miRTarBase - #MIRT501506 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PRICKLE2   
Synonyms EPM5
Description prickle planar cell polarity protein 2
Transcript NM_198859   
Expression
Putative miRNA Targets on PRICKLE2
3'UTR of PRICKLE2
(miRNA target sites are highlighted)
>PRICKLE2|NM_198859|3'UTR
   1 TATGATTGGGATCAGGGAATGGGAGAAGATGGGAGCTAAGAATGTAAAGTCAGAAACTTGCACTGTTTTAAATGTTAAAG
  81 CGCTTTTGGGGGTGGCTTATGGGGGAGAAAAGGGAAAATGCTGTCAGTAGATGGAGGCAAGGTTACAGGTTGACTCAATA
 161 GGTAGTCACAGTTCTTGGCATGTTGAATATTATTTGCACATTTCACTTTGGAAACACAGTAGACTCTATCGAGGCCAGGC
 241 TTGGTCACTTCCTTCCCATCAGTTCTGTGTTGAGTTGCCATCTCTCAAGATGGTAAATTGTTTCCTGCTCGCTTTTATCC
 321 TCTCTGGTTCTCTTACTTTTAGGACCCTTTTTTCAGTAAGTAATTTGTTTATTAGCCAGGACCCAAGACTAAGTTATTTA
 401 CATGTCCATTGTAAATGCAATGTAAATGAGAGTTCTGATAAAATATTTTTGTATTTTGTAATATCAAAGGAATTTCTATA
 481 TCGTAGGACTCAGTGGGGACTTGCATGCACATCCACCATTGTCTCTGAGTAGTATTGAAATGTGGCCCGGTACCACCTTT
 561 TTTTTTTTTTTTTTTTTTTCTATACAAATTTGTTACATGTCAGTGAGACCTTTTTCAAAGGAACATATTCAATTTGGCTT
 641 TTTGTGGCTGAAAAAACATAACTGTTAGACCCAAAGCATTTTATGCTCCGTTCCATCTTAAGGAGCCATCCTTAAGTCTG
 721 CTCCCACCCTCAGTAGAATTTATTTTCTACAAAGTGGTAGTAATTTTTTTTTAAATTGCAAATGTAATTTTTGCCAATTA
 801 GAGAAACCAACCGGTGTCAGTAAAATTCTGTGAGAAATGCCATCCCTGCTGGGAATGTTGAAGTTACTTAATGTTGATCT
 881 ATCCCTTGGGGAAAGTAAAAGTGACTGTGAGTGGTGCCATTGTGTGATGTCAGCATGACGTTGTTTTGAATGTGGCATTA
 961 TGTTCTGGTGCTCATGTTTCCTGGATTGTATTATCTGCTTTCCTTTACCAAGGCAGACAGAACTGCTGCCTTAGCCTGAC
1041 AACCGGTTGTCCTCAAAGCAAATGAACTTAAGCATTTGGGATTGAGGGACAGAAGGATTCTGAGGGGGCTCTGCGAGGGA
1121 CGGTGTGTGACATGTCATGCCTGGAGAAGGAACAAGGCTATTTGAAAACAGAAGGCAGGTCAAGGGTAGAAGTTAAAGGA
1201 GAATCTGAAGGCAGGTCAGGGAAAAGAAGAACTGGAAATGAAACAGAGGACAGGTGACAACCACCTCGAAGAGCTCCCAG
1281 AGATTGTAGAAAGAGTCCAGTGTAACCAGCTTAGTAACCAGAGTATCTGGATTACCCAGGAAGGTTGAGCTGCTGAGATT
1361 TCAGTGGTGCAATGTCTTTAAAAAAACAGGCTTTGTTGGGAGGGTATTTCCATTTTGAACTTTGAGGACTGTTGGTCAGA
1441 AAATGGGCTCAAAAGTGAGTTTGCTTAATGAAGACATTTAACGGTTGTGCTGTTTATAGTAAAATAAAACTCCCTACCTT
1521 GCTTCAGTTAAAAATGAAGCACTTGGTTTCTTCCATCCTCCTCCTCCCCTTAATGGATTGTGGCAGTTGAAATAATCCAT
1601 CGGATGACCCACCTGTAGTGAGATGTACTGTCGATGTAGTGCCCGGTGTATCTCAGTGGCCATCTGCCATGGTGAGGTGA
1681 GCGTGATCTCTTTTCAGTATAGTAGTTAACATTTTCTAGTATTTTTTATGGAGAGAATGTCAAAAGTGGCATTTCAGACC
1761 CCGTCCCAGATGGGTCTGAGGAAAGGAAGGCTGTAAAGGACATGGTAATGGCACTCCATTCGGGATGTATTAAAATAATT
1841 TGCTTTTCAGGTATTAATATGACATTTGTCATTGTCACTGATTTTTTTAAAAAAGCAATGCACATGTTGGTTGTGGCTGT
1921 TTTCCGCATGCTATCTTCATATCTAAATGCTTCATTAATTATCCGAGCCTCCGGAGAATTAACTCTATTACGTTTGTATA
2001 GTAAGTTTGTAAACTGCTTGGCAAACTGATTAAGAAATAATTTGCAATACCGTGCTACTAAAGTGGCAGGTTTCTGGTAG
2081 AAATTGTGCGAGTCCAATTTGGAGTTTTAAGTTCCTTGATTGATGAAACTAAAAAGGCAATTTTGGAAAAAGAGAGGGGG
2161 AAAAGTAGATCACTTATCTTAGCAAACGGTTGAAAATATGTCTGTCCTCTGTGGCCCCAAATCCAGTGAAAGAAATTCTC
2241 CCAGTAAAAGTTGCTTCCTAACTCTGTTTTTCTCAGAATACCTCTTACCTTTCTCAAAGAAAGCTTCAACCACCATCATC
2321 AGAAAGAAGGTGGCCTAAAAACTGACACATGGCCAGTGCCCGGAGGGGTCTGGAGGCATAAGTCTAGATGCCCAGAGAGC
2401 ATCCAGGCACTGAACTGCTCAGAGCTTGAGATGAAATGACATACAAGCTTCAGGGTAAAACTGTCTACTAGCAAGATTAC
2481 CTCCCTCAATTCTACCATTGCAGATTTCTTCTGACCCCAAATGCAACCTTACAGAGAATGCTGAATGAGGAAGGCCAATT
2561 CCTTACAATGATGGCAGAACCCCCAAGCGAATGCCCTATTGAGGAGAAGGACATCACTGTATTTGGAATTCTGCCTGCTA
2641 GTGATAGCTCACACATCACATCCCAGAATCCCACTCCCAATGCATTATTTCCTGAGGCAAGAACTTAAGGTCCTCACCTA
2721 ATTCCTCCATCACAACCATTAACTCTTATTGGACAAGCTCCTCCTGTGAGTAGGGCCTGTACTCACTTCCTCTTAGATCA
2801 TAATTCCATCTTCAAGAGACTGATTTCCAGAATAGTAATCTTTTTCCAGCGTTCTCTCTTCTCCAATGCCCTGGTTGTTA
2881 TTTTTCCCACCTCTCCTAATATTGATCTTCTTGTCTTTTGGTTAGAACTGCAACTTCGGAGTTGAGTTCATTTCCTATTG
2961 CTGCTCAATTCAGTAGCAACATAGCTGGCTTGTTCCCAGACCCAGGAAGTATAAGTCATTGACAGTTTCCTGAGTGGCTC
3041 TGCCAATCCATACCACCCTTGGTACTGTGAAAAGGCTTCTTGGCAGCCAGGTGGCATTGAGGATGGTATTCAGGGCGCTT
3121 TCCTTCTGTCATATAGTTGTGGGATCTCTACCAAGTGTGAAGGTGAATGAGGTAAGGGAGATCAGAACCATGCTTCCTGG
3201 TTTTTCATACATCCAAGGAAGAAGTCCTGGTGTGGGTTGTTTGACACCTTCTTTCCACTTTCACCTTTTATTTTTTATTC
3281 CTTCCTTTCTACCCCCAACCAGTCGAGCAAATGAGCAATTTTGTGTTTCTAATACAGGATCTGGAAGTAGTGCTTTCTAA
3361 TCCTCATTTCCTGTAGGATGTTCCTGCACTATAACAAGATTATGTTTTCTTCCTTCTGCAGCAGCTTTCTGCTTCTTGGG
3441 TACTACTAGCTATTGTTCAATTCAGGTGAGGCCTGTGATGACATATATGTAGCATGTGCTCTGCGCTCCCTGCAAGCTGA
3521 GCAGATACAACCAATGCATCACTGTATACTCTTGCTGAGAATGTGGATGCAGCCTCACAGATCTTTGCAACACTCCAACC
3601 AGCCAGGACCAGTTGATCAGAACTGATCTTATTGGTCTGATAACCAATCTTATTTGTGAACTGATTCATATCTGTCTTTC
3681 CACTCTTGGTTCTCTTGCCGTAGAACAAAAACAGTTTAGGAAGCATAATTACGAACATTTAGGAACCAATATGTATAAGT
3761 AATTCGGAGACTCCAATTCACCTGCCCCTCCCCCATCCCAGGTTGTGGAGGCTCGAGGAAGCTGACTTCTTAGGCTAAAG
3841 GACAAAAAAATCTCTTTACCTCCTTGGCCATTTTCATGTTCTCTGCCAATTACTATAGGCAGTCTTCATTTTGCAGAGGT
3921 GAGGTAAGACTTCATCTTATTCTTCATGTAATCCCACCTTCTAACAAAAAATAAATAAATATTTAAATTCCAAGGAGAAG
4001 TGTTCTTTGTGTATTTCTAGCAGAAAACAGATGCTTAAGCCTAAGAAGGAAGATCCGTCCATGACAAAGGAAAGTGGAAA
4081 ACTGAACCAGTTATCTGAATACTTCATGCCAGGACAGTTGCTATTAGCAACTGTTTTGCACCTTCAGGGCTTTAAAATGG
4161 GCTCTGCAGACAGCATTTGCATATGCAAGACTCAGTAGCCAAGCCTCCACTGCCAATTGTTGAAGGCAGTTTCAGATCGC
4241 CACCTTTTGAGGTACATTTCTTTAAGCACAAGAGAAGTAGAAATGGCCTTTGCCTTGTCTCCAGTGGTTTGTCCCTCTGG
4321 TGCCTCAGCAGATACCAGAGCTTATTCTTATGACCATTTGGAAGTAGTCCTCAAAGTAAAGATCAAGAAAAAATTGGATT
4401 CTTTTTCCATTTTCTCATAATAGTAGCCTAGTCAACACAAGACTCCCATAAAATATGACTCACTATTGGGAGCCATACTA
4481 TTTTATAAGCTTACTTCCTGCTGACAAAACTAGCTTTCCTCAAGGAAATATAAAGGAGGGGAAAGTCACATAGTGTTAGG
4561 AAAACATTCCTGTGTTTTGAATACGATGAATCCATAGGATAGAGAAAAATCTGCTTGTTCTATTCTGAGAGTTCTCTGAG
4641 ATATCCCTTCACTCTGCTTGGCATTTGGCCATTGATATTCAACAGGTCACTGACCAAGCTTTTCTAAATTTTTCAGAGAG
4721 AGTTACTTACCAGTAAGGTCTGTTCTTAAACCTACCTAGTTGATTTTCATATCTTTCCATAAAGTGTCATGATTCTGTCA
4801 TAGACCCTGACTTAACATTGTAAGGACTATGAGTCCTCCATTTTTTAATTAATTTTTTTTTAGCAAATTAGGACTTCGGC
4881 AGGTTTTCCTCTCCTAAACTCATTCTTTCCTCCACAGGATTGCTTTGTCCATCTCCTGCTTTCATTTCAAGTGCATAAAC
4961 AAAACCTCAAAGGGCCTGGGAAGGTGAGGCAGGCCAGAGTCTGTGTTCTGTGTTGAGTGTCAAGCTATTTGTTAAGAAGG
5041 TCTGCAACAGGCCTTTGGTGTGGGCTCTGCCAGAGACTGTTCTGAACACTTTGCTTGAGATCCGTGCCCTGTAAAATGGA
