAGTGAATCATTTACGTTTTCATTGGAAGACAGTATCTGATTTC
3361 AACTGGTGCGTTACGAAGTAGAGCCATTCCCACAAAGTAAATGTGCAGTGCCCATGTTTCTTGTGTTTAAATATTTTTTA
3441 TTTTCACTACATATATATTATTTTCTCATGTTTATTTACTAATGTAATTTTCACTTAAAATTAGATGTTTATTTTCAAAT
3521 TTTAAAAGCTAGTGCTCTTAAAAGAGCTAAATTATATTTCTGGAAGCAGGAGTTTAGTATAAATGTAATAAAATTTTAAA
3601 ATAAAATTGACTTCCCTACTTAATCTTGGGTTTGTGGGTGAGTTTGTTTTTAGTACACTCTTATTGGTGGTTTTGCCTGA
3681 AGAGTAATACATTATTATTATTACTTTTCTTTTTGAGACAGGGTCTCACTCTGTCACTCAGGCTGGAGTGCAGTGACACG
3761 ATCATGGCTCACTGCAATCTTGACCTTTCTCGGCATGGATGATCCTCTCACCTCAGCCTCTTGAATAGCTGGGACCACAG
3841 ACATGTGCCACCAAGCCCAGTTAATTTTAGAATTTTTTTTGTAGAGACAGGATCTTGCCATGTTGCCTAGACTGGTCTCA
3921 AACTCCTGGGCTCAAACAATCTGTCTGCCTCAGCCTTCTAAAGTGCTGAGATTACAGGTGTGAGGTACTGCACCTGGCAA
4001 TACGTTATTTTAAAAGTAAACGCTAAGCCATTTATGACTTTGGTTATATTCAGTCAGTTGGATTTAGTAACTAATAACTA
4081 GCTTTCTTCCATTCTAAGGTACTTTTATAGTTTCTAGCAATTAGTTTGTTACAATTAGCTTATATCAGATATAACAGTTC
4161 TTAATATAATGTTTATAAAAGGTTTTAAGTCTGTTGCCTGATTTTTAAATTTATATCTAGTTAACATTTTAATTTTAAAA
4241 TTGCCAACTTTTGGGAGATTTCACATATTTTACCTCTATATTTTATTTTTCCAGGATTGGTATGGAGGAGTAGTACCTTC
4321 TATTCTTGGTTTATTTTTATTTGCTAGACATAATTTCTTAACTACATATGTAAGTATAAATTCATAAAAATCACACTGAA
4401 AGAATAGGTTGATTTCAACCATTTTGAGGGTACTGGTAGGTAACACACTGTTGGGGAATAAACTAAAGAATTTCTGATTT
4481 CTACAATAGATTTAAGTATGAAATTTGAGTATACTGTGTAGCTGTGTAGATCAACTTAATGCTTAAAAAATTACCTCCTT
4561 AATGATTAGATTAATAGAACAGTGTTAGATTATCAAGGGAAGAGTTTGGAATGTAAACATAAACATGCTGCATAGGTGGT
4641 GGTTATTTGTGAGTAGGACTACTTTTAAATGGTACTAGTAAAGATTTATCAAACAATGCTGCTATTATGTTGCTATATTT
4721 TTAATAAAATGAAAATCTTAAAATCTTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||| |     ||||||| 
Target 5' atCAAACAA-----TGCTGCTa 3'
4688 - 4704 151.00 -12.70
2
miRNA  3' guGUUUGG-UAAUACACGACGAu 5'
            :|| :: :|| | ||||||| 
Target 5' ttTAATTTGGTTCT-TGCTGCTa 3'
2203 - 2224 147.00 -10.70
3
miRNA  3' guguUUGGUA---AUAC----ACGACGAu 5'
              |::|||   ||||    ||:|||| 
Target 5' cttcAGTCATTCCTATGTCTATGTTGCTa 3'
3086 - 3114 140.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26996789 14 COSMIC
COSN30536000 104 COSMIC
COSN30127523 184 COSMIC
COSN28190494 215 COSMIC
COSN31543341 267 COSMIC
COSN5078412 292 COSMIC
COSN25235082 332 COSMIC
COSN31602809 410 COSMIC
COSN30544692 416 COSMIC
COSN31539608 463 COSMIC
COSN23833194 489 COSMIC
COSN31481736 537 COSMIC
COSN2115033 616 COSMIC
COSN31519573 627 COSMIC
COSN16128410 820 COSMIC
COSN31567581 864 COSMIC
COSN4851470 893 COSMIC
COSN24301260 977 COSMIC
COSN26465210 1037 COSMIC
COSN31545059 1289 COSMIC
COSN31962416 1678 COSMIC
COSN20813577 1729 COSMIC
COSN31595755 1739 COSMIC
COSN31609742 1793 COSMIC
COSN31550227 1862 COSMIC
COSN31529502 1948 COSMIC
COSN25664635 2023 COSMIC
COSN24941473 2343 COSMIC
COSN17366511 2445 COSMIC
COSN27457758 3037 COSMIC
COSN26026542 3038 COSMIC
COSN29695243 3047 COSMIC
COSN21723780 3375 COSMIC
COSN2115034 3602 COSMIC
COSN9309630 4035 COSMIC
COSN9455033 4059 COSMIC
COSN32062625 4106 COSMIC
COSN7950966 4697 COSMIC
COSN22241302 4710 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs762235810 3 dbSNP
rs748411605 5 dbSNP
rs1317988269 6 dbSNP
rs886293896 7 dbSNP
rs750876016 9 dbSNP
rs756642132 10 dbSNP
rs1292218760 11 dbSNP
rs753929836 17 dbSNP
rs755050453 18 dbSNP
rs779190142 19 dbSNP
rs1415715463 20 dbSNP
rs1470431557 21 dbSNP
rs981419378 24 dbSNP
rs928293721 26 dbSNP
rs544134881 28 dbSNP
rs1241443323 29 dbSNP
rs1405458293 34 dbSNP
rs757059562 35 dbSNP
rs781137776 36 dbSNP
rs1262220516 38 dbSNP
rs747998879 38 dbSNP
rs745760835 40 dbSNP
rs769875523 41 dbSNP
rs775340017 44 dbSNP
rs748801670 45 dbSNP
rs1274437321 46 dbSNP
rs768120050 48 dbSNP
rs1385883245 56 dbSNP
rs914340789 59 dbSNP
rs1270111649 62 dbSNP
rs1429300222 65 dbSNP
rs1319426150 67 dbSNP
rs946876618 70 dbSNP
rs1044270754 77 dbSNP
rs1440382624 83 dbSNP
rs1275081994 88 dbSNP
rs1368703690 102 dbSNP
rs910744630 105 dbSNP
rs1221313350 110 dbSNP
rs1418957616 113 dbSNP
rs1166061214 118 dbSNP
rs1299699247 118 dbSNP
rs772313864 123 dbSNP
rs1192792575 132 dbSNP
rs774046219 136 dbSNP
rs111240132 141 dbSNP
rs1213992114 142 dbSNP
rs73109316 147 dbSNP
rs1463610501 148 dbSNP
