miRTarBase - #MIRT502038 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LRIG2   
Synonyms LIG-2, LIG2, UFS2
Description leucine rich repeats and immunoglobulin like domains 2
Transcript NM_014813   
Expression
Putative miRNA Targets on LRIG2
3'UTR of LRIG2
(miRNA target sites are highlighted)
>LRIG2|NM_014813|3'UTR
   1 AACTCACTTCAGGATGAAATCTGGGCAGAGACTTATTAATTAATTTTGCATTTACTACCTCAGAGCTCAGAAGAAACTCC
  81 GAAGTCAGCATTTGCTTTACTCTTTCTTTATGATTGCATCTGACCGCACCAAGGTGGGCCATGCGTTGTTTGGTCTTATA
 161 CCTGATGAAGAAATGGCAACAGCTGACAGAAATGGGTACAGCTCATCAAAAATGTGCAGCACCGGCAGAGGGAAGATACG
 241 GGGCAAATGTGCTTCCTGATGCTTCCATGGGGATGTGCCCTGGTGTGCATCTGCTTGTCAGGAAGAGTCACATTGCTGCT
 321 TAACATGCTGGATTGCCCTAGTCTTCAGAATGGTCCTGAGAAAACATCACTACTTCGATGTTCTACTTTGCTTTCCAAGG
 401 AGCAAAAATAACTTTGGAGCCTTCTGGGAAGTGTGCCTGGGATTCTTCAGTGGTTTCAGGCAGATAGTTGAGACTGGGGC
 481 TTTGATATTCAAGGTCTTTGGCAAGAATCCCAGGCTTGACCAACTGGTACCAGGTCAAAGATTTTTGTATTCTTGTGAAT
 561 TTTTTTTTTTGTCCCTATTGCCCAGGGATGTCATTGTAAATATATGTGCATTTATAAATAATTTTTGTATTCATTGACCA
 641 TATGTGTTGGCTGCAATGTAAATATTTTTGATATGCCAAAATTATATGTAATATCCAGTTATAATATTGACAAGTAGCTT
 721 CTCAGATCACAGATTTTAAATAACTCAATTTAGTGAGATCTAAAAATTTTATTTAAAGTATAAAAACTGTGGCTCACACC
 801 TGTAATCCCAGCATTTTGAGAGGCTAAGGTGGGAGGATTGCTTGAGGCCAGGAATTTGAGACCAGGCTGGGCAACATGGT
 881 GAGACCCTGTGTCTGCAAAAAAATAAATTAAAAAAATAGGTGGACATTGTGGCATGCTGCTGTAGTCCTAGCTACTTGGG
 961 AGGCTGAGGTGGGAGGGTCACTTGAGCCCGGGAAATCAAGGCTGCAGTGAGCTGTGTGAAGCCACTGCATCCCAGCCTGG
1041 GTGACAGAGTGAGGCCCTGGCTCAAAAGTAAAATAAATAAATAAAAAGTTTTAAAAACTTAAAAAAAAAAAAAAAAAAAA
1121 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugGUAAUAC---ACGACGAu 5'
                 ||||:||   ||||||| 
Target 5' aggtggaCATTGTGGCATGCTGCTg 3'
918 - 942 159.00 -16.80
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             :|::||  || ||||||| 
Target 5' gaaGAGTCA-CAT-TGCTGCTt 3'
302 - 321 149.00 -10.80
3
miRNA  3' guguUUGGUAAUACACGA-CGAu 5'
              :|||| ||||||:| ||| 
Target 5' cattGACCA-TATGTGTTGGCTg 3'
632 - 653 125.00 -17.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30114768 43 COSMIC
COSN30102148 82 COSMIC
COSN30528902 82 COSMIC
COSN31562361 124 COSMIC
COSN30114988 146 COSMIC
COSN31960283 205 COSMIC
COSN29928272 244 COSMIC
COSN16130531 377 COSMIC
COSN31582382 420 COSMIC
COSN31588201 450 COSMIC
COSN16128731 553 COSMIC
COSN1087228 571 COSMIC
COSN27206449 571 COSMIC
COSN22897708 904 COSMIC
COSN5730754 1575 COSMIC
COSN21402577 1734 COSMIC
COSN5999054 2375 COSMIC
COSN7172577 2408 COSMIC
COSN27673877 2540 COSMIC
COSN1087229 2776 COSMIC
COSN8887398 2828 COSMIC
COSN26762511 2872 COSMIC
COSN1401846 2973 COSMIC
COSN15023275 2990 COSMIC
COSN7172578 3257 COSMIC
COSN24332293 3469 COSMIC
COSN28943119 3482 COSMIC
COSN5353083 3498 COSMIC
COSN22080938 3591 COSMIC
COSN1401847 3868 COSMIC
COSN7172579 3963 COSMIC
COSN32123220 4815 COSMIC
COSN16407208 5071 COSMIC
COSN19552267 5351 COSMIC
COSN23366423 5450 COSMIC
COSN24763670 5809 COSMIC
COSN15903877 6192 COSMIC
COSN24933121 6526 COSMIC
COSN4743446 6771 COSMIC
COSN20842312 6855 COSMIC
COSN15282578 6948 COSMIC
COSN23270584 7364 COSMIC
COSN30654218 7494 COSMIC
COSN30723679 7495 COSMIC
COSN30642756 7575 COSMIC
COSN1087230 7594 COSMIC
COSN15665504 7734 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773635499 13 dbSNP
rs1374431305 22 dbSNP
rs761081245 24 dbSNP
rs77848874 25 dbSNP
rs780244918 27 dbSNP
rs927853047 27 dbSNP
rs1230523517 29 dbSNP
rs754074916 31 dbSNP
rs747384728 35 dbSNP
rs755768387 36 dbSNP
rs1240366907 37 dbSNP
rs759843208 39 dbSNP
rs915029036 40 dbSNP
rs765613010 44 dbSNP
rs752818271 49 dbSNP
rs779396501 51 dbSNP
rs1369235896 58 dbSNP
rs1055198235 71 dbSNP
rs1192185018 75 dbSNP
rs916255351 76 dbSNP
rs746341683 81 dbSNP
rs947536989 85 dbSNP
rs1394805797 92 dbSNP
rs1435897234 94 dbSNP
rs1250901329 100 dbSNP
rs1176398510 101 dbSNP
rs1482071711 103 dbSNP
rs946429022 106 dbSNP
rs1043473922 113 dbSNP
rs942910744 116 dbSNP
rs574537774 118 dbSNP
rs1265087533 119 dbSNP
rs376195015 120 dbSNP
rs902295370 124 dbSNP
rs999632877 125 dbSNP
rs533921788 126 dbSNP
rs759016056 127 dbSNP
rs190780458 129 dbSNP
rs1317258062 130 dbSNP
rs576902980 139 dbSNP
rs1029375931 142 dbSNP
rs1409571699 143 dbSNP
rs952094079 145 dbSNP
rs143701113 146 dbSNP
rs1047165155 165 dbSNP
rs1006289547 170 dbSNP
rs1161111221 174 dbSNP
rs1455076944 178 dbSNP
rs1015000658 180 dbSNP
rs1364015566 183 dbSNP
rs1434273540 192 dbSNP
rs962152341 195 dbSNP
rs148144342 200 dbSNP
rs1199973773 201 dbSNP
rs1490537381 203 dbSNP
rs573401640 204 dbSNP
rs1208127813 205 dbSNP
rs1353155327 209 dbSNP
rs867304519 215 dbSNP
rs1228192596 216 dbSNP
rs990763394 223 dbSNP
rs916207405 224 dbSNP
rs956568481 225 dbSNP
rs987798311 227 dbSNP
rs540504768 240 dbSNP
rs1204599351 241 dbSNP
rs1268807218 251 dbSNP
rs1466439451 252 dbSNP
rs1043401328 260 dbSNP
rs1211994765 266 dbSNP
rs923684788 269 dbSNP
rs182630453 276 dbSNP
rs1431080331 278 dbSNP
rs1434112640 278 dbSNP
rs1176866594 279 dbSNP
rs985849318 291 dbSNP
rs188025838 303 dbSNP
rs1375826338 304 dbSNP
rs1196915840 308 dbSNP
rs1040479630 313 dbSNP
rs1262736226 317 dbSNP
rs1208276522 319 dbSNP
rs768362114 320 dbSNP
rs1201717030 326 dbSNP
rs902019185 337 dbSNP
rs996803544 347 dbSNP
rs1344973664 354 dbSNP
rs1050718691 360 dbSNP