5121 TATGATGTTTTACTGATGTCTGTAATACATTTGTAAACTTCCAATAAAATTTGAATAAAAGAAATGTTGCCATTCTTCTC
5201 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUA----AUACACGACGAu 5'
             |: :|||    ||| ||||||| 
Target 5' ttgAGTTCATTTCCTAT-TGCTGCTc 3'
2942 - 2966 152.00 -10.20
2
miRNA  3' gugUUUGGUAA--U----ACACGACGAu 5'
             ||: ||||  |    |||||||:| 
Target 5' atgAAGACATTTAACGGTTGTGCTGTTt 3'
1468 - 1495 143.00 -15.20
3
miRNA  3' guguuugGUAAUAC---ACGACGAu 5'
                 |||||||   || |||| 
Target 5' aatgtggCATTATGTTCTGGTGCTc 3'
949 - 973 131.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
902795 65 ClinVar
346470 133 ClinVar
902794 146 ClinVar
346469 469 ClinVar
902793 560 ClinVar
346468 580 ClinVar
346467 581 ClinVar
346465 582 ClinVar
346466 582 ClinVar
346464 585 ClinVar
346463 690 ClinVar
346462 695 ClinVar
346461 793 ClinVar
901895 943 ClinVar
346460 995 ClinVar
901894 1044 ClinVar
346459 1114 ClinVar
901342 1157 ClinVar
901341 1274 ClinVar
346458 1277 ClinVar
901340 1292 ClinVar
346457 1310 ClinVar
346456 1476 ClinVar
346455 1495 ClinVar
901339 1508 ClinVar
346454 1560 ClinVar
346453 1568 ClinVar
346452 1589 ClinVar
346451 1605 ClinVar
900178 1621 ClinVar
900177 1633 ClinVar
900176 1647 ClinVar
902731 1682 ClinVar
346450 1763 ClinVar
346449 1868 ClinVar
346448 1964 ClinVar
346447 1970 ClinVar
902730 1982 ClinVar
346446 1991 ClinVar
902729 2089 ClinVar
902728 2102 ClinVar
346445 2207 ClinVar
346444 2269 ClinVar
346443 2288 ClinVar
901827 2290 ClinVar
346442 2296 ClinVar
901826 2391 ClinVar
346441 2447 ClinVar
901825 2475 ClinVar
346440 2567 ClinVar
901279 2633 ClinVar
901278 2666 ClinVar
346439 2724 ClinVar
346438 2772 ClinVar
346437 2782 ClinVar
346436 2797 ClinVar
346435 2856 ClinVar
346434 2891 ClinVar
346433 2909 ClinVar
346432 2982 ClinVar
900114 3065 ClinVar
900113 3116 ClinVar
346431 3178 ClinVar
900112 3325 ClinVar
346430 3333 ClinVar
900111 3343 ClinVar
902664 3358 ClinVar
902663 3489 ClinVar
346429 3491 ClinVar
902662 3496 ClinVar
902661 3501 ClinVar
902660 3504 ClinVar
902659 3540 ClinVar
902658 3632 ClinVar
901758 3672 ClinVar
346428 3755 ClinVar
901757 3755 ClinVar
901756 3830 ClinVar
901755 3852 ClinVar
346427 3862 ClinVar
346426 3864 ClinVar
346425 4057 ClinVar
346424 4071 ClinVar
346423 4109 ClinVar
901209 4182 ClinVar
901208 4196 ClinVar
346422 4238 ClinVar
346421 4257 ClinVar
346420 4330 ClinVar
901207 4354 ClinVar
346419 4455 ClinVar
900053 4472 ClinVar
900052 4531 ClinVar
346418 4595 ClinVar
346417 4733 ClinVar
900051 4769 ClinVar
346416 4787 ClinVar
346415 4797 ClinVar
346414 4862 ClinVar
903645 4877 ClinVar
346413 4994 ClinVar
903644 5092 ClinVar
COSN31492845 2 COSMIC
COSN19666616 8 COSMIC
COSN30453528 9 COSMIC
COSN23620642 31 COSMIC
COSN31497424 33 COSMIC
COSN30725852 58 COSMIC
COSN20074871 69 COSMIC
COSN7704210 82 COSMIC
COSN20120882 88 COSMIC
COSN16797075 89 COSMIC
COSN1957021 95 COSMIC
COSN26990343 108 COSMIC
COSN31536226 119 COSMIC
COSN31541888 121 COSMIC
COSN24294870 154 COSMIC
COSN31508548 167 COSMIC
COSN30118195 179 COSMIC
COSN28667646 371 COSMIC
COSN16493361 427 COSMIC
COSN26569311 482 COSMIC
COSN26647345 491 COSMIC
COSN26583895 548 COSMIC
COSN32064215 555 COSMIC
COSN8489490 584 COSMIC
COSN28765534 695 COSMIC
COSN31523889 709 COSMIC
COSN30163304 716 COSMIC
COSN27724471 897 COSMIC
COSN16131812 1102 COSMIC
COSN6773128 1123 COSMIC
COSN9557294 1184 COSMIC
COSN31542984 1364 COSMIC
COSN31552516 1379 COSMIC
COSN19663906 1380 COSMIC
COSN31544309 1481 COSMIC
COSN31519103 1485 COSMIC
COSN9557293 1517 COSMIC
COSN30110352 1573 COSMIC
COSN31563638 1584 COSMIC
COSN9557292 1620 COSMIC
COSN31569348 1791 COSMIC
COSN19388812 1818 COSMIC
COSN31579420 1878 COSMIC
COSN31594882 1881 COSMIC
COSN31550497 1972 COSMIC
COSN8489489 2055 COSMIC
COSN17078534 2101 COSMIC
COSN26649242 2115 COSMIC
COSN31556596 2189 COSMIC
COSN31565000 2238 COSMIC
COSN22653515 2352 COSMIC
COSN23059065 2558 COSMIC
COSN17037995 2612 COSMIC
COSN29195867 2850 COSMIC
COSN30360721 2851 COSMIC
COSN31962084 3116 COSMIC
COSN18891404 3412 COSMIC
COSN31584993 4358 COSMIC
COSN16905443 4842 COSMIC
COSN27996432 5245 COSMIC
COSN25006764 5824 COSMIC
COSN27692574 6226 COSMIC
COSN16363289 6351 COSMIC
COSN16472934 6512 COSMIC
COSN29032266 6731 COSMIC
rs153734 6718 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774387547 3 dbSNP
rs1205346864 6 dbSNP
rs959303876 9 dbSNP
rs768605634 10 dbSNP
rs760784504 11 dbSNP
rs749081648 17 dbSNP
rs779882554 19 dbSNP
rs1463623675 21 dbSNP
rs771124563 28 dbSNP
rs1265967854 35 dbSNP
rs747166534 36 dbSNP
rs560997309 43 dbSNP
rs773295075 49 dbSNP
rs1185229927 51 dbSNP
rs1369826355 58 dbSNP
rs1231534203 61 dbSNP
rs575414554 65 dbSNP
rs999168519 79 dbSNP
rs982129446 82 dbSNP
rs542860269 83 dbSNP
rs1267226780 85 dbSNP
rs1220874133 88 dbSNP
rs971104952 89 dbSNP
rs575422848 91 dbSNP
rs903042581 93 dbSNP
rs1234087722 101 dbSNP
rs1287985241 104 dbSNP
rs1020916403 105 dbSNP
rs1230307202 106 dbSNP
rs1042849107 112 dbSNP
rs947152882 119 dbSNP
rs564042796 126 dbSNP
rs1009585028 128 dbSNP
rs370569305 133 dbSNP
rs578172110 136 dbSNP
rs1159329514 140 dbSNP
rs142263776 146 dbSNP
rs540188899 156 dbSNP
rs112499761 159 dbSNP
rs1466012695 161 dbSNP
rs1330264884 172 dbSNP
rs1055391082 173 dbSNP
rs781357037 180 dbSNP
rs573021227 183 dbSNP
rs1406686679 189 dbSNP
rs1307579905 199 dbSNP
rs1348936791 201 dbSNP
rs1411727792 205 dbSNP
rs554698560 209 dbSNP
rs1311506095 210 dbSNP
rs1230927866 215 dbSNP
rs1257714710 223 dbSNP
rs772305483 230 dbSNP
rs536486845 238 dbSNP
rs930200392 239 dbSNP
rs867544155 248 dbSNP
rs1182227288 251 dbSNP
rs1365736057 260 dbSNP
rs1266004676 268 dbSNP
rs1296969560 278 dbSNP
rs1174503287 287 dbSNP
rs920108818 288 dbSNP
rs188646986 292 dbSNP
rs1160687444 300 dbSNP
rs1368923637 310 dbSNP
rs1470744136 312 dbSNP
rs964131460 322 dbSNP
rs1036716334 327 dbSNP
