miRTarBase - #MIRT502151 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIF5B   
Synonyms HEL-S-61, KINH, KNS, KNS1, UKHC
Description kinesin family member 5B
Transcript NM_004521   
Expression
Putative miRNA Targets on KIF5B
3'UTR of KIF5B
(miRNA target sites are highlighted)
>KIF5B|NM_004521|3'UTR
   1 TCGTTTATACATACCCACAGGTGTTAAAAAGTAATCGAAGTACGAAGAGGACATGGTATCAAGCAGTCATTCAATGACTA
  81 TAACCTCTACTCCCTTGGGATTGTAGAATTATAACTTTTAAAAAAAATGTATAAATTATACCTGGCCTGTACAGCTGTTT
 161 CCTACCTACTCTTCTTGTAAACTCTGCTGCTTCCCAACACAACTAGAGTGCAATTTTGGCATCTTAGGAGGGAAAAAGGA
 241 CAGTTTACAACTGTGGCCCTATTTATTACACAGTTTGTCTATCGTGTCTTAAATTTAGTCTTTACTGTGCCAAGCTAACT
 321 GTACCTTATAGGACTGTACTTTTTGTATTTTTTGTGTATGTTTATTTTTTAATCTCAGTTTAAATTACCTAGCTGCTACT
 401 GCTTCTTGTTTTTCTTTTCCTATTAAAACGTCTTCCTTTTTTTTTCTTAAGAGAAAATGGAACATTTAGGTTAAATGTCT
 481 TTAAATTTTACCACTTAACAACACTACATGCCCATAAAATATATCCAGTCAGTACTGTATTTTAAAATCCCTTGAAATGA
 561 TGATATCAGGGTTAAAATTACTTGTATTGTTTCTGAAGTTTGCTCCTGAAAACTACTGTTTGAGCACTGAAACGTTACAA
 641 ATGCCTAATAGGCATTTGAGACTGAGCAAGGCTACTTGTTATCTCATGAAATGCCTGTTGCCGAGTTATTTTGAATAGAA
 721 ATATTTTAAAGTATCAAAAGCAGATCTTAGTTTAAGGGAGTTTGGAAAAGGAATTATATTTCTCTTTTTCCTGATTCTGT
 801 ACTCAACAAGTCTTGATGGAATTAAAATACTCTGCTTTATTCTGGTGAGCCTGCTAGCTAATATAAGTATTGGACAGGTA
 881 ATAATTTGTCATCTTTAATATTAGTAAAATGAATTAAGATATTATAGGATTAAACATAATTTTATACGGTTAGTACTTTA
 961 TTGGCCGACCTAAATTTATAGCGTGTGGAAATTGAGAAAAATGAAGAAACAGGACAGATATATGATGAATTAAAAATATA
1041 TATAGGTCAATTTTGGTCTGAAATCCCTGAGGTGTTTTTAACCTGCTACACTAATTTGTACACTAATTTATTTCTTTAGT
1121 CTAGAAATAGTAAATTGTTTGCAAGTCACTAATAATCATTAGATAAATTATTTTCTTGGCCATAGCCGATAATTTTGTAA
1201 TCAGTACTAAGTGTATACGTATTTTTGCCACTTTTTCCTCAGATGATTAAAGTAAGTCAACAGCTTATTTTAGGAAACTG
1281 TAAAAGTAATAGGGAAAGAGATTTCACTATTTGCTTCATCAGTGGTAGGGGGGCGGTGACTGCAACTGTGTTAGCAGAAA
1361 TTCACAGAGAATGGGGATTTAAGGTTAGCAGAGAAACTTGGAAAGTTCTGTGTTAGGATCTTGCTGGCAGAATTAACTTT
1441 TTGCAAAAGTTTTATACACAGATATTTGTATTAAATTTGGAGCCATAGTCAGAAGACTCAGATCATAATTGGCTTATTTT
1521 TCTATTTCCGTAACTATTGTAATTTCCACTTTTGTAATAATTTTGATTTAAAATATAAATTTATTTATTTATTTTTTTAA
1601 TAGTCAAAAATCTTTGCTGTTGTAGTCTGCAACCTCTAAAATGATTGTGTTGCTTTTAGGATTGATCAGAAGAAACACTC
1681 CAAAAATTGAGATGAAATGTTGGTGCAGCCAGTTATAAGTAATATAGTTAACAAGCAAAAAAAGTGCTGCCACCTTTTAT
1761 GATGATTTTCTAAATGGAGAAACATTTGGCTGCATCCACATAGACCTTTATGTTTTGTTTTCAGTTGAAAACTTGCCTCC
1841 TTTGGCAACATTCGTAAATGAAGCAGAATTTTTTTTTCTCTTTTTTCCAAATATGTTAGTTTTGTTCTTGTAAGATGTAT
1921 CATGGGTATTGGTGCTGTGTAATGAACAACGAATTTTAATTAGCATGTGGTTCAGAATATACAATGTTAGGTTTTTAAAA
2001 AGTATCTTGATGGTTCTTTTCTATTTATAATTTCAGACTTTCATAAAGTGTACCAAGAATTTCATAAATTTGTTTTCAGT
2081 GAACTGCTTTTTGCTATGGTAGGTCATTAAACACAGCACTTACTCTTAAAAATGAAAATTTCTGATCATCTAGGATATTG
2161 ACACATTTCAATTTGCAGTGTCTTTTTGACTGGATATATTAACGTTCCTCTGAATGGCATTGATAGATGGTTCAGAAGAG
2241 AAACTCAATGAAATAAAGAGAATATTTATTCATGGCGATTAATTAAATTATTTGCCTAACTTAAGAAAACTACTGTGCGT
2321 AACTCTCAGTTTGTGCTTAACTCCATTTGACATGAGGTGACAGAAGAGAGTCTGAGTCTACCTGTGGAATATGTTGGTTT
2401 ATTTTCAGTGCTTGAAGATACATTCACAAATACTTGGTTTGGGAAGACACCGTTTAATTTTAAGTTAACTTGCATGTTGT
2481 AAATGCGTTTTATGTTTAAATAAAGAGGAAAATTTTTTGAAATGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||||     | ||||||| 
Target 5' tgTAAAC-----TCTGCTGCTt 3'
176 - 192 147.00 -9.80
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             |||: ||  ||||:|||| 
Target 5' ctaAAATGAT--TGTGTTGCTt 3'
1636 - 1655 147.00 -12.10
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||  | | | |||||:| 
Target 5' gtCAAA--AATCTTTGCTGTTg 3'
1603 - 1622 140.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN1118096 6 COSMIC
COSN1118095 34 COSMIC
COSN30608556 117 COSMIC
COSN17284268 128 COSMIC
COSN16397923 133 COSMIC
COSN30658437 175 COSMIC
COSN1486057 187 COSMIC
COSN5284583 279 COSMIC
COSN9204925 421 COSMIC
COSN23365921 959 COSMIC
COSN29112439 978 COSMIC
COSN29490360 1061 COSMIC
COSN25796285 1097 COSMIC
COSN9204924 1910 COSMIC
COSN20777549 1986 COSMIC
COSN9204923 2201 COSMIC
COSN6966993 2359 COSMIC
COSN1486056 2532 COSMIC
COSN27239469 2610 COSMIC
COSN22977765 3317 COSMIC
COSN29008020 3589 COSMIC
COSN19460684 3987 COSMIC
COSN31529321 4028 COSMIC
COSN31551477 4035 COSMIC
COSN20107023 4042 COSMIC
COSN24953997 4042 COSMIC
COSN30540906 4092 COSMIC
COSN22247236 4112 COSMIC
COSN31551342 4149 COSMIC
COSN26640959 4313 COSMIC
COSN29686989 4428 COSMIC
COSN16492367 4632 COSMIC
COSN6068846 4695 COSMIC
COSN25694495 4824 COSMIC
COSN29211536 5192 COSMIC
COSN15359415 6060 COSMIC
COSN25192455 6204 COSMIC
COSN17613700 6242 COSMIC
COSN17612504 6278 COSMIC
COSN10066087 6442 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1174397943 2 dbSNP
rs749267836 2 dbSNP
rs1352651361 3 dbSNP
rs201874978 5 dbSNP
rs755872429 7 dbSNP
rs1342732794 10 dbSNP
rs1331618966 15 dbSNP
rs1350029091 16 dbSNP
rs11539713 17 dbSNP
rs752049537 17 dbSNP
rs1406871986 19 dbSNP
rs1358679591 29 dbSNP
rs1233254639 36 dbSNP
rs754715270 36 dbSNP
rs1401501412 46 dbSNP
rs751006235 49 dbSNP
rs1231925652 53 dbSNP
rs1330643753 69 dbSNP
rs1204156125 78 dbSNP
rs756563235 87 dbSNP
rs1286349070 92 dbSNP
rs1465905796 98 dbSNP
rs1279582083 100 dbSNP
rs569386112 103 dbSNP
rs551287583 105 dbSNP
rs1197053008 109 dbSNP
rs1268016286 114 dbSNP
rs923427440 115 dbSNP