rs192847776 378 dbSNP
rs1006215948 386 dbSNP
rs1014969515 387 dbSNP
rs922907665 390 dbSNP
rs1432520664 404 dbSNP
rs929948436 411 dbSNP
rs1047072467 415 dbSNP
rs1413674520 423 dbSNP
rs962120557 428 dbSNP
rs1169541346 429 dbSNP
rs1458505575 431 dbSNP
rs141929843 438 dbSNP
rs1187992383 446 dbSNP
rs1323399471 451 dbSNP
rs941393233 465 dbSNP
rs1002962501 467 dbSNP
rs751759740 468 dbSNP
rs1204768196 474 dbSNP
rs1442163122 474 dbSNP
rs1277123533 475 dbSNP
rs184624204 480 dbSNP
rs960588792 483 dbSNP
rs1296316482 489 dbSNP
rs1225500683 508 dbSNP
rs1384602559 511 dbSNP
rs1315247529 512 dbSNP
rs991081590 514 dbSNP
rs1330831522 537 dbSNP
rs1338418682 537 dbSNP
rs564192357 546 dbSNP
rs750038369 556 dbSNP
rs74885682 559 dbSNP
rs1003415087 560 dbSNP
rs1035338789 560 dbSNP
rs1369873088 560 dbSNP
rs1427880226 571 dbSNP
rs1387349781 574 dbSNP
rs1333938624 575 dbSNP
rs373622104 577 dbSNP
rs892357124 578 dbSNP
rs747901574 581 dbSNP
rs1236143753 584 dbSNP
rs1238178451 587 dbSNP
rs1438937747 588 dbSNP
rs967972392 596 dbSNP
rs1289079652 598 dbSNP
rs1009450813 604 dbSNP
rs979064082 619 dbSNP
rs1202431362 628 dbSNP
rs533009986 641 dbSNP
rs769462650 642 dbSNP
rs967688401 645 dbSNP
rs935046871 650 dbSNP
rs985839338 656 dbSNP
rs1489037464 664 dbSNP
rs1376504619 665 dbSNP
rs975871835 666 dbSNP
rs773106429 669 dbSNP
rs1211968468 674 dbSNP
rs1442626290 678 dbSNP
rs1349850445 682 dbSNP
rs923411525 686 dbSNP
rs552505084 687 dbSNP
rs1408083195 691 dbSNP
rs1051060575 692 dbSNP
rs1367465196 710 dbSNP
rs888029620 716 dbSNP
rs1405058044 720 dbSNP
rs1411856234 721 dbSNP
rs1160700670 723 dbSNP
rs1473092646 725 dbSNP
rs976970255 728 dbSNP
rs1180572104 731 dbSNP
rs942301228 733 dbSNP
rs1036326945 737 dbSNP
rs762702883 742 dbSNP
rs922779472 749 dbSNP
rs1183465843 754 dbSNP
rs187448647 759 dbSNP
rs1319597490 762 dbSNP
rs1473284682 766 dbSNP
rs770878841 767 dbSNP
rs983040875 776 dbSNP
rs1286394171 780 dbSNP
rs1035758047 787 dbSNP
rs1225333626 788 dbSNP
rs909846075 796 dbSNP
rs1367509097 797 dbSNP
rs1294233652 803 dbSNP
rs531807109 809 dbSNP
rs765943575 818 dbSNP
rs941382018 830 dbSNP
rs1320485695 833 dbSNP
rs1012073106 834 dbSNP
rs1045167577 839 dbSNP
rs905307207 848 dbSNP
rs1295091747 865 dbSNP
rs1023928963 868 dbSNP
rs1393991012 869 dbSNP
rs775491995 870 dbSNP
rs760749683 871 dbSNP
rs1190180801 872 dbSNP
rs1308552955 876 dbSNP
rs1243519571 877 dbSNP
rs967899205 886 dbSNP
rs1412987603 897 dbSNP
rs939165570 897 dbSNP
rs1266084952 899 dbSNP
rs1225084290 910 dbSNP
rs1324250927 912 dbSNP
rs764301689 929 dbSNP
rs1300441458 935 dbSNP
rs979324496 943 dbSNP
rs1030597295 946 dbSNP
rs192625547 949 dbSNP
rs1322589117 951 dbSNP
rs1272162623 953 dbSNP
rs568397442 957 dbSNP
rs976177272 958 dbSNP
rs1009398468 963 dbSNP
rs1319013070 964 dbSNP
rs1471148550 967 dbSNP
rs1360273118 970 dbSNP
rs1043663200 971 dbSNP
rs12143835 974 dbSNP
rs1421094393 977 dbSNP
rs1339073062 982 dbSNP
rs1448541977 983 dbSNP
rs1206585150 987 dbSNP
rs1245790572 990 dbSNP
rs931760805 990 dbSNP
rs1483779082 991 dbSNP
rs1255342731 993 dbSNP
rs1207866757 996 dbSNP
rs543797663 998 dbSNP
rs1185120912 1011 dbSNP
rs1007208403 1015 dbSNP
rs1017753829 1022 dbSNP
rs201521552 1023 dbSNP
rs986315741 1024 dbSNP
rs1380265807 1025 dbSNP
rs1424041853 1033 dbSNP
rs1166388372 1036 dbSNP
rs1302621156 1039 dbSNP
rs997688185 1041 dbSNP
rs1371194531 1057 dbSNP
rs184874839 1062 dbSNP
rs1428481969 1069 dbSNP
rs1184978104 1071 dbSNP
rs1387967122 1071 dbSNP
rs1169192676 1073 dbSNP
rs1301630953 1079 dbSNP
rs1424187133 1083 dbSNP
rs1372294144 1087 dbSNP
rs778461835 1103 dbSNP
rs1255286897 1104 dbSNP
rs951530212 1106 dbSNP
rs188463414 1110 dbSNP
rs117039516 1114 dbSNP
rs749956 1115 dbSNP
rs750846953 1120 dbSNP
rs180864140 1121 dbSNP
rs1322547758 1125 dbSNP
rs541645241 1131 dbSNP
rs1394630923 1139 dbSNP
rs894557741 1146 dbSNP
rs1277447929 1154 dbSNP
rs1346384015 1156 dbSNP
rs1408691236 1156 dbSNP
rs1210720591 1158 dbSNP
rs555728446 1159 dbSNP
rs758923440 1164 dbSNP
rs374111401 1166 dbSNP
rs1183292725 1174 dbSNP
rs572342628 1179 dbSNP
rs532007848 1180 dbSNP
rs1249794723 1181 dbSNP
rs755741529 1186 dbSNP
rs1488957436 1190 dbSNP
rs939416012 1193 dbSNP
rs1243105119 1198 dbSNP
rs1289535256 1204 dbSNP
rs541043192 1204 dbSNP
rs1056952815 1219 dbSNP
rs1000715453 1220 dbSNP
rs1391735990 1231 dbSNP
rs1030858154 1237 dbSNP
rs956651690 1247 dbSNP
rs184276899 1248 dbSNP
rs1389600520 1259 dbSNP
rs945243808 1259 dbSNP
rs1175195370 1271 dbSNP
rs1030452714 1283 dbSNP
rs532888264 1285 dbSNP
rs1412362942 1289 dbSNP
rs1158141199 1300 dbSNP
rs1471591406 1306 dbSNP
rs1007449045 1307 dbSNP
rs543549291 1310 dbSNP
rs189635263 1328 dbSNP
rs1433800525 1331 dbSNP
rs1287386662 1337 dbSNP
rs181165916 1350 dbSNP
rs1466410534 1353 dbSNP
rs748763951 1353 dbSNP
rs185962883 1354 dbSNP
rs200027446 1355 dbSNP
rs35747502 1355 dbSNP
rs552112086 1355 dbSNP
rs1369148862 1356 dbSNP
rs386368110 1358 dbSNP
rs199581412 1364 dbSNP
rs938971063 1368 dbSNP
rs1026524101 1370 dbSNP
rs951519052 1370 dbSNP
rs1388875884 1379 dbSNP
rs1319697591 1387 dbSNP
rs1455400514 1389 dbSNP
rs1004415565 1390 dbSNP
rs1017182464 1391 dbSNP
rs1478402537 1394 dbSNP
rs1302565930 1398 dbSNP
rs1377194190 1400 dbSNP
rs962934521 1420 dbSNP
rs981436375 1421 dbSNP