rs1298995290 333 dbSNP
rs557088721 335 dbSNP
rs939721339 336 dbSNP
rs538570847 337 dbSNP
rs909659532 345 dbSNP
rs1385175278 346 dbSNP
rs1490964734 347 dbSNP
rs1371708554 351 dbSNP
rs35527090 354 dbSNP
rs1269709171 367 dbSNP
rs1018329886 371 dbSNP
rs1344080280 374 dbSNP
rs1215918829 379 dbSNP
rs1445524814 380 dbSNP
rs1204716521 389 dbSNP
rs987284117 391 dbSNP
rs1048205589 393 dbSNP
rs765317897 398 dbSNP
rs1205923686 402 dbSNP
rs955431998 422 dbSNP
rs1455123320 426 dbSNP
rs1031404086 433 dbSNP
rs1388667332 435 dbSNP
rs1451745292 443 dbSNP
rs998802950 458 dbSNP
rs1349525240 460 dbSNP
rs1295407762 463 dbSNP
rs1395083329 465 dbSNP
rs1281140119 467 dbSNP
rs148724634 469 dbSNP
rs1295343170 473 dbSNP
rs1367020471 478 dbSNP
rs926487350 483 dbSNP
rs982399826 492 dbSNP
rs1277045672 495 dbSNP
rs970638862 497 dbSNP
rs546677635 500 dbSNP
rs1021422099 509 dbSNP
rs1346424794 510 dbSNP
rs913877094 516 dbSNP
rs1011326979 520 dbSNP
rs1208599622 521 dbSNP
rs760001970 524 dbSNP
rs1246744463 532 dbSNP
rs1413549451 535 dbSNP
rs1187541334 545 dbSNP
rs988132480 546 dbSNP
rs958097786 548 dbSNP
rs1405814928 549 dbSNP
rs1174658230 552 dbSNP
rs894310407 553 dbSNP
rs980402390 555 dbSNP
rs1242979460 557 dbSNP
rs528463950 560 dbSNP
rs567461692 565 dbSNP
rs1474494618 566 dbSNP
rs1229638279 570 dbSNP
rs75087095 575 dbSNP
rs1243910082 578 dbSNP
rs549048750 579 dbSNP
rs1209348562 580 dbSNP
rs1216908748 580 dbSNP
rs1226048435 580 dbSNP
rs1258491119 580 dbSNP
rs1266780180 580 dbSNP
rs1327805258 580 dbSNP
rs1449295345 580 dbSNP
rs1457517 580 dbSNP
rs35195442 580 dbSNP
rs370988517 581 dbSNP
rs1410032260 582 dbSNP
rs886058796 582 dbSNP
rs886058797 582 dbSNP
rs1441996358 583 dbSNP
rs1261038665 584 dbSNP
rs886058795 585 dbSNP
rs1205277479 586 dbSNP
rs1313043727 586 dbSNP
rs1324230218 587 dbSNP
rs970279032 592 dbSNP
rs1407446454 599 dbSNP
rs1289737314 623 dbSNP
rs531037126 632 dbSNP
rs1212722360 637 dbSNP
rs1030502011 638 dbSNP
rs1270205280 643 dbSNP
rs141888990 645 dbSNP
rs1446852231 647 dbSNP
rs1047145497 654 dbSNP
rs1380053786 655 dbSNP
rs1258482828 657 dbSNP
rs998152629 662 dbSNP
rs1482875395 663 dbSNP
rs182926907 664 dbSNP
rs1471182049 673 dbSNP
rs920139878 683 dbSNP
rs1470570711 685 dbSNP
rs1190481584 689 dbSNP
rs779719872 690 dbSNP
rs1170434345 693 dbSNP
rs26937 695 dbSNP
rs1369518355 697 dbSNP
rs888192274 706 dbSNP
rs911383964 708 dbSNP
rs374593322 709 dbSNP
rs1435150713 714 dbSNP
rs1274764647 723 dbSNP
rs1048650603 724 dbSNP
rs937780963 726 dbSNP
rs144138668 734 dbSNP
rs146076160 736 dbSNP
rs1341924147 737 dbSNP
rs1203234694 744 dbSNP
rs1275385914 755 dbSNP
rs1438409768 758 dbSNP
rs745640974 772 dbSNP
rs923979080 773 dbSNP
rs955621859 773 dbSNP
rs145318480 775 dbSNP
rs978466494 776 dbSNP
rs1389280501 786 dbSNP
rs535354956 793 dbSNP
rs1169230864 806 dbSNP
rs1396843756 808 dbSNP
rs139624037 813 dbSNP
rs1321058445 814 dbSNP
rs1392890395 818 dbSNP
rs1011440945 826 dbSNP
rs546696198 838 dbSNP
rs781315357 848 dbSNP
rs1202360228 850 dbSNP
rs1364835157 855 dbSNP
rs1226663790 871 dbSNP
rs757234976 880 dbSNP
rs1272128576 881 dbSNP
rs1340397700 883 dbSNP
rs1227777524 885 dbSNP
rs1287868877 901 dbSNP
rs1309123900 905 dbSNP
rs1469905479 907 dbSNP
rs913845777 916 dbSNP
rs988099796 917 dbSNP
rs1034578691 927 dbSNP
rs936709040 933 dbSNP
rs554735350 939 dbSNP
rs986580597 940 dbSNP
rs1316771050 941 dbSNP
rs953505615 943 dbSNP
rs1419338746 947 dbSNP
rs993793171 948 dbSNP
rs1327093683 951 dbSNP
rs542767760 961 dbSNP
rs190325750 962 dbSNP
rs751133880 963 dbSNP
rs1327222731 964 dbSNP
rs942914376 970 dbSNP
rs1336969325 974 dbSNP
rs976275526 977 dbSNP
rs1234042168 987 dbSNP
rs1384083880 990 dbSNP
rs556884243 993 dbSNP
rs886058794 995 dbSNP
rs911415049 998 dbSNP
rs1206651096 1003 dbSNP
rs1262106413 1024 dbSNP
rs962269025 1028 dbSNP
rs777374375 1035 dbSNP
rs1259194905 1038 dbSNP
rs1003871015 1039 dbSNP
rs1440665733 1043 dbSNP
rs111362297 1044 dbSNP
rs934100862 1045 dbSNP
rs1411830123 1054 dbSNP
rs1452314318 1055 dbSNP
rs1026672505 1058 dbSNP
rs1160819026 1072 dbSNP
rs758126428 1078 dbSNP
rs1424144894 1084 dbSNP
rs571495140 1086 dbSNP
rs904971831 1088 dbSNP
rs35370941 1100 dbSNP
rs1046640971 1101 dbSNP
rs949261240 1102 dbSNP
rs1165776196 1113 dbSNP
rs752334583 1114 dbSNP
rs552838647 1115 dbSNP
rs915229964 1118 dbSNP
rs185820651 1121 dbSNP
rs958592035 1122 dbSNP
rs567299799 1125 dbSNP
rs1485815720 1126 dbSNP
rs936594557 1139 dbSNP
rs1180794350 1140 dbSNP
rs757510888 1148 dbSNP
rs764784009 1157 dbSNP
rs1481593880 1159 dbSNP
rs1233425788 1165 dbSNP
rs932045542 1175 dbSNP
rs1172210928 1177 dbSNP
rs923402133 1177 dbSNP
rs1377483102 1178 dbSNP
rs1435519207 1181 dbSNP
rs976244521 1181 dbSNP
rs1307693148 1183 dbSNP
rs1371190795 1197 dbSNP
rs181300184 1201 dbSNP
rs1307599898 1207 dbSNP
rs981647166 1220 dbSNP
rs760012240 1234 dbSNP
rs1015106850 1237 dbSNP
rs1231760893 1238 dbSNP
rs985019787 1246 dbSNP
rs971171444 1247 dbSNP
rs1025853369 1249 dbSNP
rs993907581 1250 dbSNP
rs1249279560 1260 dbSNP
rs1481323240 1264 dbSNP
rs754121612 1265 dbSNP
rs1195946570 1266 dbSNP
rs1251835148 1267 dbSNP
rs898190642 1268 dbSNP
rs952345194 1274 dbSNP
rs1016588422 1276 dbSNP
rs17069880 1277 dbSNP
rs1246265547 1283 dbSNP
rs570086815 1284 dbSNP
rs761123819 1285 dbSNP
rs904940223 1286 dbSNP
rs551734562 1289 dbSNP
rs1013296823 1291 dbSNP
rs934193331 1292 dbSNP
rs1298859118 1293 dbSNP
rs892260235 1295 dbSNP
rs1052237390 1296 dbSNP
rs1438558014 1300 dbSNP
rs1327875809 1306 dbSNP
rs1375948596 1307 dbSNP
rs17069879 1310 dbSNP
rs1404865262 1311 dbSNP
rs903796944 1317 dbSNP
rs1050837680 1321 dbSNP
rs1264302524 1324 dbSNP
rs559832659 1339 dbSNP
rs990751306 1362 dbSNP
rs937266549 1363 dbSNP
rs932038764 1370 dbSNP
rs866250824 1371 dbSNP
rs1040446443 1372 dbSNP
rs940776329 1376 dbSNP
rs541727178 1380 dbSNP
rs1417595677 1388 dbSNP
rs1171420014 1391 dbSNP
rs1430567606 1391 dbSNP
rs1157152970 1395 dbSNP