rs541699828 116 dbSNP
rs1333593517 117 dbSNP
rs1469725134 118 dbSNP
rs1325360088 125 dbSNP
rs1159341606 130 dbSNP
rs1441350403 137 dbSNP
rs1362712725 138 dbSNP
rs757449614 139 dbSNP
rs1423085379 143 dbSNP
rs956451157 148 dbSNP
rs1389020440 155 dbSNP
rs1055055936 157 dbSNP
rs1333455669 159 dbSNP
rs1237734135 164 dbSNP
rs937804168 172 dbSNP
rs1376100876 176 dbSNP
rs1219908565 181 dbSNP
rs188811574 183 dbSNP
rs1410289250 185 dbSNP
rs768173987 190 dbSNP
rs1000501651 192 dbSNP
rs1248390419 194 dbSNP
rs1418525325 198 dbSNP
rs182913371 205 dbSNP
rs1443022785 209 dbSNP
rs1469876539 209 dbSNP
rs1013908930 211 dbSNP
rs1362261136 214 dbSNP
rs982264106 230 dbSNP
rs547028452 231 dbSNP
rs760729085 233 dbSNP
rs993616053 234 dbSNP
rs897879964 246 dbSNP
rs1212390160 252 dbSNP
rs1449212806 253 dbSNP
rs913553163 260 dbSNP
rs1222704134 267 dbSNP
rs1348173174 268 dbSNP
rs776043814 270 dbSNP
rs1037711072 272 dbSNP
rs989081757 273 dbSNP
rs1234487046 280 dbSNP
rs79897350 304 dbSNP
rs1257151085 327 dbSNP
rs1425881361 333 dbSNP
rs1168779639 339 dbSNP
rs1017776131 352 dbSNP
rs1437253071 365 dbSNP
rs1173531613 368 dbSNP
rs564629757 379 dbSNP
rs1007810079 380 dbSNP
rs1050726806 387 dbSNP
rs1379486747 389 dbSNP
rs933548886 393 dbSNP
rs1047255394 395 dbSNP
rs1201340716 395 dbSNP
rs1219165183 395 dbSNP
rs1293194925 395 dbSNP
rs1439063491 401 dbSNP
rs1203147210 402 dbSNP
rs1319127323 402 dbSNP
rs1185056730 407 dbSNP
rs1238198663 407 dbSNP
rs1484366206 407 dbSNP
rs1400202986 408 dbSNP
rs1261459185 417 dbSNP
rs1478373746 427 dbSNP
rs762454098 428 dbSNP
rs1175792799 429 dbSNP
rs1454835894 446 dbSNP
rs546012966 450 dbSNP
rs1192108407 451 dbSNP
rs1476713494 465 dbSNP
rs759987560 480 dbSNP
rs774609797 482 dbSNP
rs1467250116 484 dbSNP
rs1286826949 488 dbSNP
rs1339564269 490 dbSNP
rs533138442 492 dbSNP
rs562586098 493 dbSNP
rs993975564 498 dbSNP
rs572735912 501 dbSNP
rs956463554 504 dbSNP
rs1222916187 509 dbSNP
rs1281799230 509 dbSNP
rs1279403480 510 dbSNP
rs924992587 516 dbSNP
rs1213866041 519 dbSNP
rs1037804367 522 dbSNP
rs747769955 531 dbSNP
rs796554250 532 dbSNP
rs1267306868 542 dbSNP
rs1480405532 549 dbSNP
rs1192345852 550 dbSNP
rs1346679077 552 dbSNP
rs1425258383 554 dbSNP
rs1023704918 559 dbSNP
rs374898979 564 dbSNP
rs1013543063 571 dbSNP
rs544053385 575 dbSNP
rs960606419 576 dbSNP
rs1299819927 578 dbSNP
rs1216092466 581 dbSNP
rs1435665517 582 dbSNP
rs1025492765 584 dbSNP
rs1369786270 585 dbSNP
rs1222165225 587 dbSNP
rs1362322067 589 dbSNP
rs1354693151 590 dbSNP
rs1269520919 592 dbSNP
rs1055045067 593 dbSNP
rs1236256739 594 dbSNP
rs1343532402 597 dbSNP
rs1314805367 602 dbSNP
rs189921851 626 dbSNP
rs554907152 627 dbSNP
rs1489152060 635 dbSNP
rs1046252820 640 dbSNP
rs1172229227 641 dbSNP
rs945223441 646 dbSNP
rs1412013125 649 dbSNP
rs539864086 654 dbSNP
rs989196422 656 dbSNP
rs1383117022 661 dbSNP
rs957660499 669 dbSNP
rs75120270 678 dbSNP
rs1351582725 679 dbSNP
rs986780753 680 dbSNP
rs955011120 681 dbSNP
rs780192840 684 dbSNP
rs376882698 685 dbSNP
rs1485172372 689 dbSNP
rs1242583845 697 dbSNP
rs993652937 698 dbSNP
rs172432 699 dbSNP
rs1356065259 709 dbSNP
rs902069146 713 dbSNP
rs1016318079 715 dbSNP
rs1006348789 716 dbSNP
rs1206095587 717 dbSNP
rs1307887270 721 dbSNP
rs1237026873 723 dbSNP
rs1457852081 725 dbSNP
rs185552987 727 dbSNP
rs1240905810 730 dbSNP
rs894475168 736 dbSNP
rs578012513 738 dbSNP
rs757016339 742 dbSNP
rs1002514898 763 dbSNP
rs1449154403 764 dbSNP
rs906427613 787 dbSNP
rs1357252210 790 dbSNP
rs1340100670 792 dbSNP
rs1449136047 804 dbSNP
rs1295268808 825 dbSNP
rs557878889 827 dbSNP
rs1360397217 839 dbSNP
rs1046755706 845 dbSNP
rs1259322038 872 dbSNP
rs945193810 873 dbSNP
rs1317931925 876 dbSNP
rs960618022 880 dbSNP
rs1025546565 881 dbSNP
rs1311296523 882 dbSNP
rs867347081 882 dbSNP
rs1252518607 884 dbSNP
rs892300941 885 dbSNP
rs1355507848 889 dbSNP
rs1192829622 890 dbSNP
rs962566603 891 dbSNP
rs538211841 900 dbSNP
rs1174385963 905 dbSNP
rs1401659556 910 dbSNP
rs1053463289 914 dbSNP
rs936458690 917 dbSNP
rs569432575 930 dbSNP
rs985837153 932 dbSNP
rs932997931 935 dbSNP
rs1474595524 937 dbSNP
rs1254719695 948 dbSNP
rs1029000997 951 dbSNP
rs545182285 957 dbSNP
rs557593364 958 dbSNP
rs747073097 960 dbSNP
rs972729896 964 dbSNP
rs1478754676 968 dbSNP
rs1196750629 972 dbSNP
rs139058121 979 dbSNP
rs1478423237 980 dbSNP
rs1491432559 980 dbSNP
rs150457811 980 dbSNP
rs398114220 980 dbSNP
rs566275577 980 dbSNP
rs574554127 980 dbSNP
rs778857063 980 dbSNP
rs902121702 980 dbSNP
rs962203045 980 dbSNP
rs1491374774 981 dbSNP
rs1491287549 982 dbSNP
rs1329980645 984 dbSNP
rs1273755297 994 dbSNP
rs1016475561 997 dbSNP
rs1232537210 1003 dbSNP
rs1052607141 1013 dbSNP
rs1351060325 1035 dbSNP
rs1334302324 1042 dbSNP
rs1286464934 1045 dbSNP
rs935567590 1055 dbSNP
rs984862740 1063 dbSNP
rs1207963535 1075 dbSNP
rs958803953 1076 dbSNP
rs1393411326 1083 dbSNP
rs1044277119 1085 dbSNP
rs1034868176 1088 dbSNP
rs1378641231 1093 dbSNP
rs35139104 1093 dbSNP
rs112077505 1094 dbSNP
rs1159551778 1095 dbSNP
rs115455304 1098 dbSNP
rs991845372 1103 dbSNP
rs938971635 1104 dbSNP
rs1392119922 1107 dbSNP
rs1024852101 1108 dbSNP
rs1461332436 1109 dbSNP