rs1211577177 1422 dbSNP
rs1057091804 1430 dbSNP
rs961029322 1441 dbSNP
rs1463796344 1442 dbSNP
rs1281353632 1444 dbSNP
rs754530908 1444 dbSNP
rs1201470508 1447 dbSNP
rs1344911957 1456 dbSNP
rs570755526 1459 dbSNP
rs1229944414 1467 dbSNP
rs1464177787 1474 dbSNP
rs1296364369 1479 dbSNP
rs568434163 1489 dbSNP
rs74986097 1495 dbSNP
rs1452336662 1499 dbSNP
rs1413902050 1504 dbSNP
rs1190603541 1509 dbSNP
rs747732924 1531 dbSNP
rs769523889 1536 dbSNP
rs904639931 1545 dbSNP
rs1431656477 1551 dbSNP
rs1391058306 1577 dbSNP
rs538183043 1581 dbSNP
rs10494149 1587 dbSNP
rs1239640658 1592 dbSNP
rs1188675728 1597 dbSNP
rs866270553 1602 dbSNP
rs1254626806 1604 dbSNP
rs1039366767 1607 dbSNP
rs901508651 1611 dbSNP
rs747133698 1619 dbSNP
rs1342167256 1621 dbSNP
rs10494150 1622 dbSNP
rs1225793545 1623 dbSNP
rs1284605547 1625 dbSNP
rs1358017470 1625 dbSNP
rs1411272252 1626 dbSNP
rs1047462185 1630 dbSNP
rs997846901 1650 dbSNP
rs1029965906 1655 dbSNP
rs768767771 1655 dbSNP
rs1322798175 1657 dbSNP
rs539443518 1660 dbSNP
rs1411750204 1668 dbSNP
rs1371180297 1669 dbSNP
rs139038285 1678 dbSNP
rs1294670892 1680 dbSNP
rs1370400179 1684 dbSNP
rs1408500460 1688 dbSNP
rs1416198097 1695 dbSNP
rs1222514512 1713 dbSNP
rs1285930711 1714 dbSNP
rs1007248177 1725 dbSNP
rs1228701591 1727 dbSNP
rs1016007105 1728 dbSNP
rs1416340748 1728 dbSNP
rs570031189 1729 dbSNP
rs1184888671 1747 dbSNP
rs1483658574 1750 dbSNP
rs963156062 1755 dbSNP
rs972220862 1759 dbSNP
rs1453025092 1761 dbSNP
rs553370385 1766 dbSNP
rs1002455402 1774 dbSNP
rs1353918546 1780 dbSNP
rs1290152035 1782 dbSNP
rs919427688 1783 dbSNP
rs1177979820 1787 dbSNP
rs960285215 1794 dbSNP
rs960725803 1804 dbSNP
rs1440049877 1814 dbSNP
rs1351867185 1815 dbSNP
rs1324371167 1816 dbSNP
rs1405154294 1820 dbSNP
rs72988217 1825 dbSNP
rs992590700 1835 dbSNP
rs1161816615 1836 dbSNP
rs1473226582 1844 dbSNP
rs1411842755 1845 dbSNP
rs1175340991 1857 dbSNP
rs1020929511 1863 dbSNP
rs993500133 1871 dbSNP
rs1161705438 1873 dbSNP
rs966736348 1874 dbSNP
rs1415914922 1877 dbSNP
rs774267841 1880 dbSNP
rs1209089958 1891 dbSNP
rs1328417869 1900 dbSNP
rs1165954466 1902 dbSNP
rs979494528 1903 dbSNP
rs1222145165 1907 dbSNP
rs759531658 1922 dbSNP
rs1275494526 1925 dbSNP
rs796152001 1926 dbSNP
rs1392511857 1929 dbSNP
rs1307957512 1932 dbSNP
rs1043069337 1937 dbSNP
rs1388594403 1946 dbSNP
rs1349404409 1977 dbSNP
rs555567384 2003 dbSNP
rs1157478149 2005 dbSNP
rs1415699585 2006 dbSNP
rs116376840 2007 dbSNP
rs1190118389 2008 dbSNP
rs934786223 2011 dbSNP
rs1052181768 2015 dbSNP
rs892304044 2020 dbSNP
rs1249481611 2027 dbSNP
rs1189011378 2030 dbSNP
rs1353861872 2033 dbSNP
rs1464218253 2036 dbSNP
rs561770413 2039 dbSNP
rs932985120 2046 dbSNP
rs1212225189 2047 dbSNP
rs1312691622 2048 dbSNP
rs1279468363 2049 dbSNP
rs1410381077 2056 dbSNP
rs1218694922 2066 dbSNP
rs1290348720 2078 dbSNP
rs1047407591 2081 dbSNP
rs886122214 2083 dbSNP
rs1436287117 2085 dbSNP
rs541280361 2087 dbSNP
rs1287472457 2089 dbSNP
rs377136172 2090 dbSNP
rs190474711 2091 dbSNP
rs1203002795 2096 dbSNP
rs773823412 2109 dbSNP
rs577606746 2111 dbSNP
rs1483446041 2114 dbSNP
rs898663225 2119 dbSNP
rs1168771243 2120 dbSNP
rs1007222625 2125 dbSNP
rs1472598237 2127 dbSNP
rs1033924069 2131 dbSNP
rs1015975501 2134 dbSNP
rs1483564796 2142 dbSNP
rs1236779808 2147 dbSNP
rs776815601 2160 dbSNP
rs896702394 2161 dbSNP
rs898875823 2163 dbSNP
rs1277053572 2165 dbSNP
rs1229487093 2178 dbSNP
rs10494151 2195 dbSNP
rs1026454764 2208 dbSNP
rs960501150 2209 dbSNP
rs966689835 2216 dbSNP
rs1398137311 2220 dbSNP
rs979478070 2224 dbSNP
rs993036398 2226 dbSNP
rs779093857 2227 dbSNP
rs866541822 2230 dbSNP
rs1023626523 2238 dbSNP
rs964557032 2239 dbSNP
rs761672553 2240 dbSNP
rs1446919102 2248 dbSNP
rs1424133629 2262 dbSNP
rs923140188 2266 dbSNP
rs563423133 2271 dbSNP
rs528951926 2275 dbSNP
rs2840294 2276 dbSNP
rs868423943 2278 dbSNP
rs934714360 2285 dbSNP
rs1254155791 2290 dbSNP
rs1273601850 2306 dbSNP
rs1480459818 2306 dbSNP
rs1342811689 2310 dbSNP
rs527305285 2311 dbSNP
rs1276593383 2318 dbSNP
rs1322635886 2323 dbSNP
rs941718402 2329 dbSNP
rs1232067565 2332 dbSNP
rs1352834803 2335 dbSNP
rs1037438792 2336 dbSNP
rs1408634941 2347 dbSNP
rs1393916488 2349 dbSNP
rs913714130 2354 dbSNP
rs763411901 2357 dbSNP
rs1239409545 2373 dbSNP
rs527880131 2374 dbSNP
rs1473557483 2385 dbSNP
rs1051636799 2388 dbSNP
rs142244641 2402 dbSNP
rs1391121717 2405 dbSNP
rs1055678126 2407 dbSNP
rs182039049 2408 dbSNP
rs1211912862 2410 dbSNP
rs1488925291 2424 dbSNP
rs533393067 2426 dbSNP
rs1172247642 2429 dbSNP
rs1272984944 2437 dbSNP
rs1212186733 2454 dbSNP
rs1331868565 2463 dbSNP
rs1289479877 2464 dbSNP
rs567479017 2465 dbSNP
rs1037336441 2468 dbSNP
rs1013756235 2470 dbSNP
rs1333421192 2473 dbSNP
rs1399504717 2475 dbSNP
rs549880831 2483 dbSNP
rs1302750375 2487 dbSNP
rs570150490 2490 dbSNP
rs535911624 2491 dbSNP
rs1334444445 2501 dbSNP
rs1387061825 2509 dbSNP
rs1369747542 2539 dbSNP
rs898844738 2548 dbSNP
rs1432377568 2573 dbSNP
rs1458576758 2580 dbSNP
rs1296615190 2591 dbSNP
rs1042652609 2592 dbSNP
rs993221446 2603 dbSNP
rs1365567918 2611 dbSNP
rs878953682 2619 dbSNP
rs1000843665 2620 dbSNP
rs1201046247 2626 dbSNP
rs1434033221 2629 dbSNP
rs1252554701 2650 dbSNP
rs895596276 2652 dbSNP