rs1047820542 151 dbSNP
rs878963239 156 dbSNP
rs1234015188 157 dbSNP
rs971545715 157 dbSNP
rs1006337576 163 dbSNP
rs981535899 171 dbSNP
rs140733287 172 dbSNP
rs927437864 174 dbSNP
rs536732169 175 dbSNP
rs1441973061 176 dbSNP
rs1247543750 178 dbSNP
rs376966512 184 dbSNP
rs1326962625 187 dbSNP
rs1411540891 190 dbSNP
rs1397126088 191 dbSNP
rs1286262097 195 dbSNP
rs557709888 201 dbSNP
rs1003168017 213 dbSNP
rs1035572790 215 dbSNP
rs1193843446 225 dbSNP
rs114614001 235 dbSNP
rs1230626760 237 dbSNP
rs371421903 247 dbSNP
rs886325176 248 dbSNP
rs747545212 250 dbSNP
rs747271062 251 dbSNP
rs1306129694 255 dbSNP
rs1456283100 256 dbSNP
rs1372893373 257 dbSNP
rs914267329 258 dbSNP
rs1351232848 259 dbSNP
rs944527220 265 dbSNP
rs559040141 267 dbSNP
rs968854411 268 dbSNP
rs1432826245 284 dbSNP
rs1377004461 287 dbSNP
rs1433895126 294 dbSNP
rs1040609177 297 dbSNP
rs900283998 298 dbSNP
rs985267803 304 dbSNP
rs1470180278 309 dbSNP
rs1256243843 311 dbSNP
rs996317724 313 dbSNP
rs1484991773 316 dbSNP
rs1032704049 318 dbSNP
rs892816446 325 dbSNP
rs114754545 327 dbSNP
rs760760211 329 dbSNP
rs976293605 330 dbSNP
rs1225731669 333 dbSNP
rs923536908 339 dbSNP
rs1290759415 341 dbSNP
rs1292779187 350 dbSNP
rs1412803115 363 dbSNP
rs746937736 364 dbSNP
rs1303145259 376 dbSNP
rs981607738 377 dbSNP
rs572378728 392 dbSNP
rs1223272829 395 dbSNP
rs1034917185 397 dbSNP
rs1162192278 400 dbSNP
rs1400965971 400 dbSNP
rs60627043 400 dbSNP
rs879388077 400 dbSNP
rs541257363 401 dbSNP
rs771010237 410 dbSNP
rs1219719926 411 dbSNP
rs1183006711 412 dbSNP
rs1267846461 415 dbSNP
rs1483264732 416 dbSNP
rs1184210063 417 dbSNP
rs1249562415 418 dbSNP
rs929971793 419 dbSNP
rs1186975003 426 dbSNP
rs942099379 431 dbSNP
rs1272561069 437 dbSNP
rs1163297459 438 dbSNP
rs1044491646 451 dbSNP
rs186108217 452 dbSNP
rs551171033 458 dbSNP
rs574920037 460 dbSNP
rs1365266201 469 dbSNP
rs1290437468 471 dbSNP
rs1040237483 473 dbSNP
rs900315750 482 dbSNP
rs891700573 484 dbSNP
rs780784410 487 dbSNP
rs746138013 502 dbSNP
rs1166062250 505 dbSNP
rs1349140500 507 dbSNP
rs1428471561 509 dbSNP
rs1010133028 511 dbSNP
rs1417750254 521 dbSNP
rs1442204492 523 dbSNP
rs1021243602 532 dbSNP
rs968447956 537 dbSNP
rs1252607824 538 dbSNP
rs985580736 539 dbSNP
rs1212109500 541 dbSNP
rs3846482 545 dbSNP
rs1469856083 546 dbSNP
rs1054620070 561 dbSNP
rs1203676158 562 dbSNP
rs1305709838 566 dbSNP
rs1018027607 573 dbSNP
rs965219750 579 dbSNP
rs1228866622 587 dbSNP
rs1370057885 592 dbSNP
rs72770238 595 dbSNP
rs1291361942 604 dbSNP
rs1297129164 607 dbSNP
rs1461871606 608 dbSNP
rs1353275727 621 dbSNP
rs1171115205 628 dbSNP
rs1450464606 632 dbSNP
rs755427990 636 dbSNP
rs1207003686 642 dbSNP
rs1455762673 644 dbSNP
rs563756942 652 dbSNP
rs1268072604 670 dbSNP
rs751797318 673 dbSNP
rs929528662 674 dbSNP
rs1252985389 688 dbSNP
rs190529318 693 dbSNP
rs1205850305 694 dbSNP
rs1188230316 702 dbSNP
rs1346846048 710 dbSNP
rs1277965669 712 dbSNP
rs1034582946 721 dbSNP
rs144683530 726 dbSNP
rs995656288 730 dbSNP
rs767567022 733 dbSNP
rs1374955215 762 dbSNP
rs1182554926 764 dbSNP
rs1390427453 765 dbSNP
rs538046771 771 dbSNP
rs1431295686 776 dbSNP
rs942043449 779 dbSNP
rs1467713123 786 dbSNP
rs184113110 791 dbSNP
rs759665104 792 dbSNP
rs982815386 796 dbSNP
rs1044849597 797 dbSNP
rs528372449 804 dbSNP
rs1417371498 806 dbSNP
rs905959267 810 dbSNP
rs1182768180 819 dbSNP
rs1485318991 827 dbSNP
rs1255069421 833 dbSNP
rs1212763472 835 dbSNP
rs938796240 835 dbSNP
rs1056875477 836 dbSNP
rs1409840158 842 dbSNP
rs891669573 845 dbSNP
rs201817605 849 dbSNP
rs201476611 850 dbSNP
rs1445946223 851 dbSNP
rs1021550477 858 dbSNP
rs904148169 864 dbSNP
rs1006577558 865 dbSNP
rs965975991 867 dbSNP
rs1018414102 868 dbSNP
rs1410915247 878 dbSNP
rs1355387670 879 dbSNP
rs1398140202 880 dbSNP
rs1403411580 881 dbSNP
rs1158184141 883 dbSNP
rs1451941744 884 dbSNP
rs1414217449 886 dbSNP
rs1160023117 888 dbSNP
rs561723861 893 dbSNP
rs965145524 902 dbSNP
rs1189610942 903 dbSNP
rs1415578402 903 dbSNP
rs976424133 910 dbSNP
rs781549412 911 dbSNP
rs976523909 912 dbSNP
rs921837585 914 dbSNP
rs1366159292 928 dbSNP