rs532936579 1395 dbSNP
rs1459942637 1401 dbSNP
rs1327828456 1402 dbSNP
rs984988426 1411 dbSNP
rs952379770 1419 dbSNP
rs927608135 1425 dbSNP
rs1434051534 1428 dbSNP
rs1286954284 1431 dbSNP
rs981377924 1431 dbSNP
rs1311577626 1443 dbSNP
rs191085759 1450 dbSNP
rs1234655935 1456 dbSNP
rs1198686056 1464 dbSNP
rs969047471 1469 dbSNP
rs1215488630 1474 dbSNP
rs1024599854 1475 dbSNP
rs886058793 1476 dbSNP
rs560881276 1477 dbSNP
rs1487071054 1478 dbSNP
rs186164025 1482 dbSNP
rs1257091934 1483 dbSNP
rs1474266775 1484 dbSNP
rs879297640 1495 dbSNP
rs779772450 1496 dbSNP
rs1418459880 1506 dbSNP
rs1456598110 1518 dbSNP
rs1156878730 1521 dbSNP
rs1025460502 1544 dbSNP
rs1454133828 1546 dbSNP
rs1301884114 1558 dbSNP
rs886058792 1560 dbSNP
rs1416054788 1561 dbSNP
rs575247357 1563 dbSNP
rs558482444 1568 dbSNP
rs1485358232 1573 dbSNP
rs956468565 1586 dbSNP
rs1217042878 1587 dbSNP
rs62249882 1589 dbSNP
rs1000727933 1591 dbSNP
rs1217472337 1596 dbSNP
rs180735628 1601 dbSNP
rs1030362644 1602 dbSNP
rs26938 1605 dbSNP
rs1050397783 1609 dbSNP
rs1410147719 1610 dbSNP
rs1401069090 1623 dbSNP
rs1344117106 1627 dbSNP
rs1285305177 1628 dbSNP
rs996502302 1632 dbSNP
rs1405669224 1633 dbSNP
rs1313141699 1639 dbSNP
rs901801750 1644 dbSNP
rs1040413782 1645 dbSNP
rs893856632 1659 dbSNP
rs554682425 1661 dbSNP
rs1287396714 1662 dbSNP
rs1455534738 1664 dbSNP
rs745721119 1670 dbSNP
rs1303075163 1671 dbSNP
rs534623651 1679 dbSNP
rs1213207404 1680 dbSNP
rs1175375723 1681 dbSNP
rs938048041 1682 dbSNP
rs776515359 1683 dbSNP
rs1470500186 1699 dbSNP
rs930861685 1700 dbSNP
rs1431298323 1701 dbSNP
rs573559318 1710 dbSNP
rs536372813 1711 dbSNP
rs949977111 1714 dbSNP
rs1418419031 1716 dbSNP
rs1200026967 1721 dbSNP
rs1330367810 1728 dbSNP
rs1354639086 1729 dbSNP
rs555345946 1735 dbSNP
rs918439255 1739 dbSNP
rs1369163410 1743 dbSNP
rs26939 1763 dbSNP
rs1304435328 1767 dbSNP
rs1339023509 1773 dbSNP
rs980341831 1774 dbSNP
rs1275145033 1778 dbSNP
rs1438495759 1779 dbSNP
rs1212913284 1784 dbSNP
rs972074761 1796 dbSNP
rs1187970210 1802 dbSNP
rs1251072497 1805 dbSNP
rs190669017 1821 dbSNP
rs551840081 1822 dbSNP
rs1474195987 1824 dbSNP
rs1203387283 1825 dbSNP
rs1169322148 1830 dbSNP
rs956438168 1831 dbSNP
rs985200458 1838 dbSNP
rs953874075 1845 dbSNP
rs1164817083 1849 dbSNP
rs550803054 1858 dbSNP
rs1443524728 1861 dbSNP
rs886058791 1868 dbSNP
rs1326232375 1879 dbSNP
rs1428842416 1888 dbSNP
rs539675716 1889 dbSNP
rs34585452 1899 dbSNP
rs566301279 1902 dbSNP
rs998862788 1905 dbSNP
rs1232809386 1906 dbSNP
rs547977549 1906 dbSNP
rs1271186681 1911 dbSNP
rs746875520 1913 dbSNP
rs1384150747 1919 dbSNP
rs1246698422 1920 dbSNP
rs146359505 1920 dbSNP
rs1336923419 1925 dbSNP
rs1214271815 1926 dbSNP
rs34390031 1926 dbSNP
rs967870478 1931 dbSNP
rs1408814515 1943 dbSNP
rs1029243598 1950 dbSNP
rs996081430 1954 dbSNP
rs1445075268 1958 dbSNP
rs1362864697 1962 dbSNP
rs886058790 1964 dbSNP
rs901792900 1965 dbSNP
rs886058789 1970 dbSNP
rs184734766 1972 dbSNP
rs562319367 1973 dbSNP
rs377752523 1982 dbSNP
rs1055170156 1987 dbSNP
rs1384616742 1991 dbSNP
rs570616523 1991 dbSNP
rs1320515137 1992 dbSNP
rs1049111863 1998 dbSNP
rs1341432526 2000 dbSNP
rs1461418502 2005 dbSNP
rs1370854592 2021 dbSNP
rs906548908 2039 dbSNP
rs950017661 2050 dbSNP
rs930725406 2051 dbSNP
rs1428776095 2052 dbSNP
rs563272373 2054 dbSNP
rs918470887 2063 dbSNP
rs954427132 2071 dbSNP
rs1208305835 2074 dbSNP
rs545066618 2087 dbSNP
rs577636282 2089 dbSNP
rs1475250936 2090 dbSNP
rs1188780783 2093 dbSNP
rs181914174 2097 dbSNP
rs906008365 2106 dbSNP
rs1160690534 2115 dbSNP
rs532387838 2120 dbSNP
rs1311300343 2121 dbSNP
rs1377298495 2122 dbSNP
rs1339239614 2126 dbSNP
rs189235197 2134 dbSNP
rs985639546 2141 dbSNP
rs757984307 2143 dbSNP
rs1044971294 2150 dbSNP
rs1333951541 2157 dbSNP
rs1164570572 2165 dbSNP
rs747606788 2177 dbSNP
rs953798966 2187 dbSNP
rs1208197717 2188 dbSNP
rs917522022 2192 dbSNP
rs767058181 2193 dbSNP
rs1485702915 2196 dbSNP
rs1194797200 2199 dbSNP
rs886058788 2207 dbSNP
rs991782238 2216 dbSNP
rs573646889 2225 dbSNP
rs1436625791 2234 dbSNP
rs1184642355 2244 dbSNP
rs184474107 2250 dbSNP
rs1454120433 2258 dbSNP
rs550841859 2269 dbSNP
rs967366915 2276 dbSNP
rs576367337 2283 dbSNP
rs866060288 2288 dbSNP
rs192971326 2290 dbSNP
rs202075192 2294 dbSNP
rs1334491588 2297 dbSNP
rs373515094 2297 dbSNP
rs386661734 2297 dbSNP
rs539940016 2315 dbSNP
rs1231879518 2322 dbSNP
rs1305163934 2326 dbSNP
rs1002716171 2334 dbSNP
rs1028814784 2348 dbSNP
rs1249073957 2350 dbSNP
rs906585981 2351 dbSNP
rs1201014900 2356 dbSNP
rs754565116 2357 dbSNP
rs975007864 2361 dbSNP
rs189461310 2362 dbSNP
rs548011982 2366 dbSNP
rs1161355348 2370 dbSNP
rs1433939514 2377 dbSNP
rs1170045561 2378 dbSNP
rs1371338412 2381 dbSNP
rs184544359 2391 dbSNP
rs1171283717 2403 dbSNP
rs1387485050 2422 dbSNP
rs1393724920 2431 dbSNP
rs1188622976 2432 dbSNP
rs766691190 2438 dbSNP
rs1327723297 2439 dbSNP
rs897823066 2440 dbSNP
rs142737250 2443 dbSNP
rs1293017491 2444 dbSNP
rs56262708 2447 dbSNP
rs1218785777 2453 dbSNP
rs530450714 2462 dbSNP
rs909736293 2466 dbSNP
rs1334819556 2467 dbSNP
rs1483458325 2473 dbSNP
rs905971725 2475 dbSNP
rs1489012895 2479 dbSNP
rs1186089218 2484 dbSNP
rs1259984019 2489 dbSNP
rs1478838911 2491 dbSNP
rs932400193 2497 dbSNP
rs563316643 2498 dbSNP
rs1417045288 2501 dbSNP
rs922336278 2504 dbSNP
rs1244064607 2508 dbSNP
rs1044550629 2515 dbSNP
rs1350196774 2538 dbSNP
rs950257817 2558 dbSNP
rs62249881 2567 dbSNP
rs1400058328 2569 dbSNP
rs1053264930 2572 dbSNP
rs989713584 2574 dbSNP
rs1231924287 2581 dbSNP
rs1333742407 2584 dbSNP
rs934914001 2586 dbSNP
rs192177853 2588 dbSNP
rs979538735 2589 dbSNP
rs1259149107 2597 dbSNP
rs1489419909 2606 dbSNP
rs1217647245 2612 dbSNP
rs1256844668 2620 dbSNP
rs1364410032 2620 dbSNP
rs140420417 2633 dbSNP
rs921717706 2636 dbSNP
rs1183516271 2645 dbSNP
rs1414535009 2648 dbSNP
rs1418260909 2668 dbSNP