rs1014830144 2657 dbSNP
rs1269339076 2668 dbSNP
rs1205119439 2669 dbSNP
rs1344463554 2670 dbSNP
rs1023172233 2673 dbSNP
rs1349156445 2689 dbSNP
rs1257287940 2692 dbSNP
rs1233319227 2695 dbSNP
rs1346735044 2704 dbSNP
rs965126691 2708 dbSNP
rs970676913 2709 dbSNP
rs1201078767 2716 dbSNP
rs996292103 2718 dbSNP
rs978993699 2729 dbSNP
rs1032948648 2736 dbSNP
rs549201473 2740 dbSNP
rs534400417 2749 dbSNP
rs954604512 2763 dbSNP
rs752098704 2765 dbSNP
rs966868651 2769 dbSNP
rs762641532 2771 dbSNP
rs922669584 2789 dbSNP
rs1171944934 2802 dbSNP
rs907817925 2803 dbSNP
rs934128439 2808 dbSNP
rs1249109412 2809 dbSNP
rs963027378 2810 dbSNP
rs1258816551 2821 dbSNP
rs1377525939 2826 dbSNP
rs1200570049 2836 dbSNP
rs973037002 2838 dbSNP
rs987668876 2842 dbSNP
rs910393262 2848 dbSNP
rs926997759 2855 dbSNP
rs1342392380 2867 dbSNP
rs145948371 2869 dbSNP
rs1269423986 2877 dbSNP
rs1224903849 2881 dbSNP
rs1342227519 2889 dbSNP
rs1478618360 2893 dbSNP
rs1415488770 2894 dbSNP
rs77952425 2896 dbSNP
rs1426589343 2899 dbSNP
rs1431906314 2902 dbSNP
rs1056890040 2920 dbSNP
rs577084946 2939 dbSNP
rs949593316 2940 dbSNP
rs1455319234 2941 dbSNP
rs1042600266 2951 dbSNP
rs902800256 2956 dbSNP
rs1319464616 2959 dbSNP
rs186275930 2971 dbSNP
rs766797065 2983 dbSNP
rs1483189618 3000 dbSNP
rs1271801298 3013 dbSNP
rs928944093 3019 dbSNP
rs752281478 3022 dbSNP
rs1054170244 3025 dbSNP
rs900501287 3028 dbSNP
rs1047425442 3032 dbSNP
rs1030456407 3037 dbSNP
rs1232672733 3044 dbSNP
rs1330483711 3047 dbSNP
rs954684289 3059 dbSNP
rs1004749084 3063 dbSNP
rs1355373742 3065 dbSNP
rs1328365183 3077 dbSNP
rs577835894 3081 dbSNP
rs1393409445 3083 dbSNP
rs1014007963 3087 dbSNP
rs1475194307 3091 dbSNP
rs79915389 3104 dbSNP
rs906056563 3105 dbSNP
rs926918334 3106 dbSNP
rs112907549 3108 dbSNP
rs1000381463 3117 dbSNP
rs1033207676 3118 dbSNP
rs1231966762 3150 dbSNP
rs956322551 3154 dbSNP
rs116013795 3155 dbSNP
rs1452973044 3166 dbSNP
rs573686461 3172 dbSNP
rs35737003 3173 dbSNP
rs1332616595 3176 dbSNP
rs985575469 3178 dbSNP
rs917028729 3180 dbSNP
rs1230312635 3181 dbSNP
rs949541083 3184 dbSNP
rs978201179 3191 dbSNP
rs559016801 3195 dbSNP
rs964521722 3205 dbSNP
rs1412212944 3215 dbSNP
rs973261350 3227 dbSNP
rs936884071 3232 dbSNP
rs1054046793 3239 dbSNP
rs920503760 3242 dbSNP
rs929248559 3247 dbSNP
rs1161269849 3250 dbSNP
rs1389680346 3261 dbSNP
rs1387286802 3265 dbSNP
rs1406692735 3266 dbSNP
rs372664679 3267 dbSNP
rs944720599 3270 dbSNP
rs371674464 3271 dbSNP
rs900502149 3272 dbSNP
rs1409248668 3280 dbSNP
rs76142953 3280 dbSNP
rs1192808804 3281 dbSNP
rs1283709232 3281 dbSNP
rs1347432419 3281 dbSNP
rs33992650 3281 dbSNP
rs57285134 3281 dbSNP
rs753596788 3281 dbSNP
rs771464803 3281 dbSNP
rs773663735 3281 dbSNP
rs869071505 3281 dbSNP
rs1304353640 3282 dbSNP
rs932027195 3284 dbSNP
rs1369313047 3286 dbSNP
rs1322963090 3288 dbSNP
rs1432161735 3289 dbSNP
rs1331508915 3290 dbSNP
rs1215478095 3299 dbSNP
rs1242807966 3299 dbSNP
rs77035939 3299 dbSNP
rs1156344951 3300 dbSNP
rs1265231501 3301 dbSNP
rs1172572511 3302 dbSNP
rs1395316461 3302 dbSNP
rs1380268193 3303 dbSNP
rs1452174425 3304 dbSNP
rs12143473 3305 dbSNP
rs1039405759 3306 dbSNP
rs1391861104 3307 dbSNP
rs1186863009 3309 dbSNP
rs1212210419 3311 dbSNP
rs921935658 3312 dbSNP
rs1240238868 3320 dbSNP
rs1481811156 3320 dbSNP
rs1213737199 3323 dbSNP
rs1194154483 3324 dbSNP
rs1052271034 3332 dbSNP
rs1281109875 3333 dbSNP
rs1233928001 3341 dbSNP
rs1180866957 3354 dbSNP
rs1047808940 3358 dbSNP
rs1251848442 3359 dbSNP
rs1345953354 3362 dbSNP
rs1215473001 3363 dbSNP
rs1361909197 3365 dbSNP
rs890517110 3370 dbSNP
rs1420520248 3371 dbSNP
rs572341387 3373 dbSNP
rs574108552 3376 dbSNP
rs1432526242 3380 dbSNP
rs949812303 3381 dbSNP
rs1391577301 3385 dbSNP
rs1170915553 3416 dbSNP
rs760318084 3432 dbSNP
rs1417310947 3441 dbSNP
rs796465091 3443 dbSNP
rs905646230 3449 dbSNP
rs541207567 3453 dbSNP
rs1258365470 3459 dbSNP
rs1368661684 3460 dbSNP
rs995154736 3461 dbSNP
rs1253252909 3466 dbSNP
rs1205669248 3467 dbSNP
rs1308724351 3468 dbSNP
rs1292155491 3469 dbSNP
rs1356630478 3469 dbSNP
rs149349712 3469 dbSNP
rs59848515 3469 dbSNP
rs1352341277 3470 dbSNP
rs1412333048 3471 dbSNP
rs1394573876 3483 dbSNP
rs564824585 3487 dbSNP
rs1034309824 3488 dbSNP
rs1341498280 3491 dbSNP
rs1247403099 3495 dbSNP
rs149697654 3496 dbSNP
rs1342104105 3499 dbSNP
rs1417016241 3499 dbSNP
rs1206430011 3501 dbSNP
rs1474229870 3507 dbSNP
rs1252946860 3511 dbSNP
rs1178057998 3517 dbSNP
rs1274743227 3526 dbSNP
rs992533928 3529 dbSNP
rs1215920853 3533 dbSNP
rs1336147055 3534 dbSNP
rs1273027448 3540 dbSNP
rs1230934889 3551 dbSNP
rs1024403023 3556 dbSNP
rs1481327246 3557 dbSNP
rs1390501565 3558 dbSNP
rs967075616 3579 dbSNP
rs1255005749 3581 dbSNP
rs1393650709 3582 dbSNP
rs1054590121 3587 dbSNP
rs1423988054 3590 dbSNP
rs1185217909 3601 dbSNP
rs892007243 3605 dbSNP
rs977141464 3609 dbSNP
rs924076053 3615 dbSNP
rs550158464 3616 dbSNP
rs1356410136 3620 dbSNP
rs1248636209 3625 dbSNP
rs1464589238 3626 dbSNP
rs563489258 3630 dbSNP
rs192129680 3642 dbSNP
rs990123153 3649 dbSNP
rs745777573 3652 dbSNP
rs541493354 3656 dbSNP
rs1212438685 3657 dbSNP
rs922239692 3667 dbSNP
rs376891991 3668 dbSNP
rs955419260 3669 dbSNP
rs1237644055 3673 dbSNP
rs1314798291 3675 dbSNP