rs931809888 929 dbSNP
rs1054292458 930 dbSNP
rs1332102033 932 dbSNP
rs1295107154 934 dbSNP
rs1338518154 937 dbSNP
rs1247671514 941 dbSNP
rs1341410263 951 dbSNP
rs1318105670 953 dbSNP
rs1380690978 954 dbSNP
rs1030504534 956 dbSNP
rs550459707 957 dbSNP
rs776684641 963 dbSNP
rs1041386212 966 dbSNP
rs1415835666 970 dbSNP
rs909483737 971 dbSNP
rs1202458805 972 dbSNP
rs1372230542 988 dbSNP
rs1190761981 990 dbSNP
rs1451171408 999 dbSNP
rs1438908002 1004 dbSNP
rs963678778 1005 dbSNP
rs1248179739 1008 dbSNP
rs1466723954 1010 dbSNP
rs1291437004 1021 dbSNP
rs1212106256 1022 dbSNP
rs1357693153 1023 dbSNP
rs147491761 1029 dbSNP
rs1225694879 1033 dbSNP
rs1002515896 1034 dbSNP
rs1367869309 1037 dbSNP
rs1056459817 1038 dbSNP
rs1186297696 1044 dbSNP
rs550404231 1045 dbSNP
rs1371634918 1047 dbSNP
rs1475311678 1050 dbSNP
rs927308358 1055 dbSNP
rs1173625692 1072 dbSNP
rs3833648 1076 dbSNP
rs570484937 1076 dbSNP
rs78425920 1080 dbSNP
rs1166144440 1082 dbSNP
rs1431374017 1087 dbSNP
rs1390598974 1097 dbSNP
rs1192567276 1098 dbSNP
rs1452214214 1100 dbSNP
rs1468735159 1103 dbSNP
rs1198961616 1104 dbSNP
rs1336154067 1109 dbSNP
rs1436790824 1120 dbSNP
rs1272908593 1132 dbSNP
rs1057179113 1135 dbSNP
rs996119720 1137 dbSNP
rs1437471992 1138 dbSNP
rs1295681640 1142 dbSNP
rs1027148675 1154 dbSNP
rs1325595652 1163 dbSNP
rs1369056489 1167 dbSNP
rs1276896518 1168 dbSNP
rs913034007 1170 dbSNP
rs1437263884 1173 dbSNP
rs1335296144 1175 dbSNP
rs1326731316 1177 dbSNP
rs140063649 1179 dbSNP
rs1370882411 1188 dbSNP
rs1172798771 1189 dbSNP
rs1432411210 1194 dbSNP
rs1043343270 1195 dbSNP
rs1019687486 1196 dbSNP
rs1414902956 1203 dbSNP
rs904453707 1214 dbSNP
rs1276447310 1215 dbSNP
rs1342780751 1219 dbSNP
rs1484330464 1227 dbSNP
rs1252907033 1231 dbSNP
rs757628381 1234 dbSNP
rs1310870691 1236 dbSNP
rs1280966713 1237 dbSNP
rs965766400 1240 dbSNP
rs1349991835 1243 dbSNP
rs1286552373 1249 dbSNP
rs1411527128 1252 dbSNP
rs566067994 1255 dbSNP
rs1222889666 1257 dbSNP
rs1007249976 1258 dbSNP
rs1039355985 1264 dbSNP
rs150048693 1267 dbSNP
rs1399785448 1287 dbSNP
rs1405102977 1288 dbSNP
rs1332942085 1296 dbSNP
rs145403501 1297 dbSNP
rs1260639422 1309 dbSNP
rs921882882 1311 dbSNP
rs1187928883 1312 dbSNP
rs1199992975 1315 dbSNP
rs997898053 1319 dbSNP
rs1025399447 1322 dbSNP
rs950835191 1324 dbSNP
rs989968493 1330 dbSNP
rs1446647699 1347 dbSNP
rs1266249914 1364 dbSNP
rs1230303592 1366 dbSNP
rs1379796679 1368 dbSNP
rs1329995864 1371 dbSNP
rs1479733413 1384 dbSNP
rs1226578211 1397 dbSNP
rs914386483 1406 dbSNP
rs1176356757 1407 dbSNP
rs1429510020 1417 dbSNP
rs1412716255 1418 dbSNP
rs1322200291 1419 dbSNP
rs945858569 1422 dbSNP
rs574937385 1425 dbSNP
rs1393145352 1430 dbSNP
rs1164780439 1445 dbSNP
rs879515369 1449 dbSNP
rs775835208 1451 dbSNP
rs1422600507 1452 dbSNP
rs1416331597 1459 dbSNP
rs537612262 1463 dbSNP
rs1041460068 1465 dbSNP
rs1475332916 1470 dbSNP
rs1246411434 1477 dbSNP
rs1016871472 1492 dbSNP
rs554242121 1493 dbSNP
rs1272663648 1494 dbSNP
rs1219222759 1502 dbSNP
rs765118058 1504 dbSNP
rs938351911 1506 dbSNP
rs1313433660 1507 dbSNP
rs1055463602 1508 dbSNP
rs1362824380 1510 dbSNP
rs1299315558 1513 dbSNP
rs1369547018 1515 dbSNP
rs1435399982 1515 dbSNP
rs148786886 1517 dbSNP
rs1325264426 1526 dbSNP
rs1291297213 1535 dbSNP
rs927308457 1536 dbSNP
rs1343424929 1538 dbSNP
rs1404185756 1544 dbSNP
rs1166189288 1551 dbSNP
rs1288942469 1571 dbSNP
rs1409730392 1577 dbSNP
rs577242272 1585 dbSNP
rs1356985121 1591 dbSNP
rs546245872 1597 dbSNP
rs1330540822 1601 dbSNP
rs1190711484 1604 dbSNP
rs1450347990 1607 dbSNP
rs1252389867 1608 dbSNP
rs992834697 1609 dbSNP
rs931568693 1613 dbSNP
rs913338403 1614 dbSNP
rs945855567 1616 dbSNP
rs1339754505 1619 dbSNP
rs1276535351 1621 dbSNP
rs559766800 1622 dbSNP
rs1228604779 1626 dbSNP
rs1259668051 1626 dbSNP
rs571474615 1628 dbSNP
rs1182892365 1629 dbSNP
rs887293460 1631 dbSNP
rs1294604297 1633 dbSNP
rs1042884318 1640 dbSNP
rs1369045768 1643 dbSNP
rs1170893955 1646 dbSNP
rs1430571476 1649 dbSNP
rs1356612728 1652 dbSNP
rs1019712324 1653 dbSNP
rs1174279973 1655 dbSNP
rs901253809 1671 dbSNP