rs1156729838 2674 dbSNP
rs1426188151 2680 dbSNP
rs1365771427 2692 dbSNP
rs1346769555 2700 dbSNP
rs1419887564 2723 dbSNP
rs12494731 2724 dbSNP
rs971304155 2728 dbSNP
rs1469991918 2729 dbSNP
rs1416151018 2730 dbSNP
rs865776356 2733 dbSNP
rs965835561 2737 dbSNP
rs1018793317 2739 dbSNP
rs1025093839 2740 dbSNP
rs993977105 2749 dbSNP
rs897853423 2751 dbSNP
rs1356329200 2758 dbSNP
rs529038443 2766 dbSNP
rs1016250948 2770 dbSNP
rs27383 2772 dbSNP
rs1212387356 2774 dbSNP
rs888330115 2779 dbSNP
rs1220294976 2780 dbSNP
rs530804190 2782 dbSNP
rs1490851355 2792 dbSNP
rs1172608614 2794 dbSNP
rs35969433 2797 dbSNP
rs1415649287 2801 dbSNP
rs970164817 2803 dbSNP
rs900993717 2817 dbSNP
rs1334298733 2818 dbSNP
rs1204754569 2836 dbSNP
rs764395695 2838 dbSNP
rs1353436854 2844 dbSNP
rs1014298693 2846 dbSNP
rs895946784 2850 dbSNP
rs187779353 2851 dbSNP
rs1281004934 2853 dbSNP
rs886058787 2856 dbSNP
rs1302914873 2858 dbSNP
rs1228941106 2859 dbSNP
rs558145074 2863 dbSNP
rs999031774 2866 dbSNP
rs1279379196 2869 dbSNP
rs1202287785 2874 dbSNP
rs150545518 2878 dbSNP
rs1458041327 2880 dbSNP
rs1280846960 2881 dbSNP
rs1250729718 2883 dbSNP
rs1406288244 2886 dbSNP
rs34723451 2891 dbSNP
rs926936094 2893 dbSNP
rs776570106 2896 dbSNP
rs1317273473 2901 dbSNP
rs946410990 2907 dbSNP
rs545276442 2909 dbSNP
rs1325597530 2910 dbSNP
rs970950960 2913 dbSNP
rs1438798385 2915 dbSNP
rs921624397 2916 dbSNP
rs1361342703 2918 dbSNP
rs1025545994 2921 dbSNP
rs554295488 2933 dbSNP
rs536088361 2937 dbSNP
rs770790536 2938 dbSNP
rs746785648 2941 dbSNP
rs1016281918 2944 dbSNP
rs1197861587 2945 dbSNP
rs1241229761 2945 dbSNP
rs1474124153 2951 dbSNP
rs1481491215 2965 dbSNP
rs911699956 2968 dbSNP
rs1423748182 2975 dbSNP
rs1466567041 2979 dbSNP
rs759645403 2982 dbSNP
rs1445435917 2994 dbSNP
rs568648233 2995 dbSNP
rs1028274776 2996 dbSNP
rs556453174 3001 dbSNP
rs1209079599 3007 dbSNP
rs538545674 3011 dbSNP
rs1344868362 3017 dbSNP
rs1322526724 3023 dbSNP
rs1341243083 3034 dbSNP
rs983312008 3037 dbSNP
rs1232533034 3046 dbSNP
rs997152533 3050 dbSNP
rs141619472 3051 dbSNP
rs1210255818 3053 dbSNP
rs551403380 3056 dbSNP
rs1345198796 3065 dbSNP
rs973420526 3068 dbSNP
rs532758214 3069 dbSNP
rs945140373 3075 dbSNP
rs970427404 3076 dbSNP
rs892178318 3084 dbSNP
rs1053466703 3087 dbSNP
rs565471683 3093 dbSNP
rs1474603855 3095 dbSNP
rs1187848093 3096 dbSNP
rs1367301556 3098 dbSNP
rs936377101 3099 dbSNP
rs926270618 3106 dbSNP
rs1045343958 3116 dbSNP
rs868450504 3117 dbSNP
rs918106700 3118 dbSNP
rs1014267770 3121 dbSNP
rs1414306647 3128 dbSNP
rs1436339681 3130 dbSNP
rs547069269 3133 dbSNP
rs183451972 3137 dbSNP
rs1245459974 3141 dbSNP
rs909334019 3155 dbSNP
rs1241799205 3162 dbSNP
rs1416589578 3174 dbSNP
rs528929996 3178 dbSNP
rs984865863 3190 dbSNP
rs1208152674 3197 dbSNP
rs1254657399 3200 dbSNP
rs1444582899 3205 dbSNP
rs1188885576 3207 dbSNP
rs953433776 3214 dbSNP
rs1167355524 3216 dbSNP
rs1438237090 3229 dbSNP
rs1160664937 3230 dbSNP
rs114017509 3231 dbSNP
rs1434163136 3235 dbSNP
rs996791539 3241 dbSNP
rs147994242 3247 dbSNP
rs965644039 3267 dbSNP
rs1396471107 3275 dbSNP
rs904768785 3285 dbSNP
rs1374368880 3288 dbSNP
rs1448808142 3291 dbSNP
rs1309485158 3292 dbSNP
rs754278594 3304 dbSNP
rs1230632190 3305 dbSNP
rs1257199911 3313 dbSNP
rs1009396821 3318 dbSNP
rs531639386 3325 dbSNP
rs997111473 3329 dbSNP
rs1241035820 3331 dbSNP
rs72874609 3333 dbSNP
rs1038734061 3334 dbSNP
rs944427081 3340 dbSNP
rs911667034 3343 dbSNP
rs1047591651 3344 dbSNP
rs1239197464 3347 dbSNP
rs1000554087 3350 dbSNP
rs1212259285 3374 dbSNP
rs1167258951 3386 dbSNP
rs1398077797 3388 dbSNP
rs1340828781 3392 dbSNP
rs929165261 3395 dbSNP
rs920446966 3396 dbSNP
rs1297947880 3403 dbSNP
rs1244778890 3407 dbSNP
rs1382501041 3412 dbSNP
rs868591816 3418 dbSNP
rs866835694 3419 dbSNP
rs973686426 3422 dbSNP
rs1335073094 3424 dbSNP
rs143371706 3425 dbSNP
rs1384644799 3439 dbSNP
rs572453686 3450 dbSNP
rs554334484 3469 dbSNP
rs970015934 3476 dbSNP
rs1360208326 3484 dbSNP
rs1226141585 3487 dbSNP
rs143062140 3489 dbSNP
rs153730 3491 dbSNP
rs556725661 3494 dbSNP
rs1358772449 3501 dbSNP
rs538054092 3504 dbSNP
rs571165116 3505 dbSNP
rs1383175159 3513 dbSNP
rs1031752100 3526 dbSNP
rs1192619510 3532 dbSNP
rs918125565 3534 dbSNP
rs1483556732 3536 dbSNP
rs1171300630 3538 dbSNP
rs977486642 3540 dbSNP
rs558971573 3547 dbSNP
rs539074497 3553 dbSNP
rs145812435 3566 dbSNP
rs1021813066 3568 dbSNP
rs1391050802 3569 dbSNP
rs1381324598 3571 dbSNP
rs1275716289 3575 dbSNP
rs1274641133 3576 dbSNP
rs984896934 3577 dbSNP
rs997478921 3579 dbSNP
rs559787480 3581 dbSNP
rs1219881539 3590 dbSNP
rs754692773 3592 dbSNP
rs921967356 3593 dbSNP
rs1017263896 3598 dbSNP
rs976453640 3599 dbSNP
rs546957957 3601 dbSNP
rs966071467 3609 dbSNP
rs1194279863 3611 dbSNP
rs1008606214 3616 dbSNP
rs1417162390 3618 dbSNP
rs1421799459 3623 dbSNP
rs1019526525 3625 dbSNP
rs1368867277 3631 dbSNP
rs140681630 3632 dbSNP
rs1230426060 3638 dbSNP
rs1361885551 3641 dbSNP
rs568019009 3646 dbSNP
rs956564814 3647 dbSNP
rs541737290 3653 dbSNP
rs1379145897 3663 dbSNP
rs1227125701 3665 dbSNP
rs1279546838 3669 dbSNP
rs1000634797 3670 dbSNP
rs904907709 3672 dbSNP
rs1308655958 3682 dbSNP
rs1284213393 3685 dbSNP
rs1424292299 3689 dbSNP
rs1044740155 3699 dbSNP
rs1047479537 3700 dbSNP
rs929071338 3702 dbSNP
rs1183532870 3706 dbSNP
rs192421869 3710 dbSNP
rs1037552399 3716 dbSNP
rs1036644727 3723 dbSNP
rs948629056 3729 dbSNP
rs114625121 3732 dbSNP
rs78627234 3733 dbSNP
rs1356959872 3737 dbSNP
rs187463069 3743 dbSNP
rs992782436 3749 dbSNP
rs938653362 3752 dbSNP
rs3177674 3753 dbSNP
rs756531877 3755 dbSNP
rs977884865 3756 dbSNP
rs921969663 3757 dbSNP
rs1307310321 3761 dbSNP
rs976186531 3763 dbSNP
rs944735533 3765 dbSNP
rs750786350 3766 dbSNP
rs968844799 3771 dbSNP
rs1022199041 3775 dbSNP
rs527554457 3776 dbSNP
rs1176601956 3781 dbSNP
rs956594198 3781 dbSNP
rs1461615467 3790 dbSNP