rs1415087031 1110 dbSNP
rs972666773 1112 dbSNP
rs1419372045 1114 dbSNP
rs1406772297 1118 dbSNP
rs1355521643 1120 dbSNP
rs114582270 1121 dbSNP
rs1469656072 1123 dbSNP
rs1253352621 1124 dbSNP
rs1009476987 1125 dbSNP
rs1467070628 1126 dbSNP
rs1236432836 1127 dbSNP
rs1263802957 1127 dbSNP
rs1179472999 1128 dbSNP
rs1241272216 1128 dbSNP
rs546991645 1132 dbSNP
rs1164524434 1133 dbSNP
rs528468453 1137 dbSNP
rs1459893648 1142 dbSNP
rs936406257 1143 dbSNP
rs1397470690 1144 dbSNP
rs1464667554 1146 dbSNP
rs570794695 1147 dbSNP
rs114193047 1150 dbSNP
rs530910377 1151 dbSNP
rs932963816 1153 dbSNP
rs1246863757 1162 dbSNP
rs1389198971 1167 dbSNP
rs1317323159 1172 dbSNP
rs922968829 1173 dbSNP
rs972336090 1175 dbSNP
rs562661347 1179 dbSNP
rs966044993 1181 dbSNP
rs1181562422 1183 dbSNP
rs940952873 1184 dbSNP
rs999767620 1194 dbSNP
rs769527405 1197 dbSNP
rs984934765 1198 dbSNP
rs1156535995 1204 dbSNP
rs74333406 1208 dbSNP
rs1170785063 1217 dbSNP
rs1355830311 1220 dbSNP
rs1034403081 1223 dbSNP
rs1395511298 1224 dbSNP
rs180718644 1231 dbSNP
rs1402621999 1234 dbSNP
rs561625977 1239 dbSNP
rs971418200 1241 dbSNP
rs1020735740 1242 dbSNP
rs1219270056 1246 dbSNP
rs1280158353 1247 dbSNP
rs540170011 1254 dbSNP
rs939066528 1261 dbSNP
rs918293815 1265 dbSNP
rs956645334 1266 dbSNP
rs576436029 1272 dbSNP
rs1036688989 1275 dbSNP
rs1263021087 1278 dbSNP
rs1260164465 1279 dbSNP
rs557515431 1280 dbSNP
rs888950516 1281 dbSNP
rs1050181869 1286 dbSNP
rs545837103 1293 dbSNP
rs901497291 1297 dbSNP
rs1377875097 1307 dbSNP
rs868094025 1308 dbSNP
rs976177864 1312 dbSNP
rs940358938 1314 dbSNP
rs1383230328 1326 dbSNP
rs1030969379 1329 dbSNP
rs74129471 1330 dbSNP
rs1365516912 1336 dbSNP
rs376363207 1337 dbSNP
rs1218751916 1338 dbSNP
rs1302157823 1340 dbSNP
rs968349312 1349 dbSNP
rs1375677703 1369 dbSNP
rs1049351521 1370 dbSNP
rs1238317281 1371 dbSNP
rs1022942510 1375 dbSNP
rs752750246 1376 dbSNP
rs1012490121 1382 dbSNP
rs1374540342 1394 dbSNP
rs895329725 1403 dbSNP
rs1457832313 1406 dbSNP
rs1056641625 1424 dbSNP
rs557556725 1430 dbSNP
rs1156531594 1434 dbSNP
rs927491354 1443 dbSNP
rs1420102006 1451 dbSNP
rs78756330 1451 dbSNP
rs780396748 1457 dbSNP
rs1348052878 1459 dbSNP
rs1427825308 1469 dbSNP
rs971914628 1470 dbSNP
rs553690831 1480 dbSNP
rs189829781 1481 dbSNP
rs1261173277 1488 dbSNP
rs1191591525 1490 dbSNP
rs1444794707 1496 dbSNP
rs1036700405 1497 dbSNP
rs1400541216 1501 dbSNP
rs913213518 1503 dbSNP
rs988748693 1504 dbSNP
rs957380091 1507 dbSNP
rs570775326 1519 dbSNP
rs866044633 1524 dbSNP
rs211395 1536 dbSNP
rs1029271560 1537 dbSNP
rs1307395557 1540 dbSNP
rs997259436 1547 dbSNP
rs901568269 1553 dbSNP
rs1178737592 1561 dbSNP
rs1411422654 1561 dbSNP
rs1275835464 1566 dbSNP
rs752048622 1570 dbSNP
rs932566969 1571 dbSNP
rs1036128118 1572 dbSNP
rs1396764856 1573 dbSNP
rs1416081442 1580 dbSNP
rs1355480899 1583 dbSNP
rs1311923434 1601 dbSNP
rs1004519891 1607 dbSNP
rs1444744180 1608 dbSNP
rs887443578 1611 dbSNP
rs76670295 1614 dbSNP
rs1168247382 1619 dbSNP
rs937621232 1625 dbSNP
rs924004375 1630 dbSNP
rs927468969 1634 dbSNP
rs569836384 1635 dbSNP
rs968483127 1646 dbSNP
rs1457921094 1653 dbSNP
rs1022278889 1669 dbSNP
rs1235489436 1671 dbSNP
rs1182330898 1672 dbSNP
rs1421373804 1672 dbSNP
rs1419980766 1673 dbSNP
rs766713979 1677 dbSNP
rs1476229744 1678 dbSNP
rs991519663 1679 dbSNP
rs1476846434 1681 dbSNP
rs1258269802 1692 dbSNP
rs959639364 1699 dbSNP
rs950263790 1702 dbSNP
rs913289275 1709 dbSNP
rs988863001 1719 dbSNP
rs1332491929 1720 dbSNP
rs1358897758 1722 dbSNP
rs1449254575 1748 dbSNP
rs1187137113 1751 dbSNP
rs1295579030 1751 dbSNP
rs763375551 1752 dbSNP
rs1003672878 1754 dbSNP
rs1277010841 1757 dbSNP
rs896924320 1761 dbSNP
rs567937377 1766 dbSNP
rs1015322875 1771 dbSNP
rs1196745267 1778 dbSNP
rs1339378123 1780 dbSNP
rs1256735821 1786 dbSNP
rs1259461198 1789 dbSNP
rs1005288325 1791 dbSNP
rs1235613638 1792 dbSNP
rs936002486 1799 dbSNP
rs548303510 1813 dbSNP
rs1476461391 1829 dbSNP
rs536119107 1830 dbSNP
rs112463899 1838 dbSNP
rs979304916 1842 dbSNP
rs1337154963 1850 dbSNP
rs1359098703 1856 dbSNP
rs953443163 1856 dbSNP
rs1299392470 1860 dbSNP
rs1326448748 1861 dbSNP
rs901059635 1864 dbSNP
rs143485596 1869 dbSNP
rs376876219 1869 dbSNP
rs187176398 1872 dbSNP
rs934468001 1874 dbSNP
rs1282194577 1893 dbSNP
rs1351289515 1896 dbSNP
rs118079618 1899 dbSNP
rs528379255 1906 dbSNP
rs1262378066 1918 dbSNP
rs76900724 1919 dbSNP
rs771484327 1924 dbSNP
rs1014644768 1926 dbSNP
rs879097640 1932 dbSNP
rs1454865812 1934 dbSNP
rs1175798899 1948 dbSNP
rs887432353 1950 dbSNP
rs1471971646 1951 dbSNP
rs915260557 1952 dbSNP
rs1387786823 1954 dbSNP
rs1383359734 1962 dbSNP
rs775168056 1964 dbSNP
rs545499885 1967 dbSNP
rs796502328 1985 dbSNP
rs532894237 1986 dbSNP
rs1457607151 1991 dbSNP
rs575275089 1992 dbSNP
rs1216145891 2001 dbSNP
rs563341750 2012 dbSNP
rs1001773284 2023 dbSNP
rs906084843 2027 dbSNP
rs1208061449 2029 dbSNP
rs1468999041 2031 dbSNP
rs1195676092 2033 dbSNP
rs1045994661 2035 dbSNP
rs1236612368 2038 dbSNP
rs745804547 2044 dbSNP
rs891966368 2054 dbSNP
rs1183006145 2056 dbSNP
rs570566190 2060 dbSNP
rs541958552 2061 dbSNP
rs1352142506 2063 dbSNP
rs1456841334 2081 dbSNP
rs936117037 2102 dbSNP
rs1389362044 2109 dbSNP
rs1015744146 2110 dbSNP
rs925938311 2122 dbSNP
rs1005752329 2124 dbSNP
rs1374213444 2125 dbSNP
rs985843115 2126 dbSNP
rs932685116 2129 dbSNP
rs1028409392 2132 dbSNP
rs1237830872 2133 dbSNP
rs996503242 2139 dbSNP
rs1283546106 2144 dbSNP
rs1305330325 2147 dbSNP
rs76158778 2148 dbSNP
rs1441602535 2149 dbSNP
rs901112019 2151 dbSNP
rs1393638585 2152 dbSNP
rs11593733 2158 dbSNP
rs770697379 2159 dbSNP
rs556527137 2169 dbSNP
rs1387151234 2174 dbSNP
rs1419251053 2184 dbSNP
rs1475214925 2185 dbSNP
rs749078398 2189 dbSNP
rs983183366 2197 dbSNP
rs1397582629 2199 dbSNP
rs1461145864 2210 dbSNP
rs951797006 2216 dbSNP
rs1027424247 2221 dbSNP
rs1394100644 2224 dbSNP
rs1378893053 2225 dbSNP
rs1001579151 2232 dbSNP
rs1356028213 2244 dbSNP
rs777906464 2245 dbSNP
rs560794255 2246 dbSNP
rs1317416732 2247 dbSNP
rs182564019 2249 dbSNP
rs1014542969 2254 dbSNP
rs946796939 2255 dbSNP
rs796591749 2258 dbSNP
rs755329134 2266 dbSNP
rs1258724175 2273 dbSNP
rs1486936267 2274 dbSNP
rs1192172643 2278 dbSNP
rs1420805797 2279 dbSNP
rs937963968 2281 dbSNP
rs756360295 2285 dbSNP
rs1374438251 2290 dbSNP
rs982383679 2296 dbSNP
rs1351011364 2306 dbSNP
rs1375907987 2310 dbSNP
rs1416511617 2314 dbSNP
rs371370295 2322 dbSNP
rs1339875650 2332 dbSNP
rs904589206 2333 dbSNP
rs144107279 2334 dbSNP
rs1310649119 2336 dbSNP
rs1232890866 2341 dbSNP
rs1281450201 2342 dbSNP
rs1234734396 2354 dbSNP
rs377629722 2360 dbSNP
rs1263140658 2367 dbSNP
rs932606430 2369 dbSNP
rs1369903933 2376 dbSNP
rs922668651 2377 dbSNP
rs984267780 2382 dbSNP
rs1040685678 2395 dbSNP
rs1432765707 2398 dbSNP
rs190426919 2408 dbSNP
rs907688526 2416 dbSNP
rs1419397282 2417 dbSNP
rs983257408 2418 dbSNP
rs1344542197 2422 dbSNP
rs1175697657 2428 dbSNP
rs756510086 2429 dbSNP
rs998764854 2437 dbSNP
rs1365630235 2440 dbSNP
rs951871883 2449 dbSNP
rs903071796 2453 dbSNP
rs530453088 2455 dbSNP
rs1043282133 2460 dbSNP
rs211394 2462 dbSNP
rs1198404039 2468 dbSNP
rs979878482 2470 dbSNP
rs1476662422 2471 dbSNP
rs893894350 2481 dbSNP
rs970124859 2489 dbSNP
rs938058541 2492 dbSNP
rs569730393 2493 dbSNP
rs1487138469 2502 dbSNP
rs755039741 2503 dbSNP
rs1253276927 2504 dbSNP
rs1259202825 2509 dbSNP
rs1211076893 2515 dbSNP
rs1311427669 2523 dbSNP
rs752074733 2524 dbSNP
rs548236863 2526 dbSNP
rs927990593 2532 dbSNP
rs956267996 2534 dbSNP
rs185105304 2541 dbSNP
rs1000288354 2542 dbSNP
rs904705056 2543 dbSNP
rs1050271418 2550 dbSNP
rs1396976867 2552 dbSNP
rs781726078 2553 dbSNP
rs211393 2558 dbSNP
rs1374562070 2559 dbSNP
rs369336817 2559 dbSNP
rs1041072927 2562 dbSNP
rs940019621 2564 dbSNP
rs907763780 2565 dbSNP
rs181679447 2569 dbSNP
rs930423647 2583 dbSNP
rs1174360497 2592 dbSNP
rs1412194742 2596 dbSNP
rs1420835877 2597 dbSNP
rs1170521586 2602 dbSNP
rs1009422138 2603 dbSNP
rs752074445 2605 dbSNP
rs796757228 2606 dbSNP
rs1188250028 2610 dbSNP
rs1178838111 2611 dbSNP
rs1411540255 2621 dbSNP
rs1474887560 2622 dbSNP
rs866399249 2627 dbSNP
rs980247324 2629 dbSNP
rs1328492529 2630 dbSNP
rs1464237499 2630 dbSNP
rs746066933 2630 dbSNP
rs952939338 2630 dbSNP
rs1234503637 2631 dbSNP
rs377300626 2634 dbSNP
rs969857643 2636 dbSNP
rs965093770 2655 dbSNP
rs1438120673 2661 dbSNP
rs764169110 2675 dbSNP
rs917005156 2678 dbSNP
rs1257347365 2685 dbSNP
rs552464929 2686 dbSNP
rs992426097 2688 dbSNP
rs998434655 2689 dbSNP
rs1420088037 2704 dbSNP
rs528344811 2712 dbSNP
rs1031846895 2724 dbSNP
rs1167516892 2728 dbSNP
rs750825805 2737 dbSNP
rs1378713310 2752 dbSNP
rs1301519597 2756 dbSNP
rs1329298966 2762 dbSNP
rs1444834319 2764 dbSNP
rs1174384707 2766 dbSNP
rs1375296434 2771 dbSNP
rs765653710 2772 dbSNP
rs11008727 2779 dbSNP
rs150020123 2780 dbSNP
rs1339640714 2782 dbSNP
rs1216029238 2786 dbSNP
rs1277888168 2791 dbSNP
rs1464480872 2792 dbSNP
rs1419456340 2796 dbSNP
rs997318965 2797 dbSNP
rs901232464 2811 dbSNP
rs1041538100 2826 dbSNP
rs771763348 2830 dbSNP
rs887107711 2832 dbSNP
rs1047675670 2834 dbSNP
rs1422933942 2836 dbSNP
rs1244738248 2837 dbSNP
rs930580630 2842 dbSNP
rs898975918 2845 dbSNP
rs752923176 2854 dbSNP
rs948574088 2877 dbSNP
rs866884132 2881 dbSNP
rs1046451686 2895 dbSNP
rs541946024 2897 dbSNP
rs1237287154 2906 dbSNP
rs992540844 2915 dbSNP
rs1317012282 2922 dbSNP
rs574628134 2923 dbSNP
rs939975322 2927 dbSNP
rs1196725772 2929 dbSNP
rs934327858 2931 dbSNP
rs924316717 2939 dbSNP
rs1048666164 2940 dbSNP
rs978967910 2942 dbSNP
rs1234756027 2953 dbSNP
rs921479050 2962 dbSNP
rs1348445344 2963 dbSNP
rs975522155 2964 dbSNP
rs1285013116 2970 dbSNP
rs943789815 2971 dbSNP
rs545945167 2972 dbSNP
rs1252613120 2974 dbSNP
rs866465266 2976 dbSNP
rs559883810 2980 dbSNP
rs1454934771 2984 dbSNP
rs1195880047 2986 dbSNP
rs1362486125 2996 dbSNP
rs1470045043 2997 dbSNP
rs1159703606 3003 dbSNP
rs977067983 3004 dbSNP
rs1029009644 3005 dbSNP
rs1393299412 3007 dbSNP
rs975576361 3007 dbSNP
rs1021690531 3008 dbSNP
rs543199169 3009 dbSNP
rs1238177137 3023 dbSNP
rs541293514 3032 dbSNP
rs774193727 3036 dbSNP
rs577391184 3037 dbSNP
rs1397304443 3038 dbSNP
rs1294568414 3044 dbSNP
rs1456971453 3057 dbSNP
rs1211912956 3058 dbSNP
rs990121917 3067 dbSNP
rs188549843 3077 dbSNP
rs958864363 3080 dbSNP
rs965936052 3082 dbSNP
rs1437637984 3092 dbSNP
rs1183117188 3104 dbSNP
rs1002684085 3105 dbSNP
rs770877903 3107 dbSNP
rs1379499008 3117 dbSNP
rs1162159787 3121 dbSNP
rs1176541331 3122 dbSNP
rs1455578325 3127 dbSNP
rs558952968 3128 dbSNP
rs906629654 3129 dbSNP
rs184302977 3131 dbSNP
rs1390607417 3135 dbSNP
rs191331472 3147 dbSNP
rs1337448766 3148 dbSNP
rs1231449007 3155 dbSNP
rs887099169 3157 dbSNP
rs554590655 3159 dbSNP
rs1335601983 3161 dbSNP
rs1027011046 3162 dbSNP
rs1218275259 3164 dbSNP
rs12570362 3167 dbSNP
rs565869190 3172 dbSNP
rs1196760588 3173 dbSNP
rs899054666 3177 dbSNP
rs188045983 3181 dbSNP
rs1484976934 3183 dbSNP
rs534487666 3186 dbSNP
rs895680171 3190 dbSNP
rs150825860 3193 dbSNP
rs1166384609 3194 dbSNP
rs1639132 3197 dbSNP
rs1302621647 3198 dbSNP
rs530876067 3209 dbSNP
rs1372220600 3211 dbSNP
rs1458872284 3212 dbSNP
rs1312221884 3220 dbSNP
rs569662254 3227 dbSNP
rs1364936697 3231 dbSNP
rs1290082517 3232 dbSNP
rs900046909 3237 dbSNP
rs1307125516 3239 dbSNP
rs947053701 3242 dbSNP
rs1253417113 3262 dbSNP
rs1346232421 3264 dbSNP
rs1210738884 3265 dbSNP
rs921490580 3266 dbSNP
rs1359484626 3267 dbSNP
rs944179397 3270 dbSNP
rs575722688 3271 dbSNP
rs1183079468 3274 dbSNP
rs1259136508 3275 dbSNP
rs1427522767 3288 dbSNP
rs977162886 3290 dbSNP
rs965571612 3303 dbSNP
rs1391732699 3306 dbSNP
rs1436360918 3307 dbSNP
rs1395415135 3308 dbSNP
rs1175305050 3309 dbSNP
rs755092964 3312 dbSNP
rs1376009840 3313 dbSNP
rs143275772 3317 dbSNP
rs1265410885 3322 dbSNP
rs1361412520 3326 dbSNP
rs529794832 3334 dbSNP
rs185508324 3335 dbSNP
rs560629164 3337 dbSNP
rs1162547836 3338 dbSNP
rs990188593 3345 dbSNP
rs201218644 3347 dbSNP
rs951420964 3348 dbSNP
rs1234031780 3351 dbSNP
rs1281562875 3354 dbSNP
rs1350672819 3379 dbSNP
rs1262743933 3385 dbSNP
rs1258407156 3391 dbSNP
rs1027084600 3396 dbSNP
rs1214673338 3398 dbSNP
rs541137640 3401 dbSNP
rs995487609 3406 dbSNP
rs1485272051 3412 dbSNP
rs1205311992 3413 dbSNP
rs1249511925 3414 dbSNP
rs555767285 3433 dbSNP
rs1192763116 3439 dbSNP
rs1022880783 3445 dbSNP
rs1013285696 3448 dbSNP
rs1156899470 3458 dbSNP
rs981344639 3459 dbSNP
rs1454404596 3460 dbSNP
rs1322736911 3470 dbSNP
rs1392533367 3476 dbSNP
rs532556732 3492 dbSNP
rs565478283 3493 dbSNP
rs1471772810 3505 dbSNP
rs543704227 3513 dbSNP
rs1056915787 3528 dbSNP
rs1304582659 3531 dbSNP
rs998661782 3537 dbSNP
rs374590834 3542 dbSNP
rs1256931619 3551 dbSNP
rs193211006 3553 dbSNP
rs1233208333 3562 dbSNP
rs1014764315 3566 dbSNP
rs1315741624 3566 dbSNP
rs1310951699 3567 dbSNP
rs1269538719 3571 dbSNP
rs1297172507 3575 dbSNP
rs554527276 3582 dbSNP
rs201066010 3590 dbSNP
rs572128245 3591 dbSNP
rs995886976 3592 dbSNP
rs1416194198 3599 dbSNP
rs1407176140 3600 dbSNP
rs1419657122 3600 dbSNP
rs146662607 3600 dbSNP
rs1161454647 3604 dbSNP
rs1402711911 3605 dbSNP
rs920968047 3605 dbSNP
rs1415817167 3609 dbSNP
rs1039947929 3611 dbSNP
rs1461095982 3613 dbSNP
rs1326851545 3616 dbSNP
rs944316532 3623 dbSNP
rs1039960077 3627 dbSNP
rs1440473986 3629 dbSNP
rs1464545483 3630 dbSNP
rs912837628 3632 dbSNP
rs779952598 3633 dbSNP
rs1289648640 3635 dbSNP
rs1374732877 3643 dbSNP
rs1171214725 3655 dbSNP
rs982919899 3661 dbSNP
rs1478205685 3662 dbSNP
rs1202160620 3667 dbSNP
rs1232152597 3673 dbSNP
rs951535217 3677 dbSNP
rs919969875 3690 dbSNP
rs188786216 3691 dbSNP
rs969410029 3692 dbSNP
rs1024087490 3714 dbSNP
rs1255428482 3716 dbSNP
rs891332519 3718 dbSNP
rs1042270562 3719 dbSNP
rs1012819190 3723 dbSNP
rs1408489891 3728 dbSNP
rs959923135 3729 dbSNP
rs1448716986 3730 dbSNP
rs1245793003 3734 dbSNP
rs1355522258 3735 dbSNP
rs914266463 3740 dbSNP
rs1311619395 3748 dbSNP
rs1486758142 3758 dbSNP
rs1257381988 3764 dbSNP
rs1054141796 3767 dbSNP
rs1035582601 3768 dbSNP
rs182779696 3777 dbSNP
rs903025827 3783 dbSNP
rs926928872 3793 dbSNP
rs1316780640 3810 dbSNP
rs1042808568 3811 dbSNP
rs971298010 3814 dbSNP
rs1011774167 3818 dbSNP
rs1278104229 3830 dbSNP
rs1234795299 3832 dbSNP
rs1485352622 3842 dbSNP
rs1188730315 3852 dbSNP
rs1239354808 3853 dbSNP
rs1474532357 3855 dbSNP
rs899484017 3863 dbSNP
rs1340698247 3874 dbSNP
rs907719467 3875 dbSNP
rs750824262 3879 dbSNP
rs1039800702 3880 dbSNP
rs1435956200 3882 dbSNP
rs1334207457 3902 dbSNP
rs983652550 3918 dbSNP
rs570554357 3922 dbSNP
rs558759624 3923 dbSNP
rs574424008 3942 dbSNP
rs765707067 3946 dbSNP
rs537330034 3952 dbSNP
rs1399694886 3961 dbSNP
rs1168617253 3964 dbSNP
rs1201008545 3970 dbSNP
rs1473930327 3970 dbSNP
rs1280803134 3972 dbSNP
rs1047346943 3974 dbSNP
rs930127277 3981 dbSNP
rs1248890085 3992 dbSNP
rs757680699 3994 dbSNP
rs974174693 3997 dbSNP
rs995589066 4004 dbSNP
rs1394894241 4015 dbSNP
rs190556914 4022 dbSNP
rs1422468859 4024 dbSNP
rs868209002 4025 dbSNP
rs916686652 4028 dbSNP
rs752462436 4029 dbSNP
rs1018226431 4030 dbSNP
rs1008466493 4035 dbSNP
rs1388901357 4042 dbSNP
rs201318035 4042 dbSNP
rs145356849 4044 dbSNP
rs773034225 4049 dbSNP
rs960701115 4052 dbSNP
rs1035530511 4064 dbSNP
rs1233822151 4066 dbSNP
rs1276579410 4067 dbSNP
rs771564522 4072 dbSNP
rs1010797333 4073 dbSNP
rs1215008352 4077 dbSNP
rs1466394465 4078 dbSNP
rs111264964 4082 dbSNP
rs1054637940 4087 dbSNP