rs1007325286 3677 dbSNP
rs1305090310 3680 dbSNP
rs1370053895 3684 dbSNP
rs1018357706 3685 dbSNP
rs1323644496 3687 dbSNP
rs1454738125 3689 dbSNP
rs932239959 3696 dbSNP
rs962821810 3706 dbSNP
rs1385558454 3707 dbSNP
rs1289549553 3708 dbSNP
rs1051745775 3712 dbSNP
rs1295878548 3714 dbSNP
rs1364840803 3715 dbSNP
rs1229877922 3720 dbSNP
rs973231470 3721 dbSNP
rs920429489 3724 dbSNP
rs549539532 3725 dbSNP
rs1449254964 3728 dbSNP
rs1262994465 3733 dbSNP
rs1204041256 3743 dbSNP
rs1484575846 3745 dbSNP
rs566161077 3747 dbSNP
rs527243451 3748 dbSNP
rs940722467 3757 dbSNP
rs1483378505 3758 dbSNP
rs534841076 3760 dbSNP
rs916880220 3763 dbSNP
rs898996230 3764 dbSNP
rs949730745 3767 dbSNP
rs551257418 3768 dbSNP
rs927041700 3773 dbSNP
rs1380442672 3782 dbSNP
rs571531579 3783 dbSNP
rs1314793452 3785 dbSNP
rs1375022138 3791 dbSNP
rs1435625361 3791 dbSNP
rs1172198774 3807 dbSNP
rs1034666911 3809 dbSNP
rs1189195522 3817 dbSNP
rs1374157198 3818 dbSNP
rs935753946 3828 dbSNP
rs1054516347 3835 dbSNP
rs200820371 3835 dbSNP
rs149141047 3837 dbSNP
rs891974748 3839 dbSNP
rs10627225 3840 dbSNP
rs57415596 3840 dbSNP
rs79705904 3840 dbSNP
rs34835901 3841 dbSNP
rs946267267 3843 dbSNP
rs148573492 3852 dbSNP
rs1339895332 3853 dbSNP
rs1225200020 3865 dbSNP
rs769837767 3865 dbSNP
rs1357262768 3866 dbSNP
rs773559563 3879 dbSNP
rs556917677 3886 dbSNP
rs202240633 3887 dbSNP
rs527438908 3890 dbSNP
rs1006883377 3892 dbSNP
rs922113638 3895 dbSNP
rs1436252940 3896 dbSNP
rs953616460 3900 dbSNP
rs766826824 3908 dbSNP
rs1397744400 3909 dbSNP
rs774894440 3914 dbSNP
rs1167672339 3915 dbSNP
rs1464568447 3918 dbSNP
rs1188089323 3931 dbSNP
rs1420593489 3931 dbSNP
rs1366138346 3937 dbSNP
rs1254753507 3939 dbSNP
rs1386645382 3946 dbSNP
rs898542451 3948 dbSNP
rs757707979 3951 dbSNP
rs1272084270 3956 dbSNP
rs1323619961 3968 dbSNP
rs911888090 3969 dbSNP
rs1273662743 3993 dbSNP
rs1265824390 3994 dbSNP
rs1328268969 4000 dbSNP
rs552338485 4004 dbSNP
rs564282442 4011 dbSNP
rs1282498253 4013 dbSNP
rs1444687675 4018 dbSNP
rs1336556270 4032 dbSNP
rs1328632419 4035 dbSNP
rs1036428729 4044 dbSNP
rs531587374 4047 dbSNP
rs1190486644 4052 dbSNP
rs1159769900 4063 dbSNP
rs1411043406 4063 dbSNP
rs1470320073 4066 dbSNP
rs1027461887 4072 dbSNP
rs1176550029 4075 dbSNP
rs147639652 4078 dbSNP
rs552064778 4078 dbSNP
rs573344206 4088 dbSNP
rs950600013 4091 dbSNP
rs1055607605 4094 dbSNP
rs144482078 4097 dbSNP
rs1287879820 4099 dbSNP
rs552679745 4104 dbSNP
rs1161747454 4106 dbSNP
rs1348429704 4112 dbSNP
rs971755999 4123 dbSNP
rs1238225565 4132 dbSNP
rs1045657526 4133 dbSNP
rs572576726 4133 dbSNP
rs373708193 4135 dbSNP
rs558749697 4135 dbSNP
rs979695943 4135 dbSNP
rs148456868 4136 dbSNP
rs1032654155 4138 dbSNP
rs1406213878 4142 dbSNP
rs1285864957 4145 dbSNP
rs1319750123 4148 dbSNP
rs74868038 4152 dbSNP
rs935722770 4162 dbSNP
rs1156519711 4165 dbSNP
rs1455302654 4167 dbSNP
rs997004113 4168 dbSNP
rs1192754123 4174 dbSNP
rs1487479104 4183 dbSNP
rs1243739493 4188 dbSNP
rs1218050183 4189 dbSNP
rs142593708 4202 dbSNP
rs989875499 4203 dbSNP
rs1283639781 4208 dbSNP
rs1214767786 4212 dbSNP
rs1286092390 4216 dbSNP
rs1319702035 4224 dbSNP
rs1220822250 4227 dbSNP
rs1265941200 4237 dbSNP
rs1490873658 4240 dbSNP
rs750835574 4247 dbSNP
rs1366116089 4249 dbSNP
rs61817906 4252 dbSNP
rs946222540 4253 dbSNP
rs773444900 4255 dbSNP
rs369990961 4257 dbSNP
rs1473042668 4258 dbSNP
rs1344161421 4270 dbSNP
rs1051735635 4273 dbSNP
rs1179163088 4274 dbSNP
rs182636292 4286 dbSNP
rs1431170717 4289 dbSNP
rs1216799 4291 dbSNP
rs920612641 4295 dbSNP
rs942949381 4304 dbSNP
rs1056288799 4306 dbSNP
rs1039694280 4312 dbSNP
rs949960648 4313 dbSNP
rs1305655591 4319 dbSNP
rs1209887159 4322 dbSNP
rs1369329091 4331 dbSNP
rs1442574430 4335 dbSNP
rs529338409 4341 dbSNP
rs1215738757 4357 dbSNP
rs1280916075 4358 dbSNP
rs1045611990 4363 dbSNP
rs1376769551 4366 dbSNP
rs1227505293 4373 dbSNP
rs1315430117 4377 dbSNP
rs543021102 4380 dbSNP
rs898512896 4388 dbSNP
rs903081593 4393 dbSNP
rs1202849772 4398 dbSNP
rs1464207782 4404 dbSNP
rs998748579 4408 dbSNP
rs995568786 4412 dbSNP
rs1170868223 4413 dbSNP
rs1025716979 4414 dbSNP
rs1409322100 4426 dbSNP
rs568399135 4427 dbSNP
rs892802148 4430 dbSNP
rs536627333 4433 dbSNP
rs1163372931 4434 dbSNP
rs1024560035 4445 dbSNP
rs1482396711 4456 dbSNP
rs1235019372 4466 dbSNP
rs953554501 4474 dbSNP
rs1472568832 4476 dbSNP
rs1182827434 4478 dbSNP
rs528560240 4484 dbSNP
rs551559936 4485 dbSNP
rs1334968039 4493 dbSNP
rs1311390018 4495 dbSNP
rs187763442 4496 dbSNP
rs1393989234 4517 dbSNP
rs962263850 4523 dbSNP
rs1298540403 4529 dbSNP
rs1441162437 4546 dbSNP
rs1033951235 4552 dbSNP
rs778642411 4554 dbSNP
rs1410021011 4555 dbSNP
rs1461867341 4557 dbSNP
rs1027620996 4563 dbSNP
rs1330525298 4567 dbSNP
rs530725144 4571 dbSNP
rs548340846 4575 dbSNP
rs1252841927 4582 dbSNP
rs758208654 4585 dbSNP
rs1457557511 4590 dbSNP
rs912972633 4595 dbSNP
rs1236702324 4602 dbSNP
rs1337147767 4609 dbSNP
rs991585174 4620 dbSNP
rs1264369600 4623 dbSNP
rs780323463 4637 dbSNP
rs550639093 4654 dbSNP
rs950152934 4656 dbSNP
rs746983194 4672 dbSNP
rs1296751830 4673 dbSNP
rs1238948420 4685 dbSNP
rs1327665223 4692 dbSNP
rs1441620532 4695 dbSNP
rs1340197869 4698 dbSNP
rs1293019345 4718 dbSNP