rs187359493 1673 dbSNP
rs942632363 1677 dbSNP
rs1268184807 1678 dbSNP
rs542142241 1686 dbSNP
rs1309580133 1690 dbSNP
rs1253198412 1691 dbSNP
rs1253618837 1704 dbSNP
rs1473886516 1714 dbSNP
rs561968962 1714 dbSNP
rs749421612 1718 dbSNP
rs1028310904 1725 dbSNP
rs953439598 1728 dbSNP
rs1346957724 1729 dbSNP
rs1235016425 1731 dbSNP
rs990042323 1731 dbSNP
rs1375671145 1736 dbSNP
rs775053497 1736 dbSNP
rs1228259622 1739 dbSNP
rs1305700890 1739 dbSNP
rs1040063060 1740 dbSNP
rs530625337 1741 dbSNP
rs1404130570 1744 dbSNP
rs1021466290 1747 dbSNP
rs771649898 1749 dbSNP
rs967193868 1754 dbSNP
rs1158523545 1761 dbSNP
rs1378213165 1761 dbSNP
rs550714902 1769 dbSNP
rs762786534 1771 dbSNP
rs1414078555 1782 dbSNP
rs1182875182 1786 dbSNP
rs1485206889 1795 dbSNP
rs1253859415 1805 dbSNP
rs928415641 1808 dbSNP
rs938439160 1819 dbSNP
rs991591632 1820 dbSNP
rs1226036719 1822 dbSNP
rs763851595 1836 dbSNP
rs1305662043 1837 dbSNP
rs886843291 1838 dbSNP
rs1246451087 1865 dbSNP
rs1005735934 1866 dbSNP
rs1357682283 1868 dbSNP
rs1397932992 1878 dbSNP
rs77120402 1879 dbSNP
rs1275849218 1883 dbSNP
rs1455694123 1887 dbSNP
rs772793617 1888 dbSNP
rs1048691612 1903 dbSNP
rs1390978368 1903 dbSNP
rs1472441642 1913 dbSNP
rs1176000070 1916 dbSNP
rs762349508 1927 dbSNP
rs1366441132 1932 dbSNP
rs963914250 1935 dbSNP
rs1189371109 1941 dbSNP
rs746493235 1942 dbSNP
rs532850757 1945 dbSNP
rs1206478233 1952 dbSNP
rs940209449 1965 dbSNP
rs1268236401 1970 dbSNP
rs1189818714 1972 dbSNP
rs1209839931 1981 dbSNP
rs1383592845 1982 dbSNP
rs1264268556 1987 dbSNP
rs1247419865 1990 dbSNP
rs1341499535 1998 dbSNP
rs1297104969 2001 dbSNP
rs1424304804 2002 dbSNP
rs768325249 2026 dbSNP
rs1321316340 2031 dbSNP
rs1404629421 2034 dbSNP
rs1372246028 2041 dbSNP
rs992802281 2045 dbSNP
rs1164994483 2046 dbSNP
rs1458191149 2049 dbSNP
rs1389352526 2066 dbSNP
rs546232830 2068 dbSNP
rs1450957996 2073 dbSNP
rs1248028443 2081 dbSNP
rs1460353869 2086 dbSNP
rs967419470 2087 dbSNP
rs979295940 2096 dbSNP
rs996919903 2097 dbSNP
rs1028800805 2098 dbSNP
rs1274404276 2101 dbSNP
rs893818196 2110 dbSNP
rs1344589610 2114 dbSNP
rs1312342765 2117 dbSNP
rs1435831839 2120 dbSNP
rs566130772 2125 dbSNP
rs1329457908 2133 dbSNP
rs942527950 2136 dbSNP
rs1325396502 2144 dbSNP
rs1010826571 2147 dbSNP
rs1021500602 2149 dbSNP
rs1166484569 2159 dbSNP
rs975331206 2163 dbSNP
rs977261133 2164 dbSNP
rs1171685302 2165 dbSNP
rs922524835 2169 dbSNP
rs933922631 2172 dbSNP
rs1046745218 2173 dbSNP
rs915617423 2176 dbSNP
rs886812647 2177 dbSNP
rs535038312 2178 dbSNP
rs773408766 2180 dbSNP
rs1484275362 2183 dbSNP
rs1273950600 2202 dbSNP
rs1218893751 2212 dbSNP
rs1202986293 2213 dbSNP
rs1342897420 2217 dbSNP
rs548610772 2225 dbSNP
rs1038534921 2235 dbSNP
rs1233800170 2239 dbSNP
rs1306163804 2242 dbSNP
rs1349788367 2242 dbSNP
rs908828315 2244 dbSNP
rs761904161 2245 dbSNP
rs899297504 2260 dbSNP
rs1412425723 2266 dbSNP
rs1426592883 2267 dbSNP
rs1172665027 2268 dbSNP
rs1041632687 2272 dbSNP
rs1411858001 2273 dbSNP
rs192193797 2277 dbSNP
rs813386 2281 dbSNP
rs1189476022 2282 dbSNP
rs1473752998 2283 dbSNP
rs1233838217 2297 dbSNP
rs182755852 2300 dbSNP
rs557960013 2301 dbSNP
rs1049844079 2304 dbSNP
rs893845401 2312 dbSNP
rs1328637581 2319 dbSNP
rs896053031 2327 dbSNP
rs1014487270 2331 dbSNP
rs1467560726 2356 dbSNP
rs377270968 2356 dbSNP
rs1042364979 2362 dbSNP
rs1283400556 2362 dbSNP
rs1360533887 2362 dbSNP
rs1439701037 2364 dbSNP
rs1334469267 2374 dbSNP
rs1385859469 2375 dbSNP
rs1456229035 2375 dbSNP
rs1157522223 2387 dbSNP
rs903138864 2393 dbSNP
rs998710902 2395 dbSNP
rs1020232516 2400 dbSNP
rs1472045269 2400 dbSNP
rs967819970 2402 dbSNP
rs978826706 2405 dbSNP
rs959913686 2406 dbSNP
rs1013131447 2408 dbSNP
rs1266343640 2409 dbSNP
rs557507525 2410 dbSNP
rs1022751600 2413 dbSNP
rs759254541 2413 dbSNP
rs776974730 2413 dbSNP
rs1435281804 2414 dbSNP
rs756894446 2429 dbSNP
rs34110748 2434 dbSNP
rs983816798 2437 dbSNP
rs1226387051 2441 dbSNP
rs142459612 2444 dbSNP
rs908189519 2445 dbSNP
rs961006379 2450 dbSNP
rs151136009 2451 dbSNP
rs1321976596 2453 dbSNP
rs767657509 2454 dbSNP
rs538968071 2455 dbSNP