rs1452578246 4090 dbSNP
rs937072219 4095 dbSNP
rs1362580668 4104 dbSNP
rs1021906436 4111 dbSNP
rs529680611 4112 dbSNP
rs899552847 4114 dbSNP
rs139136383 4120 dbSNP
rs1393409017 4120 dbSNP
rs565679178 4120 dbSNP
rs1374553570 4130 dbSNP
rs951998606 4131 dbSNP
rs1441434590 4132 dbSNP
rs1289037590 4133 dbSNP
rs1331342607 4135 dbSNP
rs767245779 4141 dbSNP
rs1007860149 4148 dbSNP
rs890835987 4156 dbSNP
rs1047338829 4158 dbSNP
rs1391493302 4160 dbSNP
rs536159818 4164 dbSNP
rs778609440 4169 dbSNP
rs759017238 4173 dbSNP
rs1038923017 4178 dbSNP
rs1382601055 4179 dbSNP
rs1251849928 4186 dbSNP
rs567112865 4189 dbSNP
rs916615460 4193 dbSNP
rs992255874 4203 dbSNP
rs955639255 4204 dbSNP
rs554485629 4206 dbSNP
rs867722197 4212 dbSNP
rs1409247767 4213 dbSNP
rs1308589907 4217 dbSNP
rs1352340062 4222 dbSNP
rs1413025688 4225 dbSNP
rs1451709943 4227 dbSNP
rs139367051 4233 dbSNP
rs1341290651 4239 dbSNP
rs977295179 4243 dbSNP
rs1249954104 4253 dbSNP
rs1339165510 4253 dbSNP
rs1207752394 4265 dbSNP
rs565326985 4269 dbSNP
rs773121256 4270 dbSNP
rs1483718539 4272 dbSNP
rs1185146190 4274 dbSNP
rs990355286 4275 dbSNP
rs963914861 4276 dbSNP
rs1189212999 4278 dbSNP
rs543642156 4289 dbSNP
rs1371064825 4296 dbSNP
rs1169091601 4297 dbSNP
rs1239164884 4299 dbSNP
rs1056356 4313 dbSNP
rs1432830138 4315 dbSNP
rs1302330200 4317 dbSNP
rs1351161267 4332 dbSNP
rs531860695 4338 dbSNP
rs1403074255 4346 dbSNP
rs561217240 4348 dbSNP
rs1326172199 4363 dbSNP
rs1437057084 4366 dbSNP
rs1008015861 4368 dbSNP
rs186928538 4396 dbSNP
rs1322946578 4404 dbSNP
rs1210874020 4408 dbSNP
rs1254850946 4410 dbSNP
rs747910222 4413 dbSNP
rs1385364653 4414 dbSNP
rs781687190 4420 dbSNP
rs1259263690 4421 dbSNP
rs1448553899 4422 dbSNP
rs757568757 4423 dbSNP
rs949669440 4423 dbSNP
rs886095583 4431 dbSNP
rs898712423 4435 dbSNP
rs1287279945 4438 dbSNP
rs1378207274 4438 dbSNP
rs1467673747 4438 dbSNP
rs1038622113 4441 dbSNP
rs930576770 4443 dbSNP
rs948179268 4449 dbSNP
rs1369264033 4451 dbSNP
rs1234121691 4453 dbSNP
rs1302629076 4458 dbSNP
rs1378815893 4461 dbSNP
rs920458732 4467 dbSNP
rs1307693619 4474 dbSNP
rs1478632265 4478 dbSNP
rs1245685061 4485 dbSNP
rs1249602656 4486 dbSNP
rs1466973254 4489 dbSNP
rs895354606 4490 dbSNP
rs974515698 4495 dbSNP
rs572307586 4498 dbSNP
rs911283266 4500 dbSNP
rs1411409163 4503 dbSNP
rs1056465459 4505 dbSNP
rs986776682 4511 dbSNP
rs955397228 4514 dbSNP
rs1392691609 4521 dbSNP
rs1295621033 4525 dbSNP
rs1351273644 4529 dbSNP
rs939466058 4531 dbSNP
rs542393380 4551 dbSNP
rs1390237019 4572 dbSNP
rs1020281097 4574 dbSNP
rs1285895591 4574 dbSNP
rs923925549 4581 dbSNP
rs560538582 4586 dbSNP
rs553379923 4597 dbSNP
rs1228552734 4600 dbSNP
rs1344196951 4604 dbSNP
rs957609583 4608 dbSNP
rs946727418 4619 dbSNP
rs914434900 4625 dbSNP
rs990123516 4639 dbSNP
rs1033595963 4641 dbSNP
rs545165851 4653 dbSNP
rs768949071 4664 dbSNP
rs752048582 4666 dbSNP
rs1251092750 4667 dbSNP
rs986531982 4670 dbSNP
rs1013997300 4673 dbSNP
rs182705183 4674 dbSNP
rs1047385298 4686 dbSNP
rs1352040665 4694 dbSNP
rs1460865849 4703 dbSNP
rs558765305 4710 dbSNP
rs1307964480 4713 dbSNP
rs1349291955 4719 dbSNP
rs930564937 4728 dbSNP
rs1336547173 4731 dbSNP
rs1025414360 4733 dbSNP
rs1038862788 4742 dbSNP
rs778172774 4742 dbSNP
rs993797944 4743 dbSNP
rs962406377 4748 dbSNP
rs1415611905 4751 dbSNP
rs537217592 4752 dbSNP
rs1425090350 4760 dbSNP
rs758982412 4762 dbSNP
rs1478529639 4764 dbSNP
rs1423672469 4766 dbSNP
rs1192534014 4768 dbSNP
rs1487090140 4773 dbSNP
rs11539711 4782 dbSNP
rs34898215 4784 dbSNP
rs1239044469 4785 dbSNP
rs943177811 4787 dbSNP
rs576321982 4792 dbSNP
rs1012533182 4793 dbSNP
rs1273861359 4794 dbSNP
rs1483371544 4798 dbSNP
rs1207345876 4814 dbSNP
rs1255581747 4821 dbSNP
rs1276427424 4834 dbSNP
rs1200418384 4837 dbSNP
rs1345797897 4840 dbSNP
rs747163306 4852 dbSNP
rs895290376 4855 dbSNP
rs1427140400 4856 dbSNP
rs796312845 4856 dbSNP
rs200023252 4859 dbSNP
rs1371686978 4876 dbSNP
rs1432210726 4880 dbSNP
rs1003685102 4887 dbSNP
rs1356983914 4896 dbSNP
rs1446753883 4907 dbSNP
rs1284461191 4912 dbSNP
rs747700547 4915 dbSNP
rs1225877474 4917 dbSNP
rs934081318 4920 dbSNP
rs902577893 4939 dbSNP
rs1449582795 4940 dbSNP
rs780182179 4951 dbSNP
rs115026857 4958 dbSNP
rs1276520783 4959 dbSNP
rs946705835 4959 dbSNP
rs1358899252 4960 dbSNP
rs1332806374 4961 dbSNP
rs915279989 4962 dbSNP
rs879662467 4968 dbSNP
rs1188291369 4969 dbSNP
rs980334496 4971 dbSNP
rs1451862111 4973 dbSNP
rs1169323611 4974 dbSNP
rs1054768698 4975 dbSNP
rs758347785 4998 dbSNP
rs746432181 5005 dbSNP
rs1476672648 5008 dbSNP
rs911161726 5011 dbSNP
rs534469244 5013 dbSNP
rs1432539255 5016 dbSNP
rs1403735665 5027 dbSNP
rs1024477696 5034 dbSNP
rs1365679664 5046 dbSNP
rs35703811 5047 dbSNP
rs7358234 5050 dbSNP
rs1273039631 5059 dbSNP
rs1344336856 5061 dbSNP
rs1219865129 5064 dbSNP
rs1472354207 5065 dbSNP
rs1327332258 5067 dbSNP
rs950464163 5071 dbSNP
rs1235495765 5074 dbSNP
rs1200508708 5080 dbSNP
rs147291646 5085 dbSNP
rs538339477 5090 dbSNP
rs1466531222 5097 dbSNP
rs1246618938 5102 dbSNP
rs909268700 5102 dbSNP
rs899092014 5106 dbSNP
rs185924595 5108 dbSNP
rs962683595 5123 dbSNP
rs1426732622 5132 dbSNP
rs1198097033 5139 dbSNP
rs1455267083 5154 dbSNP
rs757734074 5159 dbSNP
rs58561461 5170 dbSNP
rs1157968342 5171 dbSNP
rs1016627251 5175 dbSNP
rs1007429047 5179 dbSNP
rs1305783202 5180 dbSNP
rs890321716 5183 dbSNP
rs1321398253 5187 dbSNP
rs754232261 5188 dbSNP
rs549485555 5189 dbSNP
rs1276673547 5191 dbSNP
rs1292320138 5196 dbSNP
rs1012893586 5198 dbSNP
rs913290634 5199 dbSNP
rs373708019 5203 dbSNP
rs1053540480 5210 dbSNP
rs1201667046 5211 dbSNP
rs1270334977 5222 dbSNP
rs1229064766 5224 dbSNP
rs867915936 5229 dbSNP
rs11539714 5230 dbSNP
rs1378952065 5238 dbSNP
rs7358100 5241 dbSNP
rs1449723905 5248 dbSNP
rs925927900 5250 dbSNP
rs1378286565 5255 dbSNP
rs1331180104 5271 dbSNP
rs1035248112 5272 dbSNP
rs1463614825 5278 dbSNP
rs1351061987 5280 dbSNP
rs1389816417 5280 dbSNP
rs1405821730 5282 dbSNP
rs1165096408 5283 dbSNP
rs1325446495 5297 dbSNP
rs980391861 5301 dbSNP
rs1411431662 5307 dbSNP
rs1289114404 5314 dbSNP
rs1003627881 5317 dbSNP
rs1352560806 5318 dbSNP
rs1242962514 5320 dbSNP
rs561153562 5321 dbSNP
rs1357505132 5325 dbSNP
rs868647772 5326 dbSNP
rs917432248 5326 dbSNP
rs1483043046 5333 dbSNP
rs1203772624 5334 dbSNP
rs1251988468 5338 dbSNP
rs1141272 5342 dbSNP
rs1164177433 5344 dbSNP
rs759274193 5344 dbSNP
rs538375249 5347 dbSNP
rs1011021347 5355 dbSNP
rs1420488708 5357 dbSNP
rs1184975488 5359 dbSNP
rs992972719 5362 dbSNP
rs143972930 5376 dbSNP
rs1165335556 5382 dbSNP
rs1368603084 5393 dbSNP
rs1440007173 5396 dbSNP
rs950540429 5402 dbSNP
rs1176650195 5406 dbSNP
rs1394445924 5416 dbSNP
rs1039013371 5417 dbSNP
rs943379863 5434 dbSNP
rs540070395 5438 dbSNP
rs1248495866 5441 dbSNP
rs1295913626 5451 dbSNP
rs1222648254 5457 dbSNP
rs1342068338 5462 dbSNP
rs549215987 5478 dbSNP
rs1274655029 5485 dbSNP
rs1051013601 5493 dbSNP
rs933811721 5501 dbSNP
rs918459412 5507 dbSNP
rs41306340 5511 dbSNP
rs1185198458 5521 dbSNP
rs1388158030 5522 dbSNP
rs1448738029 5524 dbSNP
rs1169148247 5536 dbSNP
rs1374825255 5541 dbSNP
rs1464630376 5551 dbSNP
rs962516549 5560 dbSNP
rs1428811362 5569 dbSNP
rs138502495 5574 dbSNP
rs909643245 5575 dbSNP
rs1354790641 5583 dbSNP
rs1318942095 5584 dbSNP
rs1364940699 5585 dbSNP
rs539280087 5587 dbSNP
rs868124130 5590 dbSNP
rs1254975214 5591 dbSNP
rs1300481220 5591 dbSNP
rs1390124783 5591 dbSNP
rs1369171214 5593 dbSNP
rs565693587 5597 dbSNP
rs1205195238 5599 dbSNP
rs1245898460 5603 dbSNP
rs890331606 5605 dbSNP
rs13470 5617 dbSNP
rs1263739010 5624 dbSNP
rs1035231547 5628 dbSNP
rs982363180 5644 dbSNP
rs1175444496 5654 dbSNP
rs892279239 5672 dbSNP
rs1053229922 5675 dbSNP
rs558955938 5679 dbSNP
rs966836004 5684 dbSNP
rs1021101274 5685 dbSNP
rs1471045298 5690 dbSNP
rs1011507938 5698 dbSNP
rs1475544284 5700 dbSNP
rs1157221805 5701 dbSNP
rs936084722 5703 dbSNP
rs1160022570 5707 dbSNP
rs1355192195 5708 dbSNP
rs577977825 5709 dbSNP
rs1420105942 5711 dbSNP
rs1366110637 5716 dbSNP
rs1379411756 5717 dbSNP
rs1386766439 5724 dbSNP
rs1299926583 5728 dbSNP
rs893860453 5743 dbSNP
rs1018111456 5746 dbSNP
rs765358564 5749 dbSNP
rs1224926677 5753 dbSNP
rs1156821160 5757 dbSNP
rs1328114839 5757 dbSNP
rs1209089944 5759 dbSNP
rs1434813668 5759 dbSNP
rs1262336800 5767 dbSNP
rs1487456246 5771 dbSNP
rs1190563380 5781 dbSNP
rs1268064327 5784 dbSNP
rs550296624 5789 dbSNP
rs1191840704 5791 dbSNP
rs1180220938 5793 dbSNP
rs1488158499 5797 dbSNP
rs1411477714 5798 dbSNP
rs1458000047 5806 dbSNP
rs890502335 5820 dbSNP
rs1267052244 5833 dbSNP
rs539343646 5836 dbSNP
rs1051002323 5840 dbSNP
rs948954852 5841 dbSNP
rs1294666324 5845 dbSNP
rs1365609149 5846 dbSNP
rs530487634 5850 dbSNP
rs562937069 5852 dbSNP
rs993418879 5854 dbSNP
rs1224048327 5858 dbSNP
rs544728531 5869 dbSNP
rs1488837578 5870 dbSNP
rs202130986 5870 dbSNP
rs1285732419 5871 dbSNP
rs1490833156 5879 dbSNP
rs950942372 5889 dbSNP
rs919402146 5891 dbSNP
rs1473009827 5892 dbSNP
rs973211211 5896 dbSNP
rs576257899 5903 dbSNP
rs1423619681 5907 dbSNP
rs1165991692 5911 dbSNP
rs909599964 5913 dbSNP
rs192184985 5927 dbSNP
rs954639229 5930 dbSNP
rs937670611 5931 dbSNP
rs536147122 5932 dbSNP
rs927662215 5942 dbSNP
rs982309807 5943 dbSNP
rs1343042365 5957 dbSNP
rs966909390 5973 dbSNP
rs1299689412 5976 dbSNP
rs536219927 5981 dbSNP
rs1361494492 5998 dbSNP
rs1226110316 5999 dbSNP
rs892340728 6029 dbSNP
rs1483443530 6035 dbSNP
rs1206835066 6036 dbSNP
rs1235923146 6037 dbSNP
rs1032584695 6041 dbSNP
rs369680187 6042 dbSNP
rs1448139526 6043 dbSNP
rs1168513284 6048 dbSNP
rs765973519 6056 dbSNP
rs989627886 6061 dbSNP
rs1171960315 6080 dbSNP
rs1357035900 6081 dbSNP
rs904570444 6085 dbSNP
rs572338824 6087 dbSNP
rs958447792 6089 dbSNP
rs553465768 6093 dbSNP
rs1432765183 6102 dbSNP
rs1296817916 6105 dbSNP
rs1017687898 6108 dbSNP
rs1340046611 6109 dbSNP
rs1216373898 6110 dbSNP
rs776444661 6114 dbSNP
rs1378138351 6115 dbSNP
rs1044436038 6118 dbSNP
rs1204557630 6128 dbSNP
rs1008093666 6129 dbSNP
rs762367435 6144 dbSNP
rs1432693076 6147 dbSNP
rs538598752 6148 dbSNP
rs1188430910 6149 dbSNP
rs1057396185 6161 dbSNP
rs1427236217 6169 dbSNP
rs1452869809 6174 dbSNP
rs1196164241 6175 dbSNP
rs1187757215 6176 dbSNP
rs571168685 6186 dbSNP
rs1478265439 6190 dbSNP
rs1263009823 6195 dbSNP
rs549423930 6198 dbSNP
rs1407970759 6202 dbSNP
rs919440649 6212 dbSNP
rs1319689872 6213 dbSNP
rs1326950482 6216 dbSNP
rs1257123054 6218 dbSNP
rs1209983540 6220 dbSNP
rs1273094799 6221 dbSNP
rs973939911 6221 dbSNP
rs1366999079 6238 dbSNP
rs1224311907 6239 dbSNP
rs897046963 6240 dbSNP
rs1279517735 6242 dbSNP
rs1208460583 6250 dbSNP
rs1218926446 6250 dbSNP
rs1285469884 6255 dbSNP
rs1449219834 6263 dbSNP
rs537548432 6263 dbSNP
rs1292916223 6268 dbSNP
rs567514523 6269 dbSNP
rs985829774 6270 dbSNP
rs941163634 6272 dbSNP
rs1030406651 6273 dbSNP
rs1471444985 6283 dbSNP
rs888311525 6288 dbSNP
rs1158133743 6293 dbSNP
rs549201950 6304 dbSNP
rs760789256 6305 dbSNP
rs1404077822 6310 dbSNP
rs527960010 6311 dbSNP
rs1491326918 6319 dbSNP
rs956800453 6319 dbSNP
rs1491487585 6320 dbSNP
rs1285314686 6321 dbSNP
rs1032179624 6322 dbSNP
rs560812329 6323 dbSNP
rs904621481 6325 dbSNP
rs1023084697 6348 dbSNP
rs927734493 6354 dbSNP
rs981712976 6355 dbSNP
rs945050111 6358 dbSNP
rs895855728 6362 dbSNP
rs773542128 6363 dbSNP
rs929576873 6363 dbSNP
rs72775184 6364 dbSNP
rs1257265320 6372 dbSNP
rs1481837064 6372 dbSNP
rs533319300 6376 dbSNP
rs1180655086 6384 dbSNP
rs562874372 6385 dbSNP
rs942230431 6397 dbSNP
rs544714432 6398 dbSNP
rs990175735 6410 dbSNP
rs879351436 6419 dbSNP
rs1412938268 6435 dbSNP
rs958226416 6437 dbSNP
rs1425289946 6443 dbSNP
rs558545849 6444 dbSNP
rs1368803336 6447 dbSNP
rs561047349 6466 dbSNP
rs1329820841 6467 dbSNP
rs986197301 6479 dbSNP
rs1341853259 6482 dbSNP
rs985879696 6484 dbSNP
rs1249280945 6487 dbSNP
rs1360779641 6488 dbSNP
rs1248822339 6490 dbSNP
rs933060844 6497 dbSNP
rs1246480991 6499 dbSNP
rs143494405 6501 dbSNP
rs114056056 6503 dbSNP
rs1311716979 6515 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||||     | ||||||| 
Target 5' ugUAAAC-----UCUGCUGCUu 3'
5 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||||     | ||||||| 
Target 5' --UAAAC-----UCUGCUGCUu 3'
1 - 15
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000302418.4 | 3UTR | UUCUUGUAAACUCUGCUGCUUCCCAACACAACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000302418.4 | 3UTR | UAAACUCUGCUGCUUCCCAACACAACUAGAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000302418.4 | 3UTR | UAAACUCUGCUGCUUCCCAACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000302418.4 | 3UTR | UAAACUCUGCUGCUUCCCAACACAACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.631 1.4e-3 0.683 4.5e-4 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.576 2.0e-3 0.532 4.5e-3 23 Click to see details
GSE38226 Liver fibrosis -0.554 4.6e-3 -0.466 1.7e-2 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.462 1.0e-2 0.609 6.2e-4 25 Click to see details
GSE21032 Prostate cancer 0.187 4.5e-2 0.197 3.7e-2 83 Click to see details
GSE28260 Renal cortex and medulla -0.432 7.0e-2 -0.423 7.5e-2 13 Click to see details
GSE19350 CNS germ cell tumors 0.326 1.5e-1 0.049 4.4e-1 12 Click to see details
GSE19536 Breast cancer -0.093 1.8e-1 -0.003 4.9e-1 100 Click to see details
GSE19783 ER+ ER+ breast cancer -0.216 1.8e-1 -0.221 1.7e-1 20 Click to see details
GSE32688 Pancreatic cancer 0.165 1.8e-1 0.209 1.3e-1 32 Click to see details
GSE17498 Multiple myeloma 0.123 2.2e-1 0.216 9.0e-2 40 Click to see details
GSE28544 Breast cancer 0.153 2.4e-1 0.546 2.9e-3 24 Click to see details
GSE21687 Ependynoma primary tumors 0.083 2.6e-1 0.081 2.6e-1 64 Click to see details
GSE21849 B cell lymphoma -0.125 2.6e-1 -0.047 4.0e-1 29 Click to see details
GSE17306 Multiple myeloma 0.086 2.8e-1 0.020 4.5e-1 49 Click to see details
GSE19783 ER- ER- breast cancer -0.044 3.5e-1 0.069 2.7e-1 79 Click to see details
GSE27834 Pluripotent stem cells 0.089 3.7e-1 0.138 3.1e-1 16 Click to see details
GSE14794 Lymphoblastoid cells 0.034 3.8e-1 0.064 2.7e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.058 3.9e-1 0.037 4.3e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.012 4.8e-1 0.078 3.6e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.012 4.8e-1 0.078 3.6e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.282 0 0.260 0.01 84 Click to see details
CESC 0.995 0.03 1.000 0.5 3 Click to see details
PCPG -0.982 0.06 -1.000 0.5 3 Click to see details
KIRP -0.264 0.07 -0.379 0.02 32 Click to see details
BLCA -0.331 0.09 -0.255 0.15 18 Click to see details
STAD -0.226 0.11 -0.287 0.06 32 Click to see details
HNSC -0.175 0.13 -0.208 0.09 42 Click to see details
LUSC -0.181 0.14 -0.221 0.09 38 Click to see details
PRAD -0.153 0.14 0.001 0.5 50 Click to see details
KICH -0.18 0.19 -0.102 0.31 25 Click to see details
CHOL -0.306 0.21 -0.400 0.14 9 Click to see details
THCA -0.096 0.23 -0.123 0.18 59 Click to see details
LUAD 0.183 0.28 0.406 0.1 12 Click to see details
LIHC -0.082 0.29 -0.068 0.32 49 Click to see details
ESCA 0.134 0.35 0.227 0.25 11 Click to see details
COAD -0.165 0.35 -0.429 0.14 8 Click to see details
UCEC 0.074 0.38 0.056 0.41 19 Click to see details
KIRC -0.017 0.45 0.021 0.43 68 Click to see details
PAAD -0.062 0.47 0.000 0.5 4 Click to see details
PAAD -0.062 0.47 0.000 0.5 4 Click to see details
PAAD -0.062 0.47 0.000 0.5 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878