rs1456420162 4723 dbSNP
rs981218232 4743 dbSNP
rs1160165514 4750 dbSNP
rs1276529072 4754 dbSNP
rs1378920987 4756 dbSNP
rs1442076339 4761 dbSNP
rs924452034 4762 dbSNP
rs934545192 4765 dbSNP
rs1267228196 4766 dbSNP
rs1054334742 4769 dbSNP
rs1486591054 4769 dbSNP
rs1260771738 4772 dbSNP
rs1215528996 4777 dbSNP
rs1351034328 4778 dbSNP
rs1305374206 4789 dbSNP
rs986948161 4794 dbSNP
rs912730246 4795 dbSNP
rs932333121 4798 dbSNP
rs1383824879 4800 dbSNP
rs1387282858 4813 dbSNP
rs1298874980 4821 dbSNP
rs1419348294 4826 dbSNP
rs1358790137 4832 dbSNP
rs1463815575 4841 dbSNP
rs567203742 4845 dbSNP
rs1454944780 4848 dbSNP
rs1049477908 4856 dbSNP
rs1374111792 4857 dbSNP
rs890840277 4858 dbSNP
rs1261891591 4864 dbSNP
rs1192230019 4874 dbSNP
rs1487106507 4876 dbSNP
rs1169170037 4877 dbSNP
rs1211358427 4879 dbSNP
rs1007997838 4884 dbSNP
rs747082335 4888 dbSNP
rs1253990553 4897 dbSNP
rs942902826 4899 dbSNP
rs769900622 4900 dbSNP
rs535869136 4901 dbSNP
rs898002385 4914 dbSNP
rs1176689035 4916 dbSNP
rs1408086519 4926 dbSNP
rs773475465 4934 dbSNP
rs552517852 4942 dbSNP
rs1326977610 4943 dbSNP
rs1028360005 4948 dbSNP
rs147611947 4949 dbSNP
rs1171173713 4952 dbSNP
rs1463990609 4956 dbSNP
rs1374071247 4958 dbSNP
rs1273159886 4959 dbSNP
rs1047129739 4960 dbSNP
rs538308926 4961 dbSNP
rs558617146 4966 dbSNP
rs1441477437 4968 dbSNP
rs1253883708 4975 dbSNP
rs578139004 4977 dbSNP
rs981501448 4978 dbSNP
rs543979968 4979 dbSNP
rs1257293073 4984 dbSNP
rs1327581432 4986 dbSNP
rs1014093276 4987 dbSNP
rs557713868 4991 dbSNP
rs574358459 4994 dbSNP
rs1449236069 5008 dbSNP
rs142312298 5009 dbSNP
rs1401688762 5019 dbSNP
rs1331316385 5024 dbSNP
rs1216800 5030 dbSNP
rs890796910 5039 dbSNP
rs767837946 5049 dbSNP
rs943733500 5054 dbSNP
rs1036814741 5056 dbSNP
rs775057974 5060 dbSNP
rs1491338668 5061 dbSNP
rs1183754477 5064 dbSNP
rs1355476364 5065 dbSNP
rs897991008 5066 dbSNP
rs1215101402 5069 dbSNP
rs1196745018 5070 dbSNP
rs1274841980 5071 dbSNP
rs1469755179 5071 dbSNP
rs957318426 5072 dbSNP
rs776052730 5073 dbSNP
rs1355950456 5074 dbSNP
rs566949043 5081 dbSNP
rs12732564 5082 dbSNP
rs545216788 5083 dbSNP
rs369851810 5084 dbSNP
rs565366781 5086 dbSNP
rs753381976 5088 dbSNP
rs1397248532 5092 dbSNP
rs1323685474 5103 dbSNP
rs912708003 5104 dbSNP
rs1387927895 5111 dbSNP
rs756858303 5127 dbSNP
rs888005402 5143 dbSNP
rs1439918649 5147 dbSNP
rs1013172406 5150 dbSNP
rs1321495146 5158 dbSNP
rs1176484996 5159 dbSNP
rs530649724 5160 dbSNP
rs1247172986 5169 dbSNP
rs1023354891 5174 dbSNP
rs971406381 5175 dbSNP
rs1002911141 5177 dbSNP
rs975609338 5178 dbSNP
rs1031740532 5187 dbSNP
rs1354664829 5188 dbSNP
rs1238339607 5191 dbSNP
rs1348892155 5191 dbSNP
rs1227958447 5192 dbSNP
rs1373862065 5196 dbSNP
rs920169520 5204 dbSNP
rs1353266234 5205 dbSNP
rs1272724270 5206 dbSNP
rs1322144397 5207 dbSNP
rs1208837437 5208 dbSNP
rs1195858597 5209 dbSNP
rs1270538590 5209 dbSNP
rs1285523259 5209 dbSNP
rs1476995811 5209 dbSNP
rs1488740694 5209 dbSNP
rs1491031281 5209 dbSNP
rs34766169 5209 dbSNP
rs555569515 5209 dbSNP
rs1208627822 5210 dbSNP
rs1289749635 5215 dbSNP
rs1490644221 5217 dbSNP
rs1350556745 5218 dbSNP
rs931594751 5220 dbSNP
rs955860824 5220 dbSNP
rs1271436638 5221 dbSNP
rs1047021787 5223 dbSNP
rs1270341658 5224 dbSNP
rs1339469345 5224 dbSNP
rs1296015570 5225 dbSNP
rs1416207915 5225 dbSNP
rs1471408202 5226 dbSNP
rs908547794 5226 dbSNP
rs914429634 5227 dbSNP
rs57453736 5228 dbSNP
rs868034823 5228 dbSNP
rs1180640833 5229 dbSNP
rs954056939 5231 dbSNP
rs113139448 5232 dbSNP
rs1238425482 5240 dbSNP
rs905304028 5241 dbSNP
rs1209776066 5246 dbSNP
rs1310990618 5249 dbSNP
rs1001314441 5252 dbSNP
rs1219756121 5256 dbSNP
rs1471028553 5270 dbSNP
rs1161435182 5273 dbSNP
rs1234808726 5274 dbSNP
rs145222201 5283 dbSNP
rs1302048454 5287 dbSNP
rs1445485858 5287 dbSNP
rs1036762426 5291 dbSNP
rs918367239 5296 dbSNP
rs1465039620 5297 dbSNP
rs893015707 5301 dbSNP
rs931098310 5303 dbSNP
rs1425786819 5324 dbSNP
rs1049657902 5329 dbSNP
rs1181663482 5339 dbSNP
rs1305049841 5347 dbSNP
rs1482508846 5348 dbSNP
rs1240378734 5352 dbSNP
rs1199899103 5356 dbSNP
rs1011455986 5360 dbSNP
rs1409501516 5373 dbSNP
rs887962276 5381 dbSNP
rs1321979338 5390 dbSNP
rs541043216 5396 dbSNP
rs1311504001 5403 dbSNP
rs373055636 5407 dbSNP
rs967468280 5409 dbSNP
rs1309702748 5413 dbSNP
rs868542221 5417 dbSNP
rs546193040 5419 dbSNP
rs748662952 5424 dbSNP
rs1011662449 5431 dbSNP
rs1179584867 5431 dbSNP
rs35009982 5431 dbSNP
rs72143008 5431 dbSNP
rs753415234 5431 dbSNP
rs762573575 5431 dbSNP
rs956099716 5431 dbSNP
rs1283921977 5447 dbSNP
rs200419678 5449 dbSNP
rs11102589 5450 dbSNP
rs953935040 5450 dbSNP
rs1019771925 5451 dbSNP
rs538619199 5453 dbSNP
rs191297203 5469 dbSNP
rs1293399919 5476 dbSNP
rs1481779971 5493 dbSNP
rs149162600 5494 dbSNP
rs1250755883 5495 dbSNP
rs758204821 5509 dbSNP
rs1374602000 5512 dbSNP
rs1303384618 5518 dbSNP
rs145134551 5522 dbSNP
rs1185174185 5524 dbSNP
rs76408741 5525 dbSNP
rs1456595384 5526 dbSNP
rs1362615246 5537 dbSNP
rs1445175306 5538 dbSNP
rs76367274 5542 dbSNP
rs1378827232 5543 dbSNP
rs1388450070 5544 dbSNP
rs1434247150 5551 dbSNP
rs866306832 5560 dbSNP
rs983455171 5566 dbSNP
rs1489085141 5567 dbSNP
rs182621224 5568 dbSNP
rs1215414525 5571 dbSNP
rs948938301 5578 dbSNP