rs915362810 2461 dbSNP
rs562304667 2463 dbSNP
rs754419435 2463 dbSNP
rs755410499 2463 dbSNP
rs1261269730 2473 dbSNP
rs975228033 2474 dbSNP
rs187829356 2477 dbSNP
rs933888760 2479 dbSNP
rs140025009 2480 dbSNP
rs542201764 2481 dbSNP
rs1246033934 2483 dbSNP
rs982736778 2484 dbSNP
rs908170174 2488 dbSNP
rs555388343 2500 dbSNP
rs941032012 2505 dbSNP
rs1038095033 2509 dbSNP
rs79914614 2511 dbSNP
rs1299439075 2517 dbSNP
rs1012784616 2519 dbSNP
rs1425691982 2519 dbSNP
rs937798868 2522 dbSNP
rs1293412455 2523 dbSNP
rs952462039 2534 dbSNP
rs1429593648 2537 dbSNP
rs754284189 2537 dbSNP
rs1015323014 2542 dbSNP
rs1388540708 2542 dbSNP
rs752314456 2550 dbSNP
rs896020427 2551 dbSNP
rs151337319 2557 dbSNP
rs574730562 2557 dbSNP
rs922919192 2560 dbSNP
rs954434606 2575 dbSNP
rs1269602570 2576 dbSNP
rs1204159693 2584 dbSNP
rs1481976079 2587 dbSNP
rs985675504 2598 dbSNP
rs544113952 2609 dbSNP
rs1227746004 2612 dbSNP
rs1311050960 2618 dbSNP
rs1298577738 2622 dbSNP
rs1217911888 2637 dbSNP
rs1347935862 2638 dbSNP
rs1304342204 2642 dbSNP
rs1409582104 2656 dbSNP
rs757709579 2659 dbSNP
rs1160805292 2665 dbSNP
rs946865073 2668 dbSNP
rs1462710754 2669 dbSNP
rs573563061 2670 dbSNP
rs903158553 2671 dbSNP
rs140242767 2673 dbSNP
rs1181414435 2678 dbSNP
rs1033039912 2679 dbSNP
rs1288638061 2680 dbSNP
rs1253948399 2684 dbSNP
rs1368762122 2684 dbSNP
rs539946450 2689 dbSNP
rs1323686001 2693 dbSNP
rs779292425 2705 dbSNP
rs964464517 2709 dbSNP
rs1228358826 2711 dbSNP
rs1348967056 2711 dbSNP
rs1407227876 2716 dbSNP
rs1392399254 2719 dbSNP
rs1281968203 2735 dbSNP
rs1322855124 2743 dbSNP
rs996968814 2744 dbSNP
rs1470978566 2746 dbSNP
rs1056858458 2759 dbSNP
rs1229062591 2762 dbSNP
rs1029500816 2764 dbSNP
rs948623992 2767 dbSNP
rs955195756 2772 dbSNP
rs1182254885 2774 dbSNP
rs1423089513 2776 dbSNP
rs36840 2787 dbSNP
rs888293641 2792 dbSNP
rs908467368 2794 dbSNP
rs962382335 2798 dbSNP
rs191705953 2809 dbSNP
rs1247010539 2815 dbSNP
rs1490788171 2822 dbSNP
rs758843834 2825 dbSNP
rs937748802 2830 dbSNP
rs1327692751 2832 dbSNP
rs896903229 2832 dbSNP
rs1411205727 2833 dbSNP
rs1240176206 2835 dbSNP
rs1056179518 2836 dbSNP
rs529480169 2837 dbSNP
rs1383540971 2840 dbSNP
rs371717217 2842 dbSNP
rs751502346 2843 dbSNP
rs917374588 2846 dbSNP
rs1331380328 2848 dbSNP
rs1433076703 2861 dbSNP
rs1387031140 2869 dbSNP
rs986134712 2871 dbSNP
rs1022477388 2881 dbSNP
rs1405234367 2883 dbSNP
rs950225462 2890 dbSNP
rs1399693735 2892 dbSNP
rs1041930796 2894 dbSNP
rs1444882583 2897 dbSNP
rs1186106199 2901 dbSNP
rs903416617 2901 dbSNP
rs1448273595 2912 dbSNP
rs1000483434 2915 dbSNP
rs1054858349 2924 dbSNP
rs899870597 2925 dbSNP
rs1356029890 2939 dbSNP
rs996895143 2943 dbSNP
rs992193689 2945 dbSNP
rs1345402840 2948 dbSNP
rs1411050032 2955 dbSNP
rs1297216692 2969 dbSNP
rs1226248594 2971 dbSNP
rs1328318709 2987 dbSNP
rs548936666 2990 dbSNP
rs1386165953 2996 dbSNP
rs558952894 2998 dbSNP
rs948048599 3000 dbSNP
rs1425126402 3002 dbSNP
rs955162780 3003 dbSNP
rs531219134 3007 dbSNP
rs376190617 3008 dbSNP
rs550932724 3019 dbSNP
rs1194446559 3020 dbSNP
rs1225169794 3023 dbSNP
rs1267460440 3023 dbSNP
rs1451540388 3023 dbSNP
rs1490630170 3023 dbSNP
rs1219936177 3030 dbSNP
rs1274154940 3031 dbSNP
rs138467718 3031 dbSNP
rs1241690456 3032 dbSNP
rs1270863484 3032 dbSNP
rs1329272838 3032 dbSNP
rs1285166072 3033 dbSNP
rs1328363820 3033 dbSNP
rs1491428998 3033 dbSNP
rs369111824 3033 dbSNP
rs548956707 3033 dbSNP
rs7701031 3033 dbSNP
rs1290845889 3034 dbSNP
rs1491181141 3034 dbSNP
rs1274066639 3035 dbSNP
rs888325189 3035 dbSNP
rs1349587831 3036 dbSNP
rs941213217 3036 dbSNP
rs896932868 3037 dbSNP
rs998325977 3037 dbSNP
rs1029390184 3038 dbSNP
rs1232982516 3038 dbSNP
rs1328384115 3039 dbSNP
rs889465718 3039 dbSNP
rs1022508439 3040 dbSNP
rs1283198769 3040 dbSNP
rs36839 3041 dbSNP
rs1157603365 3042 dbSNP
rs1342023397 3042 dbSNP
rs960879665 3043 dbSNP
rs978257934 3043 dbSNP
rs1447314029 3044 dbSNP
rs56958757 3044 dbSNP
rs61693819 3044 dbSNP
rs1386686282 3045 dbSNP
rs1323306205 3046 dbSNP
rs1442442492 3046 dbSNP
rs58068478 3046 dbSNP
rs1460144392 3047 dbSNP