rs964285558 3794 dbSNP
rs1489620291 3797 dbSNP
rs145749817 3802 dbSNP
rs1008491936 3807 dbSNP
rs890086636 3808 dbSNP
rs979636936 3811 dbSNP
rs1407519489 3813 dbSNP
rs774862875 3814 dbSNP
rs183313301 3815 dbSNP
rs1379580212 3821 dbSNP
rs1447720858 3824 dbSNP
rs574878914 3830 dbSNP
rs896176409 3832 dbSNP
rs1221058151 3834 dbSNP
rs1279219145 3835 dbSNP
rs1014574909 3848 dbSNP
rs898942020 3851 dbSNP
rs153731 3852 dbSNP
rs1259670633 3854 dbSNP
rs948616680 3855 dbSNP
rs886058786 3862 dbSNP
rs544825776 3864 dbSNP
rs1056941761 3869 dbSNP
rs1244686658 3876 dbSNP
rs938620874 3877 dbSNP
rs932177592 3878 dbSNP
rs1458541652 3880 dbSNP
rs924586408 3881 dbSNP
rs1422318880 3891 dbSNP
rs1477757278 3892 dbSNP
rs763248175 3893 dbSNP
rs1402895028 3897 dbSNP
rs977477928 3901 dbSNP
rs947442248 3917 dbSNP
rs1323110117 3924 dbSNP
rs1348409225 3926 dbSNP
rs11549479 3936 dbSNP
rs1438910374 3937 dbSNP
rs1275476548 3947 dbSNP
rs1339939397 3964 dbSNP
rs1458780077 3965 dbSNP
rs1280080286 3968 dbSNP
rs1318327455 3972 dbSNP
rs1227570891 3977 dbSNP
rs900658387 3982 dbSNP
rs1452925247 3986 dbSNP
rs914702457 3986 dbSNP
rs1198571981 3992 dbSNP
rs1221888315 3998 dbSNP
rs1261764405 4018 dbSNP
rs1487055679 4023 dbSNP
rs191473926 4024 dbSNP
rs1479204474 4029 dbSNP
rs1192125194 4036 dbSNP
rs1426460321 4041 dbSNP
rs1040885058 4049 dbSNP
rs944788017 4052 dbSNP
rs1412123988 4054 dbSNP
rs753024407 4056 dbSNP
rs140931283 4057 dbSNP
rs760585358 4059 dbSNP
rs988738879 4061 dbSNP
rs886058785 4071 dbSNP
rs1244001245 4076 dbSNP
rs1282172644 4077 dbSNP
rs987025139 4078 dbSNP
rs1358207338 4083 dbSNP
rs773119653 4094 dbSNP
rs1284950445 4096 dbSNP
rs935252637 4099 dbSNP
rs1331633551 4108 dbSNP
rs886058784 4109 dbSNP
rs1223431199 4113 dbSNP
rs534239453 4121 dbSNP
rs963452224 4122 dbSNP
rs1387586380 4123 dbSNP
rs969655574 4129 dbSNP
rs1236025778 4137 dbSNP
rs1361479342 4138 dbSNP
rs1015981965 4141 dbSNP
rs573163477 4149 dbSNP
rs1474009444 4154 dbSNP
rs1164444517 4155 dbSNP
rs145272711 4162 dbSNP
rs553356402 4171 dbSNP
rs992336560 4174 dbSNP
rs1437069749 4180 dbSNP
rs1385802915 4185 dbSNP
rs1389084658 4196 dbSNP
rs960414126 4199 dbSNP
rs1014604270 4203 dbSNP
rs772069384 4206 dbSNP
rs761617538 4210 dbSNP
rs1241914456 4226 dbSNP
rs14056 4238 dbSNP
rs996426346 4239 dbSNP
rs1444454724 4244 dbSNP
rs1056907612 4252 dbSNP
rs1237976797 4253 dbSNP
rs886058783 4257 dbSNP
rs903132337 4259 dbSNP
rs568186052 4263 dbSNP
rs549592275 4267 dbSNP
rs1170709345 4270 dbSNP
rs1404329432 4273 dbSNP
rs1417004962 4278 dbSNP
rs1470276922 4278 dbSNP
rs1040520952 4279 dbSNP
rs914563911 4292 dbSNP
rs1008944345 4297 dbSNP
rs769427114 4298 dbSNP
rs1307332628 4300 dbSNP
rs891842495 4303 dbSNP
rs1190089817 4307 dbSNP
rs1466578683 4315 dbSNP
rs1039751302 4321 dbSNP
rs538069337 4330 dbSNP
rs1326211378 4343 dbSNP
rs1204895724 4351 dbSNP
rs186186236 4354 dbSNP
rs767995471 4358 dbSNP
rs1482533042 4365 dbSNP
rs748785738 4372 dbSNP
rs951588897 4387 dbSNP
rs918883603 4394 dbSNP
rs1251565705 4398 dbSNP
rs1432648832 4399 dbSNP
rs1257865733 4401 dbSNP
rs57075212 4407 dbSNP
rs1196788846 4409 dbSNP
rs925962494 4419 dbSNP
rs974739107 4420 dbSNP
rs1234103728 4421 dbSNP
rs769408749 4426 dbSNP
rs1016363560 4430 dbSNP
rs1467047365 4437 dbSNP
rs1012594054 4438 dbSNP
rs1389622154 4444 dbSNP
rs916412866 4445 dbSNP
rs746249344 4455 dbSNP
rs960445349 4466 dbSNP
rs1230881559 4469 dbSNP
rs575410668 4472 dbSNP
rs1335773937 4474 dbSNP
rs757784141 4480 dbSNP
rs1450387441 4497 dbSNP
rs552366396 4506 dbSNP
rs1230138723 4514 dbSNP
rs1002701246 4515 dbSNP
rs1404217716 4531 dbSNP
rs561998562 4532 dbSNP
rs1271074031 4535 dbSNP
rs1041600321 4538 dbSNP
rs983188038 4546 dbSNP
rs1011909893 4551 dbSNP
rs1027301127 4560 dbSNP
rs893113227 4563 dbSNP
rs1478666207 4568 dbSNP
rs1170819450 4569 dbSNP
rs527591694 4584 dbSNP
rs1040121207 4586 dbSNP
rs942747346 4591 dbSNP
rs115643713 4593 dbSNP
rs1365644166 4595 dbSNP
rs886058782 4595 dbSNP
rs1339028822 4606 dbSNP
rs778328714 4622 dbSNP
rs879054221 4627 dbSNP
rs548644279 4628 dbSNP
rs1296655890 4629 dbSNP
rs1321514305 4630 dbSNP
rs1391190685 4634 dbSNP
rs930096363 4644 dbSNP
rs1019533985 4648 dbSNP
rs1216042676 4653 dbSNP
rs918755164 4658 dbSNP
rs78263476 4665 dbSNP
rs891957258 4671 dbSNP
rs1053159091 4674 dbSNP
rs1421895122 4689 dbSNP
rs1385531720 4695 dbSNP
rs1000218064 4706 dbSNP
rs904540635 4714 dbSNP
rs139791258 4715 dbSNP
rs1361905746 4721 dbSNP
rs544401873 4731 dbSNP
rs153732 4733 dbSNP
rs1383734484 4734 dbSNP
rs991139318 4737 dbSNP
rs1318826193 4738 dbSNP
rs1216392646 4741 dbSNP
rs958447354 4746 dbSNP
rs1035438833 4752 dbSNP
rs1185149929 4759 dbSNP
rs981163962 4769 dbSNP
rs1438624285 4771 dbSNP
rs1271457295 4773 dbSNP
rs1176412280 4778 dbSNP
rs939199159 4779 dbSNP
rs1419226371 4780 dbSNP
rs1160434591 4784 dbSNP
rs1359140617 4785 dbSNP
rs886058781 4787 dbSNP
rs565148792 4789 dbSNP
rs153733 4797 dbSNP
rs1339056555 4801 dbSNP
rs1313427431 4805 dbSNP
rs1390678118 4806 dbSNP
rs1020555465 4807 dbSNP
rs1011462885 4809 dbSNP
rs1407307790 4820 dbSNP
rs893069786 4822 dbSNP
rs1309263081 4829 dbSNP
rs759784420 4831 dbSNP
rs1375616523 4842 dbSNP
rs1224445277 4847 dbSNP
rs983219692 4853 dbSNP
rs1310326613 4862 dbSNP
rs571451772 4862 dbSNP
rs1263464490 4870 dbSNP
rs1457196300 4871 dbSNP
rs1196359055 4873 dbSNP
rs750274826 4877 dbSNP
rs1470182950 4878 dbSNP
rs1190076708 4882 dbSNP
rs951802450 4883 dbSNP
rs920265858 4886 dbSNP
rs777744196 4896 dbSNP
rs974396991 4897 dbSNP
rs1430410551 4899 dbSNP
rs964729718 4902 dbSNP
rs374957460 4905 dbSNP
rs1370558247 4907 dbSNP
rs182857924 4909 dbSNP
rs930065280 4918 dbSNP
rs554830210 4926 dbSNP
rs761825367 4927 dbSNP
rs1038973949 4928 dbSNP
rs1223129026 4938 dbSNP
rs1365596880 4943 dbSNP
rs1225252247 4944 dbSNP
rs34753442 4948 dbSNP
rs941602908 4952 dbSNP
rs1283919766 4961 dbSNP
rs535466097 4968 dbSNP
rs758325989 4977 dbSNP
rs916857367 4978 dbSNP