rs187654598 5589 dbSNP
rs907436943 5591 dbSNP
rs1311475078 5596 dbSNP
rs1300679664 5598 dbSNP
rs1403133328 5599 dbSNP
rs949399802 5610 dbSNP
rs1342632446 5616 dbSNP
rs982168496 5617 dbSNP
rs1399628453 5623 dbSNP
rs1333927180 5625 dbSNP
rs1174623303 5626 dbSNP
rs558681666 5630 dbSNP
rs1467012217 5640 dbSNP
rs573192902 5641 dbSNP
rs1478546088 5647 dbSNP
rs1263240846 5650 dbSNP
rs926707567 5652 dbSNP
rs1248876616 5654 dbSNP
rs1487095240 5662 dbSNP
rs755006045 5673 dbSNP
rs545367276 5678 dbSNP
rs1055519052 5683 dbSNP
rs1482901944 5685 dbSNP
rs1226101869 5687 dbSNP
rs1251336794 5697 dbSNP
rs1220364587 5702 dbSNP
rs1481420622 5708 dbSNP
rs1278910571 5709 dbSNP
rs1218269715 5712 dbSNP
rs892986360 5722 dbSNP
rs1198310384 5725 dbSNP
rs1242356189 5727 dbSNP
rs1461583471 5728 dbSNP
rs1185385050 5729 dbSNP
rs1246147597 5730 dbSNP
rs1427796854 5733 dbSNP
rs1171237704 5734 dbSNP
rs1374796756 5735 dbSNP
rs947302101 5738 dbSNP
rs1336596507 5741 dbSNP
rs1053008684 5743 dbSNP
rs1401917289 5749 dbSNP
rs1464791369 5751 dbSNP
rs1175958915 5752 dbSNP
rs1335370781 5759 dbSNP
rs1407362699 5761 dbSNP
rs370725190 5765 dbSNP
rs1169270324 5774 dbSNP
rs1476638250 5776 dbSNP
rs1318909217 5782 dbSNP
rs1012066797 5787 dbSNP
rs903130944 5788 dbSNP
rs1253778884 5797 dbSNP
rs1458116002 5798 dbSNP
rs368293327 5798 dbSNP
rs889596768 5815 dbSNP
rs1198049808 5817 dbSNP
rs1383214098 5823 dbSNP
rs1008302369 5824 dbSNP
rs1019469820 5828 dbSNP
rs575661012 5843 dbSNP
rs1340317754 5847 dbSNP
rs1313352739 5857 dbSNP
rs899546130 5858 dbSNP
rs965251239 5865 dbSNP
rs749400821 5870 dbSNP
rs1230664179 5871 dbSNP
rs1392227513 5875 dbSNP
rs1027130135 5879 dbSNP
rs117967569 5885 dbSNP
rs1383173921 5890 dbSNP
rs1440276792 5905 dbSNP
rs1237445825 5906 dbSNP
rs1323750835 5907 dbSNP
rs1025309130 5909 dbSNP
rs1265943374 5914 dbSNP
rs1292113020 5917 dbSNP
rs982997363 5919 dbSNP
rs1016252028 5920 dbSNP
rs971042403 5927 dbSNP
rs1290049373 5928 dbSNP
rs1242719245 5931 dbSNP
rs1378316650 5932 dbSNP
rs1485505102 5938 dbSNP
rs952453494 5944 dbSNP
rs771213370 5946 dbSNP
rs1323581265 5947 dbSNP
rs916361378 5950 dbSNP
rs1431488198 5952 dbSNP
rs926634020 5953 dbSNP
rs1310486230 5955 dbSNP
rs560703912 5956 dbSNP
rs1156814269 5971 dbSNP
rs1478961873 5974 dbSNP
rs4839289 5977 dbSNP
rs915351334 5985 dbSNP
rs1199586573 5992 dbSNP
rs928809264 5994 dbSNP
rs947197634 6009 dbSNP
rs1471051924 6013 dbSNP
rs1266978962 6015 dbSNP
rs1219040574 6017 dbSNP
rs1354914235 6025 dbSNP
rs1157400279 6028 dbSNP
rs1285745334 6030 dbSNP
rs1041586840 6034 dbSNP
rs1222617961 6037 dbSNP
rs1347676251 6043 dbSNP
rs34731751 6053 dbSNP
rs903098481 6061 dbSNP
rs1053334532 6073 dbSNP
rs1291116867 6075 dbSNP
rs1343077327 6076 dbSNP
rs1363522652 6078 dbSNP
rs891787799 6079 dbSNP
rs947431986 6081 dbSNP
rs943973790 6082 dbSNP
rs746135500 6083 dbSNP
rs192143439 6095 dbSNP
rs1425737341 6097 dbSNP
rs114211716 6098 dbSNP
rs899515139 6104 dbSNP
rs7548091 6105 dbSNP
rs1019425792 6114 dbSNP
rs1224909493 6117 dbSNP
rs775761090 6119 dbSNP
rs1488731006 6121 dbSNP
rs994084796 6125 dbSNP
rs538113485 6131 dbSNP
rs952469429 6134 dbSNP
rs1216459703 6136 dbSNP
rs1280016703 6143 dbSNP
rs1262397938 6148 dbSNP
rs1320882392 6159 dbSNP
rs983776999 6174 dbSNP
rs36107734 6179 dbSNP
rs1221880047 6182 dbSNP
rs1218878978 6185 dbSNP
rs769175793 6192 dbSNP
rs1286930783 6195 dbSNP
rs969124431 6200 dbSNP
rs1015765363 6214 dbSNP
rs1359502732 6222 dbSNP
rs981832534 6223 dbSNP
rs1481547756 6235 dbSNP
rs776064540 6238 dbSNP
rs1404072255 6242 dbSNP
rs1180266858 6252 dbSNP
rs1172833900 6261 dbSNP
rs1407793785 6270 dbSNP
rs1420031276 6271 dbSNP
rs1419014298 6274 dbSNP
rs552121236 6301 dbSNP
rs1184978624 6313 dbSNP
rs1474001428 6315 dbSNP
rs971353472 6316 dbSNP
rs1238410698 6318 dbSNP
rs1203653165 6326 dbSNP
rs761314018 6334 dbSNP
rs1227329693 6342 dbSNP
rs568873939 6350 dbSNP
rs556422779 6353 dbSNP
rs537903339 6355 dbSNP
rs989470296 6360 dbSNP
rs1348681983 6366 dbSNP
rs1198677358 6374 dbSNP
rs1306582169 6384 dbSNP
rs551197731 6391 dbSNP
rs1229645726 6395 dbSNP
rs1302004407 6397 dbSNP
rs567902403 6401 dbSNP
rs1283366891 6407 dbSNP
rs1450371660 6408 dbSNP
rs536829104 6410 dbSNP
rs1333472519 6415 dbSNP
rs989001793 6421 dbSNP
rs1365646348 6425 dbSNP
rs1406463643 6427 dbSNP
rs1353980430 6428 dbSNP
rs1168690175 6441 dbSNP
rs913511310 6444 dbSNP
rs966860853 6452 dbSNP
rs947639157 6453 dbSNP
rs1277378694 6459 dbSNP
rs1043037481 6460 dbSNP
rs1183302865 6485 dbSNP
rs1443357317 6496 dbSNP
rs1372411495 6500 dbSNP
rs1179785189 6504 dbSNP
rs977621204 6508 dbSNP
rs575055532 6519 dbSNP
rs1223388158 6522 dbSNP
rs1321884973 6524 dbSNP
rs942755728 6531 dbSNP
rs1041192518 6532 dbSNP
rs1308825069 6539 dbSNP
rs900991265 6544 dbSNP
rs1309938568 6554 dbSNP
rs1445949188 6566 dbSNP
rs1372774455 6574 dbSNP
rs1245080491 6583 dbSNP
rs924479533 6585 dbSNP
rs1438888312 6587 dbSNP
rs1350649101 6590 dbSNP
rs1350241427 6591 dbSNP
rs943927049 6594 dbSNP
rs1423181986 6595 dbSNP
rs1382518229 6601 dbSNP
rs1292665131 6605 dbSNP
rs994030514 6607 dbSNP
rs1203347632 6608 dbSNP
rs1247818494 6616 dbSNP
rs1192360119 6623 dbSNP
rs1488617096 6624 dbSNP
rs1047351048 6639 dbSNP
rs1219761395 6652 dbSNP
rs1040963138 6654 dbSNP
rs921209847 6656 dbSNP
rs1481061123 6666 dbSNP
rs1355672215 6669 dbSNP
rs1179326943 6676 dbSNP
rs1238263933 6681 dbSNP
rs1314990483 6682 dbSNP
rs888347411 6683 dbSNP
rs1005885018 6692 dbSNP
rs1346202579 6698 dbSNP
rs142283779 6699 dbSNP
rs750072864 6706 dbSNP
rs762557909 6710 dbSNP
rs573458770 6711 dbSNP
rs1164768467 6712 dbSNP
rs1362523452 6715 dbSNP
rs1385360798 6720 dbSNP
rs1425979976 6730 dbSNP
rs1326225160 6735 dbSNP
rs1433307214 6735 dbSNP
rs538674745 6752 dbSNP
rs1353591485 6754 dbSNP
rs1489036188 6754 dbSNP
rs1442397126 6756 dbSNP
rs888153700 6759 dbSNP
rs1299678546 6763 dbSNP
rs1003244666 6777 dbSNP
rs1484867471 6783 dbSNP
rs1380285928 6784 dbSNP
rs1245235762 6791 dbSNP
rs1003974191 6800 dbSNP
rs1037578149 6801 dbSNP
rs906720374 6802 dbSNP
rs1221923461 6803 dbSNP
rs1315602755 6804 dbSNP
rs1296778502 6818 dbSNP
rs1361449543 6824 dbSNP
rs1382064563 6829 dbSNP
rs1383223879 6831 dbSNP
rs115020498 6832 dbSNP
rs1470581720 6835 dbSNP
rs1272299584 6840 dbSNP
rs1404745001 6852 dbSNP
rs575653740 6859 dbSNP
rs1033880884 6862 dbSNP
rs11446387 6865 dbSNP
rs141604285 6866 dbSNP
rs66951963 6866 dbSNP
rs140112826 6867 dbSNP
rs959651308 6874 dbSNP
rs1258002419 6875 dbSNP
rs1201019958 6879 dbSNP
rs1461124308 6881 dbSNP
rs138539097 6882 dbSNP
rs1201807587 6884 dbSNP
rs1320296119 6893 dbSNP
rs1271033785 6894 dbSNP
rs1245537213 6911 dbSNP
rs769637166 6916 dbSNP
rs141127480 6917 dbSNP
rs967165854 6927 dbSNP
rs1334150422 6929 dbSNP
rs978217053 6934 dbSNP
rs911984610 6942 dbSNP
rs766166313 6945 dbSNP
rs1396548506 6949 dbSNP
rs150748257 6952 dbSNP
rs976613969 6956 dbSNP
rs1369991479 6970 dbSNP
rs559933601 6975 dbSNP
rs922652822 6977 dbSNP
rs560208600 6979 dbSNP
rs139114229 6980 dbSNP
rs1046856216 6981 dbSNP
rs551893147 6988 dbSNP
rs1273788905 6990 dbSNP
rs888284326 6994 dbSNP
rs149482694 6995 dbSNP
rs572066422 6996 dbSNP
rs1247115332 6999 dbSNP
rs1359149645 7001 dbSNP
rs904849626 7010 dbSNP
rs1036764793 7022 dbSNP
rs1335888968 7023 dbSNP
rs906305089 7025 dbSNP
rs375643505 7027 dbSNP
rs561250808 7027 dbSNP
rs1003660572 7028 dbSNP
rs1216588798 7030 dbSNP
rs752750442 7034 dbSNP
rs1423821961 7035 dbSNP
rs895365084 7050 dbSNP
rs1009731661 7053 dbSNP
rs531204660 7070 dbSNP
rs1265312927 7102 dbSNP
rs1445786501 7105 dbSNP
rs1193081888 7110 dbSNP
rs1011122668 7113 dbSNP
rs1475394237 7127 dbSNP
rs969333726 7137 dbSNP
rs1269800959 7138 dbSNP
rs1475436279 7149 dbSNP
rs1187945506 7153 dbSNP
rs1223468806 7155 dbSNP
rs548344171 7156 dbSNP
rs1490306994 7157 dbSNP
rs1290025003 7158 dbSNP
rs568141690 7161 dbSNP
rs1242963481 7170 dbSNP
rs1194589496 7176 dbSNP
rs1022690769 7181 dbSNP
rs979021239 7184 dbSNP
rs1426812750 7199 dbSNP
rs911508356 7210 dbSNP
rs757400411 7224 dbSNP
rs536861970 7226 dbSNP
rs976726734 7232 dbSNP
rs778908796 7237 dbSNP
rs147199256 7248 dbSNP
rs1019018761 7253 dbSNP
rs1401252662 7255 dbSNP
rs567063476 7258 dbSNP
rs1156724101 7266 dbSNP
rs1468706999 7268 dbSNP
rs539274571 7269 dbSNP
rs909712967 7270 dbSNP
rs1490230040 7280 dbSNP
rs770700394 7293 dbSNP
rs1028167503 7295 dbSNP
rs774204667 7296 dbSNP
rs1267214894 7299 dbSNP
rs1327151812 7299 dbSNP
rs1448103225 7307 dbSNP
rs1284236139 7308 dbSNP
rs953914379 7313 dbSNP
rs1203867020 7322 dbSNP
rs182860786 7326 dbSNP
rs1283306520 7328 dbSNP
rs1281410177 7344 dbSNP
rs1345121777 7387 dbSNP
rs1224291649 7407 dbSNP
rs1222530837 7415 dbSNP
rs1343213040 7425 dbSNP
rs1279888381 7427 dbSNP
rs1044975664 7430 dbSNP
rs1285647237 7435 dbSNP
rs1344357074 7444 dbSNP
rs909813590 7457 dbSNP
rs939690515 7458 dbSNP
rs1416085835 7463 dbSNP
rs1205098586 7476 dbSNP
rs1177155462 7477 dbSNP
rs1285543401 7488 dbSNP
rs939287832 7488 dbSNP
rs1188480989 7489 dbSNP
rs1475968116 7494 dbSNP
rs569276030 7500 dbSNP
rs927734020 7507 dbSNP
rs1241879714 7514 dbSNP
rs1056016306 7519 dbSNP
rs1462994645 7522 dbSNP
rs188809024 7525 dbSNP
rs1202435037 7548 dbSNP
rs1320775634 7556 dbSNP
rs1009318621 7557 dbSNP
rs1055189175 7559 dbSNP
rs895334029 7561 dbSNP
rs946948431 7573 dbSNP
rs1022489761 7574 dbSNP
rs554670577 7577 dbSNP
rs1383382422 7579 dbSNP
rs746072361 7580 dbSNP
rs902796390 7586 dbSNP
rs1199694274 7601 dbSNP
rs574562897 7623 dbSNP
rs115202314 7624 dbSNP
rs1157733147 7626 dbSNP
rs1172891158 7627 dbSNP
rs1019365342 7628 dbSNP
rs901892982 7642 dbSNP
rs1402306325 7644 dbSNP
rs996274811 7646 dbSNP
rs1185103790 7652 dbSNP
rs1028136465 7654 dbSNP
rs1244350828 7676 dbSNP
rs113437985 7678 dbSNP
rs754697902 7685 dbSNP
rs1459646460 7695 dbSNP
rs953840510 7696 dbSNP
rs984390212 7698 dbSNP
rs1234105629 7700 dbSNP
rs1405848113 7700 dbSNP
rs1306487410 7701 dbSNP
rs113868220 7702 dbSNP
rs1165439396 7702 dbSNP
rs1177233801 7702 dbSNP
rs1224211665 7702 dbSNP
rs1230868788 7702 dbSNP
rs1270657795 7702 dbSNP
rs1354108745 7702 dbSNP
rs1386250124 7702 dbSNP
rs1409531412 7702 dbSNP
rs1443256328 7702 dbSNP
rs1480117790 7702 dbSNP
rs56809946 7702 dbSNP
rs60598615 7702 dbSNP
rs71087156 7702 dbSNP
rs71809486 7702 dbSNP
rs767469924 7702 dbSNP
rs773742058 7702 dbSNP
rs767625751 7703 dbSNP
rs1490471182 7704 dbSNP
rs753900357 7705 dbSNP
rs1290743156 7712 dbSNP
rs375900922 7714 dbSNP
rs1238803889 7718 dbSNP
rs1280440469 7723 dbSNP
rs1318611095 7729 dbSNP
rs1309270886 7730 dbSNP
rs145371924 7734 dbSNP
rs1224455851 7736 dbSNP
rs760437278 7739 dbSNP