rs1365408548 3052 dbSNP
rs1430892125 3054 dbSNP
rs1022075688 3059 dbSNP
rs962933528 3064 dbSNP
rs974050275 3066 dbSNP
rs1331463935 3067 dbSNP
rs916636045 3068 dbSNP
rs926277216 3073 dbSNP
rs959032460 3074 dbSNP
rs1246127792 3076 dbSNP
rs1284894534 3081 dbSNP
rs991833812 3090 dbSNP
rs1385256264 3092 dbSNP
rs917687118 3095 dbSNP
rs779824832 3098 dbSNP
rs1244126677 3104 dbSNP
rs969796314 3105 dbSNP
rs1314031901 3107 dbSNP
rs1042267023 3115 dbSNP
rs1342608936 3121 dbSNP
rs984786269 3137 dbSNP
rs1270828303 3141 dbSNP
rs1403457435 3144 dbSNP
rs1367886297 3158 dbSNP
rs909832924 3159 dbSNP
rs1461684519 3165 dbSNP
rs941246264 3179 dbSNP
rs1036890458 3183 dbSNP
rs924839145 3189 dbSNP
rs936249597 3190 dbSNP
rs1197243010 3192 dbSNP
rs1437220260 3192 dbSNP
rs1481265691 3195 dbSNP
rs1269342596 3196 dbSNP
rs551497263 3200 dbSNP
rs899798234 3205 dbSNP
rs1252760086 3207 dbSNP
rs553510214 3210 dbSNP
rs757739582 3211 dbSNP
rs1311145384 3213 dbSNP
rs138692651 3213 dbSNP
rs1222247653 3217 dbSNP
rs1051157524 3222 dbSNP
rs891197864 3224 dbSNP
rs566934159 3231 dbSNP
rs1006552371 3247 dbSNP
rs1043366925 3251 dbSNP
rs1300170556 3263 dbSNP
rs1462537611 3267 dbSNP
rs904135539 3268 dbSNP
rs1174104621 3272 dbSNP
rs1475958343 3278 dbSNP
rs535501774 3279 dbSNP
rs555718607 3280 dbSNP
rs575491803 3281 dbSNP
rs544492878 3282 dbSNP
rs1417952512 3283 dbSNP
rs1409963626 3284 dbSNP
rs557721161 3285 dbSNP
rs1180804131 3290 dbSNP
rs1015834539 3297 dbSNP
rs1252191515 3304 dbSNP
rs898366587 3305 dbSNP
rs34076355 3308 dbSNP
rs769860328 3308 dbSNP
rs182366522 3310 dbSNP
rs1033607000 3311 dbSNP
rs187444452 3314 dbSNP
rs991770565 3316 dbSNP
rs7721410 3317 dbSNP
rs984817341 3320 dbSNP
rs1365603774 3327 dbSNP
rs1229317087 3330 dbSNP
rs115321831 3332 dbSNP
rs1309376243 3333 dbSNP
rs771088399 3340 dbSNP
rs924736252 3343 dbSNP
rs962015892 3345 dbSNP
rs1454700237 3348 dbSNP
rs936191706 3350 dbSNP
rs542290580 3353 dbSNP
rs1157966327 3356 dbSNP
rs1264399403 3357 dbSNP
rs990780326 3363 dbSNP
rs1202597950 3366 dbSNP
rs146470105 3367 dbSNP
rs1448410404 3368 dbSNP
rs932913310 3370 dbSNP
rs933823837 3371 dbSNP
rs1461419009 3375 dbSNP
rs1051080666 3376 dbSNP
rs1205096266 3382 dbSNP
rs1485062350 3384 dbSNP
rs1475338927 3387 dbSNP
rs1177790682 3390 dbSNP
rs1358976318 3393 dbSNP
rs1313249961 3397 dbSNP
rs910998685 3403 dbSNP
rs1383659294 3409 dbSNP
rs942433424 3412 dbSNP
rs1468316479 3418 dbSNP
rs1380473289 3422 dbSNP
rs547841516 3422 dbSNP
rs531153318 3424 dbSNP
rs903540590 3448 dbSNP
rs1423836890 3452 dbSNP
rs1384204095 3456 dbSNP
rs1165130844 3460 dbSNP
rs891165285 3463 dbSNP
rs1372027517 3468 dbSNP
rs1193013037 3479 dbSNP
rs1427249767 3486 dbSNP
rs940083181 3493 dbSNP
rs1053119398 3495 dbSNP
rs1037120104 3497 dbSNP
rs1315947163 3506 dbSNP
rs1490299797 3508 dbSNP
rs896732343 3508 dbSNP
rs1225032998 3512 dbSNP
rs1360182187 3516 dbSNP
rs1269678342 3519 dbSNP
rs898287369 3524 dbSNP
rs551256187 3530 dbSNP
rs1437023569 3533 dbSNP
rs1014204612 3540 dbSNP
rs1033957166 3541 dbSNP
rs769651443 3547 dbSNP
rs895055002 3549 dbSNP
rs1321388967 3564 dbSNP
rs1363523176 3567 dbSNP
rs1013492541 3571 dbSNP
rs1395404704 3585 dbSNP
rs571118533 3596 dbSNP
rs1268284390 3617 dbSNP
rs1375253469 3625 dbSNP
rs966353201 3626 dbSNP
rs1480286081 3630 dbSNP
rs978211627 3635 dbSNP
rs1203016746 3647 dbSNP
rs1282511255 3648 dbSNP
rs1006329007 3658 dbSNP
rs1016329293 3661 dbSNP
rs1446814294 3665 dbSNP
rs1341615102 3672 dbSNP
rs200842606 3676 dbSNP
rs1032105876 3680 dbSNP
rs1251780622 3681 dbSNP
rs1222854237 3688 dbSNP
rs191937190 3691 dbSNP
rs547187291 3692 dbSNP
rs1284949542 3694 dbSNP
rs1271657943 3695 dbSNP
rs773012342 3702 dbSNP
rs1198790136 3705 dbSNP
rs1364520875 3720 dbSNP
rs972053219 3729 dbSNP
rs990315094 3730 dbSNP
rs1383922391 3732 dbSNP
rs1396618511 3736 dbSNP
rs762635069 3741 dbSNP
rs1452003986 3743 dbSNP
rs1425091267 3747 dbSNP
rs921461339 3760 dbSNP
rs1304771755 3761 dbSNP
rs1427897576 3762 dbSNP
rs536696826 3777 dbSNP
rs932880790 3778 dbSNP
rs759618477 3785 dbSNP
rs987068458 3792 dbSNP
rs112099289 3793 dbSNP
rs1307012539 3794 dbSNP
rs1337017246 3796 dbSNP
rs942506911 3797 dbSNP
rs1236379300 3798 dbSNP
rs1259804654 3800 dbSNP
rs979156030 3803 dbSNP
rs1356669138 3807 dbSNP
rs769639221 3812 dbSNP
rs1349726182 3827 dbSNP
rs1277356883 3836 dbSNP
rs1443939743 3843 dbSNP
rs775674264 3851 dbSNP
rs912525753 3860 dbSNP
rs113376859 3873 dbSNP
rs940043483 3873 dbSNP
rs1339318352 3888 dbSNP
rs878869297 3894 dbSNP
rs1037492505 3897 dbSNP
rs1415364757 3898 dbSNP
rs1407750278 3902 dbSNP
rs1490000287 3904 dbSNP
rs1156990457 3907 dbSNP
rs548104774 3918 dbSNP
rs949642867 3924 dbSNP
rs1183036469 3926 dbSNP
rs1460065257 3927 dbSNP
rs1244849167 3933 dbSNP
rs920039247 3933 dbSNP
rs1045702118 3937 dbSNP
rs796941477 3940 dbSNP
rs1281889808 3961 dbSNP
rs185204301 3986 dbSNP
rs1251253083 3988 dbSNP
rs1225318456 3994 dbSNP
rs1420992168 3998 dbSNP
rs1353955662 4001 dbSNP
rs566119813 4004 dbSNP
rs931419122 4005 dbSNP
rs1054879254 4006 dbSNP
rs1384407614 4009 dbSNP
rs895023717 4016 dbSNP
rs762844926 4022 dbSNP
rs753946257 4023 dbSNP
rs1316658441 4024 dbSNP
rs762329626 4025 dbSNP
rs993941252 4042 dbSNP
rs999218289 4043 dbSNP
rs73109317 4044 dbSNP
rs1387175966 4052 dbSNP
rs116705125 4061 dbSNP
rs996362220 4062 dbSNP
rs1028491609 4070 dbSNP
rs1217651509 4072 dbSNP
rs7706313 4075 dbSNP
rs1397946542 4076 dbSNP
rs763976270 4076 dbSNP
rs1389148883 4078 dbSNP
rs1219829681 4088 dbSNP
rs1360907880 4100 dbSNP
rs1312819961 4101 dbSNP
rs1305724756 4110 dbSNP
rs987015331 4117 dbSNP
rs1383068306 4119 dbSNP
rs1268971776 4121 dbSNP
rs1402190884 4135 dbSNP
rs912829421 4140 dbSNP
rs1302719144 4142 dbSNP
rs537810224 4144 dbSNP
rs961648755 4146 dbSNP
rs1422978537 4147 dbSNP
rs780493683 4148 dbSNP
rs963846249 4148 dbSNP
rs557649084 4149 dbSNP
rs374012452 4154 dbSNP
rs1409506417 4158 dbSNP
rs1357748107 4162 dbSNP
rs1244649017 4163 dbSNP
rs1417261461 4168 dbSNP
rs1252431135 4183 dbSNP
rs1188242365 4192 dbSNP
rs1477998633 4198 dbSNP
rs925067761 4200 dbSNP
rs1196756115 4204 dbSNP
rs758688711 4206 dbSNP
rs931413590 4213 dbSNP
rs1055141071 4219 dbSNP
rs916382108 4221 dbSNP
rs1265709587 4235 dbSNP
rs780626507 4240 dbSNP
rs1305286891 4253 dbSNP
rs988234988 4256 dbSNP
rs917610604 4265 dbSNP
rs36838 4267 dbSNP
rs1283035789 4269 dbSNP
rs533767705 4279 dbSNP
rs1046276034 4285 dbSNP
rs902410286 4290 dbSNP
rs1441519033 4292 dbSNP
rs1352862204 4301 dbSNP
rs1422217463 4308 dbSNP
rs553536252 4314 dbSNP
rs1428598148 4323 dbSNP
rs1185660158 4330 dbSNP
rs999878581 4340 dbSNP
rs1053448430 4348 dbSNP
rs1267556203 4349 dbSNP
rs1045327675 4358 dbSNP
rs1479334870 4361 dbSNP
rs1234130777 4366 dbSNP
rs1198791481 4367 dbSNP
rs1319206592 4369 dbSNP
rs905406447 4371 dbSNP
rs893501672 4384 dbSNP
rs1222043107 4387 dbSNP
rs573441375 4394 dbSNP
rs1170942098 4395 dbSNP
rs1302193807 4396 dbSNP
rs942217691 4397 dbSNP
rs749505148 4398 dbSNP
rs995885756 4403 dbSNP
rs1447694489 4404 dbSNP
rs1028752802 4406 dbSNP
rs993580717 4407 dbSNP
rs954163931 4426 dbSNP
rs1377996610 4430 dbSNP
rs890468189 4431 dbSNP
rs1406196119 4435 dbSNP
rs542701543 4435 dbSNP
rs779065217 4438 dbSNP
rs1007931733 4443 dbSNP
rs1409794296 4443 dbSNP
rs1018183988 4449 dbSNP
rs1243018899 4460 dbSNP
rs1202359846 4463 dbSNP
rs1334321740 4467 dbSNP
rs963920947 4473 dbSNP
rs1228087318 4480 dbSNP
rs1000683161 4484 dbSNP
rs1315341108 4487 dbSNP
rs1032116076 4496 dbSNP
rs1019815744 4499 dbSNP
rs1240908434 4500 dbSNP
rs1382171150 4504 dbSNP
rs956720713 4508 dbSNP
rs961644394 4512 dbSNP
rs1397730645 4513 dbSNP
rs973437111 4519 dbSNP
rs1288070355 4527 dbSNP
rs1309765087 4532 dbSNP
rs1225895374 4533 dbSNP
rs1257427918 4541 dbSNP
rs1324403583 4543 dbSNP
rs1205749184 4544 dbSNP
rs1241502172 4551 dbSNP
rs1451410400 4551 dbSNP
rs1362041667 4556 dbSNP
rs1158895431 4558 dbSNP
rs1443436547 4558 dbSNP
rs1382857778 4561 dbSNP
rs748719917 4564 dbSNP
rs970423176 4579 dbSNP
rs1257562155 4580 dbSNP
rs773744730 4582 dbSNP
rs980432854 4582 dbSNP
rs1288383723 4592 dbSNP
rs942247475 4597 dbSNP
rs1358749644 4598 dbSNP
rs1289670561 4599 dbSNP
rs919900001 4600 dbSNP
rs1247169991 4604 dbSNP
rs1340961046 4605 dbSNP
rs386688692 4608 dbSNP
rs1294831649 4609 dbSNP
rs1380262608 4610 dbSNP
rs1426610162 4612 dbSNP
rs952832590 4614 dbSNP
rs1298355782 4616 dbSNP
rs190581819 4618 dbSNP
rs1429330667 4619 dbSNP
rs916684182 4627 dbSNP
rs919437659 4631 dbSNP
rs1458002121 4633 dbSNP
rs1369526659 4634 dbSNP
rs949495212 4637 dbSNP
rs1193142727 4642 dbSNP
rs575994650 4648 dbSNP
rs544643834 4657 dbSNP
rs923804275 4661 dbSNP
rs1463594475 4662 dbSNP
rs1490247212 4662 dbSNP
rs1265588080 4669 dbSNP
rs1173700660 4670 dbSNP
rs1404864926 4672 dbSNP
rs1211693149 4676 dbSNP
rs1431084618 4680 dbSNP
rs1289755261 4686 dbSNP
rs1357171327 4686 dbSNP
rs1364530894 4687 dbSNP
rs1319663876 4695 dbSNP
rs1278591255 4697 dbSNP
rs1404175582 4697 dbSNP
rs576429443 4698 dbSNP
rs1278142310 4699 dbSNP
rs890532342 4702 dbSNP
rs1007592628 4705 dbSNP
rs1346746207 4708 dbSNP
rs1225394026 4709 dbSNP
rs1464510179 4709 dbSNP
rs1261411878 4714 dbSNP
rs1054114379 4716 dbSNP
rs1480342595 4718 dbSNP
rs893437395 4721 dbSNP
rs1000755222 4727 dbSNP
rs931647253 4733 dbSNP
rs1452182357 4745 dbSNP
rs1050147491 4748 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8 PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000334121.6 | 3UTR | GAUUUAUCAAACAAUGCUGCUAUUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000334121.6 | 3UTR | AUUUAUCAAACAAUGCUGCUAUUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.737 1.0e-4 0.732 1.2e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.598 8.0e-4 0.672 1.2e-4 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.485 9.5e-3 0.497 7.9e-3 23 Click to see details
GSE21032 Prostate cancer 0.205 3.2e-2 0.142 1.0e-1 83 Click to see details
GSE19350 CNS germ cell tumors 0.472 6.1e-2 0.231 2.4e-1 12 Click to see details
GSE19536 Breast cancer 0.152 6.6e-2 0.200 2.3e-2 100 Click to see details
GSE28260 Renal cortex and medulla -0.397 9.0e-2 -0.302 1.6e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.343 9.7e-2 -0.238 1.9e-1 16 Click to see details
GSE28544 Breast cancer -0.2 1.7e-1 -0.512 5.3e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.187 2.1e-1 0.235 1.6e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.081 2.2e-1 -0.049 3.2e-1 90 Click to see details
GSE38226 Liver fibrosis 0.175 2.2e-1 0.211 1.8e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.123 2.5e-1 0.150 2.1e-1 32 Click to see details
GSE17498 Multiple myeloma -0.109 2.5e-1 -0.047 3.9e-1 40 Click to see details
GSE21687 Ependynoma primary tumors 0.078 2.7e-1 0.051 3.4e-1 64 Click to see details
GSE19783 ER- ER- breast cancer 0.061 3.0e-1 0.113 1.6e-1 79 Click to see details
GSE17306 Multiple myeloma -0.059 3.4e-1 -0.118 2.1e-1 49 Click to see details
GSE21849 B cell lymphoma 0.056 3.9e-1 0.333 3.9e-2 29 Click to see details
GSE26953 Aortic valvular endothelial cells -0.019 4.6e-1 -0.022 4.6e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.005 4.9e-1 0.075 3.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.005 4.9e-1 0.075 3.6e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD 0.67 0.01 0.657 0.01 12 Click to see details
HNSC 0.302 0.03 0.334 0.02 42 Click to see details
PAAD 0.931 0.03 0.400 0.3 4 Click to see details
BRCA -0.174 0.06 -0.206 0.03 84 Click to see details
PCPG -0.794 0.21 -1.000 0.5 3 Click to see details
KICH 0.165 0.22 0.204 0.16 25 Click to see details
KIRP 0.119 0.26 0.247 0.09 32 Click to see details
PRAD -0.089 0.27 -0.062 0.33 50 Click to see details
CESC 0.615 0.29 0.500 0.33 3 Click to see details
COAD -0.232 0.29 -0.643 0.04 8 Click to see details
KIRC 0.057 0.32 0.096 0.22 68 Click to see details
LUSC 0.074 0.33 0.114 0.25 38 Click to see details
UCEC 0.09 0.36 0.137 0.29 19 Click to see details
LIHC 0.05 0.37 -0.040 0.39 49 Click to see details
BLCA 0.076 0.38 0.146 0.28 18 Click to see details
ESCA -0.062 0.43 -0.064 0.43 11 Click to see details
STAD -0.021 0.45 -0.060 0.37 32 Click to see details
CHOL -0.037 0.46 0.017 0.48 9 Click to see details
THCA 0.01 0.47 -0.121 0.18 59 Click to see details
THCA 0.01 0.47 -0.121 0.18 59 Click to see details
THCA 0.01 0.47 -0.121 0.18 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B