rs1274889081 4988 dbSNP
rs956230212 4991 dbSNP
rs190966782 4994 dbSNP
rs1490714501 4996 dbSNP
rs1202223384 5000 dbSNP
rs1270285169 5002 dbSNP
rs1477687279 5007 dbSNP
rs1166476097 5010 dbSNP
rs1184389489 5010 dbSNP
rs1410687903 5016 dbSNP
rs556093776 5017 dbSNP
rs904572971 5031 dbSNP
rs1023389390 5039 dbSNP
rs936975336 5042 dbSNP
rs1303661138 5047 dbSNP
rs1012958449 5049 dbSNP
rs1398109767 5050 dbSNP
rs1208278122 5059 dbSNP
rs1339849191 5081 dbSNP
rs1227373346 5088 dbSNP
rs895796019 5089 dbSNP
rs1222649296 5091 dbSNP
rs1056419773 5092 dbSNP
rs569811683 5093 dbSNP
rs1191679485 5097 dbSNP
rs1244178663 5103 dbSNP
rs928305325 5104 dbSNP
rs1383665054 5106 dbSNP
rs1047562188 5107 dbSNP
rs1164254525 5109 dbSNP
rs1290100468 5119 dbSNP
rs1359990708 5133 dbSNP
rs537559229 5139 dbSNP
rs920399148 5144 dbSNP
rs1326803581 5153 dbSNP
rs570486994 5164 dbSNP
rs552403017 5165 dbSNP
rs1312436143 5168 dbSNP
rs1384480816 5170 dbSNP
rs1020101141 5181 dbSNP
rs990410722 5182 dbSNP
rs974893127 5186 dbSNP
rs1350938285 5189 dbSNP
rs1203891328 5190 dbSNP
rs1287000755 5191 dbSNP
rs943080034 5216 dbSNP
rs1209790575 5222 dbSNP
rs1241712957 5230 dbSNP
rs957305858 5239 dbSNP
rs1184458634 5244 dbSNP
rs1379755191 5255 dbSNP
rs1468730736 5276 dbSNP
rs185274579 5276 dbSNP
rs987700113 5276 dbSNP
rs1406675430 5277 dbSNP
rs1393347798 5280 dbSNP
rs1018236745 5286 dbSNP
rs1164150156 5287 dbSNP
rs752861999 5300 dbSNP
rs1408045427 5306 dbSNP
rs891109374 5324 dbSNP
rs867350457 5327 dbSNP
rs1333442227 5328 dbSNP
rs1029684148 5329 dbSNP
rs534941274 5330 dbSNP
rs1351972142 5335 dbSNP
rs978860217 5339 dbSNP
rs1261598603 5352 dbSNP
rs1462982573 5353 dbSNP
rs567291552 5354 dbSNP
rs147815740 5355 dbSNP
rs1436133733 5359 dbSNP
rs1276071229 5360 dbSNP
rs1184020724 5365 dbSNP
rs897255290 5375 dbSNP
rs1477623162 5376 dbSNP
rs1174259066 5382 dbSNP
rs1023083541 5383 dbSNP
rs1470159656 5386 dbSNP
rs1330237782 5387 dbSNP
rs1393807081 5388 dbSNP
rs1392799486 5390 dbSNP
rs1268270991 5392 dbSNP
rs1013404549 5401 dbSNP
rs548977050 5409 dbSNP
rs1267827344 5421 dbSNP
rs1038533822 5422 dbSNP
rs1251128911 5435 dbSNP
rs1337651521 5439 dbSNP
rs1035664198 5443 dbSNP
rs1003470021 5450 dbSNP
rs548483075 5454 dbSNP
rs1393125853 5461 dbSNP
rs1271018670 5465 dbSNP
rs778304205 5469 dbSNP
rs1169643402 5485 dbSNP
rs529974202 5497 dbSNP
rs144395750 5519 dbSNP
rs898982453 5523 dbSNP
rs1038807366 5526 dbSNP
rs1389386271 5529 dbSNP
rs569175121 5533 dbSNP
rs762493943 5534 dbSNP
rs1402606036 5537 dbSNP
rs1301814252 5551 dbSNP
rs1347888895 5552 dbSNP
rs1406126092 5558 dbSNP
rs1295220752 5560 dbSNP
rs1325109898 5561 dbSNP
rs1228926177 5563 dbSNP
rs943087148 5564 dbSNP
rs550913855 5566 dbSNP
rs1358789204 5567 dbSNP
rs1220281395 5573 dbSNP
rs536088210 5576 dbSNP
rs1294078520 5579 dbSNP
rs1490472672 5583 dbSNP
rs1185868880 5589 dbSNP
rs1259387588 5592 dbSNP
rs895327538 5600 dbSNP
rs1323406865 5605 dbSNP
rs1430160560 5608 dbSNP
rs1055263788 5611 dbSNP
rs1193418938 5615 dbSNP
rs1367584923 5617 dbSNP
rs774962394 5624 dbSNP
rs532505500 5626 dbSNP
rs1365665689 5633 dbSNP
rs182032367 5633 dbSNP
rs1045401289 5634 dbSNP
rs1425829637 5641 dbSNP
rs375093798 5645 dbSNP
rs1331286832 5647 dbSNP
rs1384322709 5651 dbSNP
rs1296765481 5652 dbSNP
rs1382255222 5657 dbSNP
rs1317160109 5658 dbSNP
rs540468727 5661 dbSNP
rs1317173059 5666 dbSNP
rs1434895621 5667 dbSNP
rs1360335711 5671 dbSNP
rs754038025 5674 dbSNP
rs1486714184 5677 dbSNP
rs1205454426 5683 dbSNP
rs1242336087 5684 dbSNP
rs766643765 5684 dbSNP
rs913010591 5685 dbSNP
rs189381004 5686 dbSNP
rs1385308036 5695 dbSNP
rs989989525 5710 dbSNP
rs957397424 5718 dbSNP
rs1455832396 5720 dbSNP
rs543011162 5725 dbSNP
rs991602845 5736 dbSNP
rs985347712 5750 dbSNP
rs955306120 5756 dbSNP
rs1004258479 5767 dbSNP
rs951354933 5775 dbSNP
rs1223342871 5782 dbSNP
rs561272711 5787 dbSNP
rs1029653078 5798 dbSNP
rs1239686931 5802 dbSNP
rs899015418 5806 dbSNP
rs1459864425 5808 dbSNP
rs994615871 5809 dbSNP
rs2163716 5814 dbSNP
rs868112601 5817 dbSNP
rs186184031 5820 dbSNP
rs1209292609 5833 dbSNP
rs1460778980 5837 dbSNP
rs530867517 5844 dbSNP
rs745453947 5856 dbSNP
rs1174928143 5858 dbSNP
rs1007315238 5861 dbSNP
rs1275935424 5864 dbSNP
rs890161674 5866 dbSNP
rs1458491023 5872 dbSNP
rs1346146837 5874 dbSNP
rs1220495003 5877 dbSNP
rs961476937 5878 dbSNP
rs1160622979 5881 dbSNP
rs1017400794 5882 dbSNP
rs1338925731 5896 dbSNP
rs1005638881 5897 dbSNP
rs934361645 5901 dbSNP
rs895293475 5912 dbSNP
rs1296458001 5916 dbSNP
rs1375638783 5919 dbSNP
rs1391885395 5926 dbSNP
rs1282603574 5927 dbSNP
rs1321120818 5935 dbSNP
rs1055232770 5936 dbSNP
rs1263563282 5942 dbSNP
rs781629002 5949 dbSNP
rs1202014577 5963 dbSNP
rs575859619 5969 dbSNP
rs1234099424 5973 dbSNP
rs1480709799 5985 dbSNP
rs1043336940 5991 dbSNP
rs1268865054 5995 dbSNP
rs1003737515 5999 dbSNP
rs1178987340 6008 dbSNP
rs947598998 6011 dbSNP
rs1409547581 6023 dbSNP
rs906816975 6034 dbSNP
rs1168677008 6037 dbSNP
rs1269293081 6041 dbSNP
rs1225728103 6045 dbSNP
rs916089870 6048 dbSNP
rs1322906618 6050 dbSNP
rs555896202 6065 dbSNP
rs1406698138 6070 dbSNP
rs1045398175 6071 dbSNP
rs945734578 6072 dbSNP
rs771257211 6084 dbSNP
rs1054591655 6085 dbSNP
rs747393928 6090 dbSNP
rs1274731443 6091 dbSNP
rs1307545575 6094 dbSNP
rs148672551 6099 dbSNP
rs1289000393 6101 dbSNP
rs1416298089 6105 dbSNP
rs982854297 6109 dbSNP
rs1202243314 6113 dbSNP
rs1247644264 6115 dbSNP
rs1475331323 6122 dbSNP
rs985316700 6135 dbSNP
rs955272298 6136 dbSNP
rs1184976332 6141 dbSNP
rs778183045 6142 dbSNP
rs1027378379 6144 dbSNP
rs143951352 6154 dbSNP
rs1391807807 6166 dbSNP
rs758950782 6167 dbSNP
rs1426454209 6168 dbSNP
rs1344350985 6172 dbSNP
rs1443751505 6172 dbSNP
rs972685457 6172 dbSNP
rs1271740893 6174 dbSNP
rs1235715639 6177 dbSNP
rs537015256 6181 dbSNP
rs1212139174 6190 dbSNP
rs1312210623 6191 dbSNP
rs961637162 6200 dbSNP
rs1007841961 6205 dbSNP
rs1016952545 6207 dbSNP
rs1225364673 6211 dbSNP
rs890279344 6213 dbSNP
rs1446951575 6215 dbSNP
rs558671083 6221 dbSNP
rs1214040826 6222 dbSNP
rs1051488291 6223 dbSNP
rs114541019 6232 dbSNP
rs563440693 6243 dbSNP
rs1343801963 6247 dbSNP
rs1383454174 6253 dbSNP
rs902873835 6262 dbSNP
rs752846719 6267 dbSNP
rs1163751783 6275 dbSNP
rs1407100934 6284 dbSNP
rs1398917010 6289 dbSNP
rs1043081920 6294 dbSNP
rs1451445560 6298 dbSNP
rs947666277 6299 dbSNP
rs1033789086 6309 dbSNP
rs371651606 6311 dbSNP
rs76900103 6314 dbSNP
rs1278473914 6326 dbSNP
rs6764057 6330 dbSNP
rs779097615 6336 dbSNP
rs1042998776 6338 dbSNP
rs1203233995 6342 dbSNP
rs1241581671 6343 dbSNP
rs1462845626 6346 dbSNP
rs1188289250 6347 dbSNP
rs1363310516 6349 dbSNP
rs1009823737 6360 dbSNP
rs181527950 6363 dbSNP
rs1341155643 6372 dbSNP
rs1054158146 6374 dbSNP
rs1307446355 6379 dbSNP
rs1412431172 6387 dbSNP
rs935718783 6391 dbSNP
rs974439913 6393 dbSNP
rs1372686179 6396 dbSNP
rs1194833463 6398 dbSNP
rs1407790891 6402 dbSNP
rs1396255403 6412 dbSNP
rs1327533520 6417 dbSNP
rs1169444257 6436 dbSNP
rs1404613425 6437 dbSNP
rs1330211769 6438 dbSNP
rs1223232528 6439 dbSNP
rs889579783 6444 dbSNP
rs753951310 6448 dbSNP
rs1261698738 6455 dbSNP
rs1325849217 6460 dbSNP
rs933780567 6466 dbSNP
rs11712790 6474 dbSNP
rs189888750 6475 dbSNP
rs922465539 6476 dbSNP
rs964072545 6484 dbSNP
rs1017972576 6493 dbSNP
rs750808084 6494 dbSNP
rs1252513826 6497 dbSNP
rs550748456 6498 dbSNP
rs1179436582 6500 dbSNP
rs1431176825 6509 dbSNP
rs939964980 6514 dbSNP
rs1466219310 6523 dbSNP
rs1167027751 6524 dbSNP
rs1393649345 6529 dbSNP
rs1411198958 6536 dbSNP
rs954566935 6543 dbSNP
rs757070396 6559 dbSNP
rs1351600905 6561 dbSNP
rs1404886818 6566 dbSNP
rs1281714601 6568 dbSNP
rs148182199 6573 dbSNP
rs1234231071 6574 dbSNP
rs1251010252 6575 dbSNP
rs551880617 6576 dbSNP
rs984160329 6577 dbSNP
rs1275447593 6580 dbSNP
rs1321566615 6581 dbSNP
rs74800265 6593 dbSNP
rs571438582 6594 dbSNP
rs1433594758 6595 dbSNP
rs1021372438 6607 dbSNP
rs751341346 6609 dbSNP
rs1476209371 6611 dbSNP
rs1011692372 6632 dbSNP
rs1364425634 6636 dbSNP
rs1424575042 6637 dbSNP
rs764071513 6641 dbSNP
rs879653634 6644 dbSNP
rs1380489314 6652 dbSNP
rs1301909086 6656 dbSNP
rs894130875 6664 dbSNP
rs1387759643 6676 dbSNP
rs1295341567 6678 dbSNP
rs1288227213 6687 dbSNP
rs970829783 6689 dbSNP
rs1352349675 6690 dbSNP
rs1267196239 6700 dbSNP
rs1488777442 6703 dbSNP
rs907384313 6707 dbSNP
rs1021137006 6709 dbSNP
rs762833893 6712 dbSNP
rs153734 6718 dbSNP
rs1166617023 6726 dbSNP
rs1384074489 6730 dbSNP
rs1405702320 6734 dbSNP
rs1033089415 6747 dbSNP
rs920041555 6753 dbSNP
rs1156790829 6772 dbSNP
rs1473291131 6773 dbSNP
rs1251906591 6777 dbSNP
rs1190330916 6778 dbSNP
rs528536234 6783 dbSNP
rs974176126 6797 dbSNP
rs1383330967 6802 dbSNP
rs1437543109 6806 dbSNP
rs149485668 6807 dbSNP
rs764666625 6816 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUA----AUACACGACGAu 5'
                :|||    ||| ||||||| 
Target 5' -----uUCAUUUCCUAU-UGCUGCUc 3'
1 - 20
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000295902.6 | 3UTR | UUCAUUUCCUAUUGCUGCUCAAUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.8 6.7e-6 -0.732 8.1e-5 21 Click to see details
GSE21849 B cell lymphoma -0.53 1.6e-3 0.321 4.5e-2 29 Click to see details
GSE21687 Ependynoma primary tumors 0.22 4.0e-2 0.215 4.4e-2 64 Click to see details
GSE19783 ER+ ER+ breast cancer 0.325 8.1e-2 0.382 4.8e-2 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.307 9.4e-2 0.072 3.8e-1 20 Click to see details
GSE28544 Breast cancer -0.223 1.5e-1 -0.642 3.6e-4 24 Click to see details
GSE32688 Pancreatic cancer -0.187 1.5e-1 -0.058 3.8e-1 32 Click to see details
GSE14794 Lymphoblastoid cells -0.104 1.6e-1 -0.082 2.2e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.266 2.0e-1 0.175 2.9e-1 12 Click to see details
GSE21032 Prostate cancer 0.087 2.2e-1 0.079 2.4e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.094 3.3e-1 0.127 2.7e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.077 3.6e-1 0.098 3.2e-1 24 Click to see details
GSE19536 Breast cancer 0.036 3.6e-1 -0.011 4.6e-1 100 Click to see details
GSE17306 Multiple myeloma 0.052 3.6e-1 0.046 3.8e-1 49 Click to see details
GSE42095 Differentiated embryonic stem cells -0.067 3.8e-1 -0.035 4.4e-1 23 Click to see details
GSE27834 Pluripotent stem cells -0.078 3.9e-1 -0.068 4.0e-1 16 Click to see details
GSE28260 Renal cortex and medulla -0.069 4.1e-1 -0.165 3.0e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.024 4.2e-1 -0.045 3.5e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.015 4.7e-1 -0.031 4.4e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.015 4.7e-1 -0.031 4.4e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.82 0 -0.826 0 32 Click to see details
PRAD -0.334 0.01 -0.282 0.02 50 Click to see details
BLCA -0.512 0.01 -0.474 0.02 18 Click to see details
CHOL -0.7 0.02 -0.767 0.01 9 Click to see details
PAAD -0.925 0.04 -0.400 0.3 4 Click to see details
KIRP 0.26 0.08 0.173 0.17 32 Click to see details
THCA -0.185 0.08 -0.189 0.08 59 Click to see details
COAD -0.418 0.15 -0.476 0.12 8 Click to see details
LUAD 0.256 0.21 0.217 0.25 12 Click to see details
HNSC -0.122 0.22 -0.090 0.29 42 Click to see details
LIHC 0.08 0.29 0.068 0.32 49 Click to see details
KIRC 0.058 0.32 0.112 0.18 68 Click to see details
ESCA 0.145 0.34 0.191 0.29 11 Click to see details
UCEC 0.076 0.38 0.084 0.37 19 Click to see details
KICH 0.064 0.38 0.008 0.48 25 Click to see details
BRCA 0.032 0.39 0.028 0.4 84 Click to see details
LUSC -0.017 0.46 -0.002 0.5 38 Click to see details
PCPG 0.071 0.48 -0.500 0.33 3 Click to see details
CESC 0.052 0.48 0.500 0.33 3 Click to see details
CESC 0.052 0.48 0.500 0.33 3 Click to see details
CESC 0.052 0.48 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis: