miRTarBase - #MIRT505686 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SESTD1   
Synonyms SOLO
Description SEC14 and spectrin domain containing 1
Transcript NM_178123   
Expression
Putative miRNA Targets on SESTD1
3'UTR of SESTD1
(miRNA target sites are highlighted)
>SESTD1|NM_178123|3'UTR
   1 TAGCTACCAGCTACCTACAGATTTGCAGTTCATAATCCCGCATGTTGTCAACATACTACAGCATTAGCCACCACACCTTA
  81 AGATGCATTTCACAGCCAAAATAAGTCTCATTTCTTTTCATGACACATTTCTCTTTACATGTTAACACCTTGCTACTACC
 161 AAGGCATAATTACTTAACATGCTTCGAGGCTGTAGATTCCAAGTATCTTAAAAGAAGGAACTATAAACATTGCACTGAAA
 241 ACTTGCTTTAAAGCTTTACCTGACCTGTCAGTTTGTAGACAAACAACTGATAATAAGCTTTGAATGGTGCTAATAAGAGT
 321 AGGAATTCTCTCTATTAAAAAGAAAAAAAAAAGTTGCCCTTCCTCCACAGGTGATTTAGTAAATTTAGACAGTAGTTAAA
 401 CTCTTGTTAGTAGACAGTGGTGTCCTCAAAATTTTACTTTGTAATTCTTCAGAATTGATTATTTTTATTGTGTCAATACA
 481 GAGAAAGCCTTTCAGATCTTTGATATATCATAGTCATTAAAAGACCTTTTCCTATTTGTATTGATAATGTATTAAAAGTT
 561 GTTTGTGCTTAATAAAAGACTTCTTTAAACATCTTATTTAATTTAGTAGTTACATCCTATTTCCAAACATGAGTGCCTTA
 641 TTTAAAAGGGCATTCTTAGGACTGTGAGGATGGTTTAATATTTGTTTTTTCATGGTGGTTGCATGTATTTTAGACAGGAA
 721 ATACATATGTAAGCATGTGTATATAATAAATAAGCATGTTTTATCATGAAAAATTATTGTGAACAATTTAGATCTTTAAG
 801 AACTTATTAATAATGGAATACTATTTCTAATTTTTCTCTTTTTCAACTTGAAAAATATTCTCAAAATTATTAACTACCCT
 881 GAAGATACTTTGTCTTTAGGGGAGGAGGGCTGAGGAAGAAGGCATACATAATTACTTCAGTGTAATCCTTTATATCAGAG
 961 TAATCTTTCAGGAACTAAAATAGCAATTGTTAATAAAATTTAGTTTCTCATTATAGTCTAAAAGCAAAATAAATTCTGAA
1041 GTAGTCCAATAACAGAACTGTATGACCCCTTTAGAAATAAAATTTATCATGAAATGCTAGTTCTTTTAAGTTTGTATTAA
1121 GTTTAAATGGTAAAATGCATATAATTTAAATTTTATGTATTTTTATTTCAGAACATTTTTTAAAATATTAAAAATTATTT
1201 TTTAGTCTTGTAGTCATTACAAAATTATAAACGAGTTGTATACTGGTTCCTTTTTGAGGTCTACAAACATGCTCGTGTAT
1281 CTTCCAATGCAAAAAAAAAACCCCTCCCTTTTAACCTGCTAGTTTTTCCAGCCTTCTTCACTGACTGACAGACTTCTTGG
1361 AGAAATCCACATCCAGTGCCCCTACATCCTCATCACTCACTACTCAGCACCTTGCAGTCTGGTTTTACACAGCACTCTAC
1441 TGAAACTGTTCTTTTGAAAGTCAGCAATGGCCTCCCAGTTACCAAACTGAATGGTTTTTTTCTCCGTCTGAATCCCTTAC
1521 CCTTTTCTCTGCAACATTTACACCATTGAGCAACCTTTCCTAGACAGTGTCTCCTTCCTTGAAGATGCTATCCTCTGAAA
1601 TAACTGTGAGTACAGTCGCATAACCCTAATTTAAGATGTGCCTGCTGAACATGTGCTCTCTCAGATCCTGTCCTCAGAAT
1681 GCTTTTGGCTCTTTTCTCGGTATCTCATCCTTAGAGTTTTTATTTTATACCAATGTTCTGGATTACATACCTGGTCCAGA
1761 AATCTAGACTTGTACTTCTTTTTAATTGCCTAGTTGACATTTCAACCTTGATTAAAGATTGACAATATTTATCACCTTTT
1841 CCTCCTGGAACAATTTAGGTTAATGGTGCAGCCTTTTTTCCTAGTCAAACATGCCAGGAAGTTCAGGGCAAAGTTCAACT
1921 GCTCCCTCTTGTCTTATGTGGTCACTGCTTCTGAGAACATCCAGGAAGTTCTTTCTATACTTGAATCATCTTCTCAGTCC
2001 TTTGGGGCTTTACTGCTATGAGTATGAACTTTTGTGATTATTTATTTCAGTCTTCATGATGGTGCTATCACATTCTACAG
2081 TTGTTTATGTCTGTACCCAGTAAGCTCTTTTGAGGGAAGGAATCTTGTCTTCTCCTATTCCCAGTCTTGCTCATGCATAA
2161 CAGATGCCCATTCCTCCTAAATATGAATGCTGTATTATAGGCATTAGTAATAATCCCTGTTACATTGCAGTCTGAAGTAT
2241 GTTTTAAACATACTTTTTTAAAGTTAGAACTGACTTACAAGTGAATCTATTCTTAGATTCTTAGATACTAACTACTTTAG
2321 ATATTTAGTTATACTCAATAACTAAATATCAATACTCAATATCTGTTTCTTCTGAATTTCAGAGTAGTTAGAATGTTTTT
2401 CTTAAGACTTTGCTAGAAAGGAACTGGTTTGTTAGTAATTCTGCCATCAACTCATGGAGTTATAATTGCCAAATGAGTTA
2481 ATTTTTATATACCTTAAGCTATCTTGCCTACAAAAAGTAAAATAAGGCAGGATTCATAAATGTTACTTGTAAATTGAGTG
2561 TTTCACATGAGGCCAAGTATGATTTTAACATAATGAATATCATTGCTCCTCATCTGTAAATTTGCTGCTGCTTTCATATG
2641 TGTATCTGTACATAGAGTTATGAATGAAAATCCAGTAATGCCCTAAAGCAACTTTCTTCCATAGGGTCAAAGCTCACTTA
2721 AGGTAAACGTGTGAAAAAAGTGACTGCAGTGTGTTTGAAACCACAAGCTGTTTCTATGTCATAAATTAACATCAGCTTGC
2801 AAGTCTCTGAAAGAACCACTCATTTGTAATTGGTATATATGTCACAACCTCCCACATTCCTTTAGCCCATCTCAGGGAAT
2881 TATTGAAACGCTGGCAGGGTTAGTTTCATTTTGTTTTGGTTTTTTTGGGTTTTTTTGTTTGTTTGAGGATTTTTTTTTTC
2961 TTTTATCATTTGTTTGCTCCTGTGTAAGCTTAATATATAATGGCAGTTTGGCATCTGTTCTTCGCACATGTCTAACCCAG
3041 CAGAGTTATGCAAAAATGATGACTTCATTTTAGGTCAAATTGGCTTTGTTCCCAGTCCTCATTGTTGGTCACTTTGTTCA
3121 GTTCTGGTGACTCATTGGTGATGTTGATGAAACTGCTCAGCCTGCCAGCTGGGATATTGATGGCAGGTCTAGGCTTCATT
3201 GTTAGGTAGAAGATTGAATACTTCTCACTTTATACAAATTTACATTGGCTATTGCTCCCATGTGTTAGCTAGTCTTAACA
3281 TGTTTGTTATTTCGTTATCTTATTAGCTGACATACGGAGTGGTATTATTAGTGTCGTACTCCTTAGCGTGAGCATGACAA
3361 TTAAGTTACCTTACTAACAGTGATGAGTAAACCATACTCTGATCTAAACCCATTGTTACCAATGATGTGATTATGAAGTT
3441 AGCTGAATCTATGGTCTACATTTGAAGAAATAGTTCAGAATTCTCTACTACATTGTAAGTTACTTGCTAATAGAGATTGG
3521 GCATTATTATGTACTACTCCCCTTCTCACATCCTACCCAAAGTACACAAGGCCGTAGTAAAATACTGTTGCTACTAAAAA
3601 CTAAACATACTGTGGTTGCTAATGTCCTTTACATCTTCAGCCTATAGGGAATGGTACAGGCAGAAACAAGCACCATTAAG
3681 TATATTATCATCAGTAGTGAGATCTGTATGATTAGGATATCTTTGCTTAAGCCCCCAAAGGAAAAATTCTCTAGCATTAA
3761 AAACATGGCTGGAACATAGCTAAGCAGTTAACCTAATTAGTAGACTTATTGTTAACGTTCAGTCCTAAAAATGAAAAGCT
3841 TCAGTTGGGAGTAGAAAATATACTATGCTGGTATATAGAGCAACAAATACCCTGATGAGATAAAATGAAGTAGAAACTTA
3921 CCATTTGACATTATTTGACTTTCATACATGCTACTGAAAAGTCTAGGTTTAGCTAAGAAGCATAAATAATGGCAGTACTT
4001 GTAGAGGAAAGAACATACCAGCTAAAACAAGAACTGTAATGAATATAATGGAAAGTGTTTGGAGCTTGAATACTTGGCTT
4081 CAAAAATCTGGCTTTGCCATTTACTGTTAAAAAAATATCTGAGAATTTATCTCAGGCTGTAAAACAGAGAAGTCATACCA
4161 ATTTCAAGAATAAAATATGATATAAAGAATTGTTGAAGCCAAAATATCCAGAAATAAACAGAATGGAAGGTATCATTGCT
4241 ATAATTATCTTTTCAGAATAAAAAATAGAGTATTCTTTATCCTTTCTGTTGTCTCACATGACAAGCATGGGATGGTGAGG
4321 AAATGGCATATTGCCTATGTTCGCCGCCCCACCCCCTTAGTTCCACCACCCCTTCACCGTCACCCCCAGTTCACTAGTGT
4401 ATCAGAATGCATCTTCAGAATTACACACTGAAGATACAAAAGGTCCAGTTGGTAAGCTCATCAGTAAATAACAAGGCTTT
4481 GAAATCTGACAAATTAGCTATTTTTGTAGGAAGATAATAGAACAGCAAGATGGAAGACAAGTGATGAGTATCATCTGTTT
4561 TGAGGTTGACAAGGTGTGACATAACCCTGTTAATAGACACAAGTAAAAGAAAATCATACTAGGATTGGATATTAGTGAGC
4641 GAGCACCGACCAGTAGAAACAACAACAGCATAAATCTGTTATTTAAGTATCCCAATAATGAGGTTAAAAAAAAAAAAAAA
4721 ACAGAACAAAGCATGAAAAGACCACAATTAGTGCTGGCTATGCTTAGAGAGGAGCAGTCTCTTGGTAAACTCAGGCAGTG
4801 ATGATGAACAGAAAATGGCCGACTGATACTGTAATAGAGGCATAGAACTAAGGACACTCCGTGAGCTGGCATAAATACAG
4881 GGGAGTCTTTAAGACTGAAAAAAGTTCATGGGTATGACACTTAATATGACTCAACATTACTGCAGAATTTTAAAGCAAAC
4961 ATGAAAGCTTGAGAATAAACACTAGTCCCTCTACTTCAAGAAAAAGCAGAACCTGTACTAGAACATGAAGAACTTAGAGA
5041 TCAAAAGACAGCCAGAACTATGATGAAATATTTTGAAAGCAGTGGGCACATTTTTAAAGATTTTTTTTGGAGAACTTTAT
5121 GAGGCTGTATGTATAATTCCTATATGTAATTTTATAGGAATTCTTAACTGAAAGTAGTTATCAACTGCTACTTATCAGGA
5201 GCAGTGTTATTAGGGATTTTAAGTTAGGCATGTAGAAAACTTTCTGACAAAAGGGCTATTGAACTCCAGCCAGTTCCCAG
5281 TGAATCTCCAGGAGGCACCTTAGAAGTCTTCACAAGCTGAATACCATGTCTTTAGGGTGTCCAAATGCTTCTGTCTTGGG
5361 GGAGAGATGAGAGATGACTGGGTGCCTTTCCACTCAGAACACAGTAGACCACTCACTATTTATGACCAAGCCTCACTTCT
5441 TTTCTATTACAGTTACAGATTCTTTTTTAGTCTGGAAGTTAGGGTAAATAAAATTTGTATGTTTGATTTTTCTCTTAGGA
5521 ATGTTTTCTCATCTTAACTCTTATGTTATCTTTATGGCCAACAGATTTGCTCAGAATATATCATCAAAATATATGTATTG
5601 TATTTTGTAAAGGTGAAAGGATCGAAATACCACTTTGACAGTTATAAACCAGAGTAGATTTGAGAACTGATTGCTCACAT
5681 CACACTTACGAATAGTCTCAGAAGCCTTTAAGAGAAACTTACTTCTCAATGGACACTTAGAAGAATTTGATGATCTTACT
5761 GTCATAAAATCAGTAATGAAATTCTCAGCAAAACTATTTGGTAAACATTGCACCCTGTATTTTTACCCAACATCTTGTTA
5841 TGAAAATTATCAAATACATTAAAAAGTTAAAATAATTTTATAGTGTACTCACTACCTAGATGCTAATTAGCATTACCTAT
5921 GCTTGCTTTGTCACATATCCATTCATCATTTCATATTATTATTTGATGCATTTTAAATTGCATATCATTAACTAGAGTTC
6001 ATTGTTGGCTTTTTTACATAAAATTAGCATGCAATGAAGTGCATAGAAATATGTGTTCACTGAGGTTTGGCAAATGCATA
6081 TAGTGCTATGGAAATAGGAAACGTTATCACCACCCTAGAAAGTTTCCACACTGCCCTTTCCAGTCAATTCCTGTCCCTAC
6161 TTGACCCTCAAAGGCAACCACTGTTCCTTTTTCTACCATAAGATTTTTCTGTTCTAAAACTTTATATAAATAGAGTCACG
6241 CAACATGTACGCTTTTCTACAAGGCTTCATTTTTTTATTGCTGTTCTTTTTTATTGCTGAGTAGTATTCCACTGTATGAC
6321 AATATTACAGTTTGTTTTCTTAATTTCCTATTATTGATAGATACCTGGGCTGTTTCCAGGATTGGCCATTATAAATAAAG
6401 CTGCTATGACCATTCTTACGTAAGTCTTTGTGAACATAGGTTTTCATTTCTTTGCAGTAAATTCCTTGGATTAGAATTGC
6481 TGGGTCACAGGGTAGTTTTAAAAGAAACTGCCATACCTTTTTCCAGTTCAGTTTTATTGTGCCCTGTATTTTGTATTTTG
6561 ATGTGCATAAAGGTGTAAACTATTTTTATGATCCATATTGAAGTATTAGAAGAAGTGAGTTTGGAATAACAATGGCATTG
6641 TTCATGGTCAAGGATGACAATTGGAACTATCTGAGGAAAGCAAAGACCTGTCTGCCCCAGACAGCTCCTCAAGGGGTTCC
6721 TATGCCTGAAACTTTAGCAATATTTCACTCCTTGAAAGGTTAAAGCCCAACCATGGTGATATGTTAGCTAGAAGAAACAG
6801 CACTGGTTTGTTTATGTTACTAACTTTCACCACCCGTTTTCAGTAGGTAAAGTAAGACTGATCATTGAACAGAAAAGGTT
6881 ATTTCTGTGATGAGGTTGAGGGGGTAGTGGAAAGCATGTATTGCTAGTAAGCCCCAGGTACAGCTATGTGAGAGAGAGTC
6961 ACCTGGACAGGGAAGTCCCCCAAATGGTGGCCAGAAGAGCAGAAAACGGGGTGGGAAAAATTCTACCTCACAGTTTTGCA
7041 TAGGGGATAGCTATGCTTTTACGGGACATTTTAGCGTTTAAAAATATTTTCAATATTGTCTCTTTATTCAATACCACCCA
7121 GCTGTAGTTTTTTCACACTCTGATGACTCTCTTATCCACTCTTTTACCTCTCCCAGCTGTTCTATTACATACAGCATTCA
7201 CCTGTATTAGTCTATAGAATTATAATCATCTGTGTGTTTCTAATGCTCATTTTCAAAAATATGTATGGTTTATTCGATTT
7281 TTCCTATTAAAATTTTAAGGGCTGGGAAATTTGGCTTCTACTGTAAATCCTTATAATGTTCCACACATTGTAAATATGCA
7361 ATAAAAATGTTAACAACTATAATGGCAGCAGGTTTTGGTATGTATTTCTTTGATATATTGTCACTTTGGACAATAAGTTT
7441 GATTTCTGTTAATAAAAGTTGTTCATAAAATCTAGGGAGAATTAAGTCACACTGGTCTCTATAAGATAATCTGATGAATT
7521 CTGCATCTTTGAATCAATTTGAGTTATTTTTTGTAAAGGTTTAAATTGTTTCTAACAGTGTTACCTAAAACCTTTCATTA
7601 AATCAAAAATGTAACTTGTATATTCTGAAATAACCTGGAGTCTTAGAAGACAGAGGCTTCTGCTTCCCTCTCCCGTGACC
7681 CCAACAATCCCTTCCCACAGGCTTGGCACAGAAGTTCAGTGCTTTCTCTACGTCTCATGTTGTCAGAAATAGGTTCTCAC
7761 CATAATAGACAGTGGTGAAATTTCCATTGTTCCTACTGAGAAGTCCATTTTTAAGGCATCAAAGGTGAATGTGTATTTAG
7841 GGATGGAGGAGGCATATTACAACAAAGCTGTATTTAAAATAACACAATCATATCATGCTATAAACAATAGCAGTTCCAGA
7921 ATGGCTACTAAGGATTTTGGACTGCCAGACTTTGGAAATTGGCAAGCCTTATACCTTGTCCAATGAAGTTAAGTACATTT
8001 GAGTGACAGTTCAACATACAAGCAAAAAAATATATAGAAGACATTGTACATTTGTTATTAATGGACATGTTTACTTTACA
8081 TGTTAGAGTATCCATCCATCTCTAGGTTTTCCATTAGATGCTTCATTGTATCCACAAACCTGTTTCAAACCATTGAAGTG
8161 ATCTTACCATTGTGTTTGTTCAAAATAAAATTGGGAGAAAATGTGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUA-AUACACGACGAu 5'
              | |::|  || ||||||| 
Target 5' cctcATCTGTAAATTTGCTGCTg 3'
2608 - 2630 150.00 -10.60
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||  :: |||| |||||:| 
Target 5' ttCATTTTTTTAT-TGCTGTTc 3'
6266 - 6286 139.00 -7.30
3
miRNA  3' guGU-UUGG---UAA----UACAC-GACGAu 5'
            || ||||   |||    ||||| ||||| 
Target 5' cgCATAACCCTAATTTAAGATGTGCCTGCTg 3'
1617 - 1647 134.00 -16.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26994396 39 COSMIC
COSN31500410 40 COSMIC
COSN30524712 49 COSMIC
COSN31582284 53 COSMIC
COSN30472549 58 COSMIC
COSN31559332 131 COSMIC
COSN30544214 182 COSMIC
COSN30517956 185 COSMIC
COSN30193836 186 COSMIC
COSN29610650 342 COSMIC
COSN31537423 481 COSMIC
COSN1808950 534 COSMIC
COSN31546544 578 COSMIC
COSN31606993 583 COSMIC
COSN31479764 593 COSMIC
COSN31609392 794 COSMIC
COSN31485641 804 COSMIC
COSN31961755 832 COSMIC
COSN32064113 884 COSMIC
COSN28201211 1096 COSMIC
COSN17508132 1182 COSMIC
COSN24775181 1388 COSMIC
COSN5490264 1420 COSMIC
COSN2512987 1679 COSMIC
COSN5127898 2137 COSMIC
COSN16456092 2683 COSMIC
COSN6156318 2803 COSMIC
COSN23748896 2896 COSMIC
COSN20097462 2919 COSMIC
COSN9118835 2927 COSMIC
COSN23330721 2931 COSMIC
COSN27525787 2950 COSMIC
COSN15660885 3057 COSMIC
COSN7148922 3179 COSMIC
COSN4799481 3532 COSMIC
COSN20097460 3762 COSMIC
COSN9118834 4166 COSMIC
COSN7148921 4351 COSMIC
COSN1229546 4706 COSMIC
COSN20097459 4706 COSMIC
COSN7148920 4810 COSMIC
COSN20901552 5163 COSMIC
COSN29145753 5203 COSMIC
COSN9118833 5223 COSMIC
COSN32063028 5295 COSMIC
COSN25410573 5603 COSMIC
COSN16830024 5756 COSMIC
COSN22535052 5939 COSMIC
COSN9118832 5944 COSMIC
COSN20601660 6329 COSMIC
COSN25904552 6500 COSMIC
COSN16246891 6508 COSMIC
COSN9118831 6629 COSMIC
COSN25115178 6658 COSMIC
COSN15698828 6779 COSMIC
COSN19298383 6965 COSMIC
COSN32063885 7008 COSMIC
COSN32064408 7086 COSMIC
COSN18793209 7173 COSMIC
COSN9118828 7698 COSMIC
COSN28127414 7870 COSMIC
COSN6156316 8050 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1250918072 4 dbSNP
rs113531681 12 dbSNP
rs200218736 13 dbSNP
rs771420613 14 dbSNP
rs1018691788 16 dbSNP
rs1162780605 16 dbSNP
rs573293839 17 dbSNP
rs527474166 25 dbSNP
rs746630865 26 dbSNP
rs1368248559 28 dbSNP
rs1328381944 31 dbSNP
rs377245582 34 dbSNP
rs749077006 39 dbSNP
rs370840815 40 dbSNP
rs745654466 44 dbSNP
rs1459327213 45 dbSNP
rs767366852 47 dbSNP
rs1286040083 48 dbSNP
rs775485441 51 dbSNP
rs1245924174 60 dbSNP
rs546269157 71 dbSNP
rs1026944900 73 dbSNP
rs913204171 75 dbSNP
rs1315198497 82 dbSNP
rs1057173172 87 dbSNP
rs1446055762 96 dbSNP
rs1190506538 101 dbSNP
rs938749734 108 dbSNP
rs1472818112 110 dbSNP
rs995119151 114 dbSNP
rs899134187 131 dbSNP
rs1044402600 141 dbSNP
rs1370517390 148 dbSNP
rs1162876200 155 dbSNP
rs1383268209 157 dbSNP
rs1421358267 166 dbSNP
rs532447261 173 dbSNP
rs1169003376 178 dbSNP
rs980668072 182 dbSNP
rs963539162 183 dbSNP
rs895901309 185 dbSNP
rs77673142 186 dbSNP
rs769514446 198 dbSNP
rs745521268 213 dbSNP
rs909474754 217 dbSNP
rs780814460 218 dbSNP
rs1379762727 222 dbSNP
rs1241405298 223 dbSNP
rs540592862 223 dbSNP
rs1348905864 226 dbSNP
rs1203041802 235 dbSNP
rs1461417682 242 dbSNP
rs756075941 242 dbSNP
rs756818104 253 dbSNP
rs746552349 262 dbSNP
rs951056580 267 dbSNP
rs144257577 279 dbSNP
rs1182347502 284 dbSNP
rs1249384725 287 dbSNP
rs1363039917 287 dbSNP
rs1206612170 288 dbSNP
rs1468361062 290 dbSNP
rs997976497 295 dbSNP
rs1403147996 297 dbSNP
rs1469419168 302 dbSNP
rs1334774865 307 dbSNP
rs1308003772 310 dbSNP
rs1402482187 312 dbSNP
rs1296390118 324 dbSNP
rs965495369 328 dbSNP
rs149322813 334 dbSNP
rs1295306828 335 dbSNP
rs1415591099 336 dbSNP
rs1350303876 342 dbSNP
rs939145740 345 dbSNP
rs555275313 347 dbSNP
rs1464034975 350 dbSNP
rs574018843 351 dbSNP
rs1021507174 353 dbSNP
rs1323789569 353 dbSNP
rs1458682769 353 dbSNP
rs542866548 353 dbSNP
rs1010093052 356 dbSNP
rs1249700484 358 dbSNP
rs891821236 359 dbSNP
rs1042673132 361 dbSNP
rs1200732254 362 dbSNP
rs1355552224 369 dbSNP
rs1163492629 383 dbSNP
rs1057057605 388 dbSNP
rs946642521 396 dbSNP
rs1174466439 398 dbSNP
rs1459381584 399 dbSNP
rs1425914306 406 dbSNP
rs938813647 414 dbSNP
rs905950433 415 dbSNP
rs1044463390 427 dbSNP
rs942207223 430 dbSNP
rs1472053579 437 dbSNP
rs1324629416 441 dbSNP
rs760341090 443 dbSNP
rs974379951 447 dbSNP
rs1280914780 457 dbSNP
rs1319440463 460 dbSNP
rs1178656444 461 dbSNP
rs929543469 468 dbSNP
rs115485016 474 dbSNP
rs1211508101 476 dbSNP
rs1269341307 477 dbSNP
rs1264743047 479 dbSNP
rs1490114079 488 dbSNP
rs911607898 493 dbSNP
rs987184252 498 dbSNP
rs976424652 503 dbSNP
rs190047046 505 dbSNP
rs780679769 506 dbSNP
rs1371347461 509 dbSNP
rs1275100808 513 dbSNP
rs1164729388 523 dbSNP
rs1365363597 538 dbSNP
rs1234190982 541 dbSNP
rs995442175 544 dbSNP
rs1335390261 549 dbSNP
rs963643371 550 dbSNP
rs1023260890 556 dbSNP
rs968983277 557 dbSNP
rs1382357364 570 dbSNP
rs1294252157 578 dbSNP
rs1305194762 580 dbSNP
rs558412222 583 dbSNP
rs1292347672 590 dbSNP
rs1010147610 591 dbSNP
rs1219939446 596 dbSNP
rs895825098 597 dbSNP
rs1057196820 598 dbSNP
rs1396113569 600 dbSNP
rs1486323428 600 dbSNP
rs1186078606 604 dbSNP
rs891705511 605 dbSNP
rs1425579069 606 dbSNP
rs185569097 619 dbSNP
rs998966498 620 dbSNP
rs1385121444 628 dbSNP
rs370208011 628 dbSNP
rs1042207133 629 dbSNP
rs1346101834 635 dbSNP
rs1454003386 652 dbSNP
rs905836745 661 dbSNP
rs946582798 665 dbSNP
rs566401278 671 dbSNP
rs1315695756 672 dbSNP
rs1038938211 689 dbSNP
rs942999450 691 dbSNP
rs942108382 693 dbSNP
rs887987607 694 dbSNP
rs1317249567 695 dbSNP
rs1161048800 698 dbSNP
rs1215357729 701 dbSNP
rs1047920202 705 dbSNP
rs1266373329 707 dbSNP
rs929427260 709 dbSNP
rs1469751603 717 dbSNP
rs911576865 721 dbSNP
rs1443344313 727 dbSNP
rs1180983741 733 dbSNP
rs1255033394 736 dbSNP
rs987598731 739 dbSNP
rs1157984400 748 dbSNP
rs976335568 751 dbSNP
rs1336805439 754 dbSNP
rs141672069 754 dbSNP
rs910873728 757 dbSNP
rs1450395079 760 dbSNP
rs1259146589 762 dbSNP
rs1241419555 768 dbSNP
rs766740111 770 dbSNP
rs1222959535 775 dbSNP
rs1305210928 776 dbSNP
rs1303117603 779 dbSNP
rs193136450 786 dbSNP
rs968493382 791 dbSNP
rs1021447907 794 dbSNP
rs988611101 797 dbSNP
rs1373745800 799 dbSNP
rs535815711 800 dbSNP
rs1326015365 803 dbSNP
rs919023636 804 dbSNP
rs149983470 807 dbSNP
rs1382362350 808 dbSNP
rs1481215013 810 dbSNP
rs1176652866 813 dbSNP
rs1428015178 813 dbSNP
rs1290304469 817 dbSNP
rs963574013 818 dbSNP
rs1002780236 820 dbSNP
rs1330855676 822 dbSNP
rs1355030236 824 dbSNP
rs139468614 826 dbSNP
rs1376914409 829 dbSNP
rs1023189070 836 dbSNP
rs1171513902 839 dbSNP
rs1347093192 840 dbSNP
rs1455533088 845 dbSNP
rs1321569695 850 dbSNP
rs536885183 852 dbSNP
rs1216373896 857 dbSNP
rs1395546740 857 dbSNP
rs1274406485 875 dbSNP
rs1307415718 876 dbSNP
rs1013175224 877 dbSNP
rs960002946 880 dbSNP
rs571416874 884 dbSNP
rs1248850087 888 dbSNP
rs1490601078 907 dbSNP
rs1035705036 909 dbSNP
rs1022964108 917 dbSNP
rs1169127353 921 dbSNP
rs551240977 921 dbSNP
rs887871703 925 dbSNP
rs1207182880 931 dbSNP
rs17363183 953 dbSNP
rs1043568949 954 dbSNP
rs1209102842 963 dbSNP
rs115996092 968 dbSNP
rs547040606 979 dbSNP
rs1041052072 983 dbSNP
rs1227300093 986 dbSNP
rs188120353 989 dbSNP
rs1270861753 991 dbSNP
rs752847651 992 dbSNP
rs1297080577 993 dbSNP
rs1213346378 998 dbSNP
rs34552415 1008 dbSNP
rs1382497592 1011 dbSNP
rs1374396814 1015 dbSNP
rs1360667185 1017 dbSNP
rs1222205097 1020 dbSNP
rs910917258 1025 dbSNP
rs1449525680 1032 dbSNP
rs1194791834 1035 dbSNP
rs1436298117 1038 dbSNP
rs1375807471 1041 dbSNP
rs1049397572 1046 dbSNP
rs1474768609 1049 dbSNP
rs1184764885 1057 dbSNP
rs1386985376 1057 dbSNP
rs947018707 1059 dbSNP
rs1162682253 1065 dbSNP
rs1038906926 1069 dbSNP
rs988491877 1070 dbSNP
rs1319169633 1073 dbSNP
rs1325978936 1075 dbSNP
rs1371479348 1079 dbSNP
rs1195336650 1087 dbSNP
rs1384161411 1090 dbSNP
rs561604012 1095 dbSNP
rs1313376956 1096 dbSNP
rs1353242037 1097 dbSNP
rs544913123 1099 dbSNP
rs1206553319 1100 dbSNP
rs1284496288 1103 dbSNP
rs1445961305 1105 dbSNP
rs955903658 1108 dbSNP
rs1209218656 1109 dbSNP
rs1486880232 1120 dbSNP
rs1281464360 1121 dbSNP
rs1195786741 1125 dbSNP
rs114935060 1127 dbSNP
rs1051418736 1128 dbSNP
rs981805630 1129 dbSNP
rs565480418 1130 dbSNP
rs1182843350 1131 dbSNP
rs1383178541 1138 dbSNP
rs1023272911 1141 dbSNP
rs1006226168 1144 dbSNP
rs919003187 1146 dbSNP
rs1291012475 1152 dbSNP
rs973566570 1154 dbSNP
rs1048026 1159 dbSNP
rs1335260787 1161 dbSNP
rs767446727 1164 dbSNP
rs1240174420 1169 dbSNP
rs1279845925 1171 dbSNP
rs183795869 1175 dbSNP
rs1226130661 1176 dbSNP
rs1429943405 1181 dbSNP
rs1461347924 1182 dbSNP
rs1203011522 1185 dbSNP
rs1253956864 1186 dbSNP
rs552626638 1187 dbSNP
rs1182240756 1195 dbSNP
rs1398473322 1197 dbSNP
rs1471733971 1199 dbSNP
rs960264775 1203 dbSNP
rs1466173432 1206 dbSNP
rs1036394834 1212 dbSNP
rs760164398 1215 dbSNP
rs902033611 1216 dbSNP
rs977441821 1222 dbSNP
rs1392394260 1225 dbSNP
rs1040542342 1232 dbSNP
rs1186137243 1233 dbSNP
rs1407648892 1245 dbSNP
rs1284778814 1246 dbSNP
rs548235702 1249 dbSNP
rs1323673222 1250 dbSNP
rs1008258761 1254 dbSNP
rs191294069 1261 dbSNP
rs1044327549 1263 dbSNP
rs1341398182 1264 dbSNP
rs1196233289 1266 dbSNP
rs77975658 1272 dbSNP
rs536951074 1275 dbSNP
rs549434955 1277 dbSNP
rs1436588441 1282 dbSNP
rs764081828 1287 dbSNP
rs1253221865 1289 dbSNP
rs1195901589 1290 dbSNP
rs1394813808 1301 dbSNP
rs1446674 1301 dbSNP
rs371302650 1301 dbSNP
rs199702268 1302 dbSNP
rs1327632458 1305 dbSNP
rs202079481 1305 dbSNP
rs1052826438 1308 dbSNP
rs146277362 1311 dbSNP
rs1017379848 1316 dbSNP
rs1224442440 1319 dbSNP
rs1007372038 1321 dbSNP
rs1278754975 1324 dbSNP
rs1490252921 1329 dbSNP
rs1189630088 1331 dbSNP
rs928493051 1332 dbSNP
rs534491597 1334 dbSNP
rs566984582 1335 dbSNP
rs1388849205 1338 dbSNP
rs1329506887 1340 dbSNP
rs928950062 1341 dbSNP
rs915850698 1343 dbSNP
rs1365268166 1344 dbSNP
rs1457121635 1348 dbSNP
rs531019124 1350 dbSNP
rs984679755 1350 dbSNP
rs1167351831 1357 dbSNP
rs1382269325 1363 dbSNP
rs1294855068 1364 dbSNP
rs1362928265 1365 dbSNP
rs952052776 1366 dbSNP
rs1315481985 1367 dbSNP
rs897484024 1376 dbSNP
rs377732360 1378 dbSNP
rs547101743 1379 dbSNP
rs1486271736 1380 dbSNP
rs1204614187 1382 dbSNP
rs1246200889 1386 dbSNP
rs1446976331 1387 dbSNP
rs1414724103 1390 dbSNP
rs530159521 1391 dbSNP
rs941773096 1392 dbSNP
rs915691372 1399 dbSNP
rs1422410982 1400 dbSNP
rs1162305246 1418 dbSNP
rs1158371837 1419 dbSNP
rs1026298039 1429 dbSNP
rs561266912 1430 dbSNP
rs972179892 1435 dbSNP
rs1454547411 1436 dbSNP
rs1337260404 1445 dbSNP
rs1234927075 1452 dbSNP
rs1179882419 1457 dbSNP
rs778314882 1461 dbSNP
rs116107223 1467 dbSNP
rs1309494166 1474 dbSNP
rs1317754926 1477 dbSNP
rs186870215 1478 dbSNP
rs938866409 1482 dbSNP
rs1204913973 1483 dbSNP
rs928869713 1485 dbSNP
rs978080418 1493 dbSNP
rs967384289 1501 dbSNP
rs563531919 1502 dbSNP
rs777810377 1502 dbSNP
rs1352636668 1505 dbSNP
rs182591187 1506 dbSNP
rs1233559543 1512 dbSNP
rs75159411 1514 dbSNP
rs112204979 1516 dbSNP
rs1470659465 1524 dbSNP
rs1177118028 1528 dbSNP
rs1052712771 1529 dbSNP
rs1445652793 1530 dbSNP
rs1299669566 1531 dbSNP
rs1323983499 1536 dbSNP
rs756501629 1541 dbSNP
rs573339593 1543 dbSNP
rs964080814 1546 dbSNP
rs934296653 1550 dbSNP
rs1286657128 1552 dbSNP
rs1325802833 1553 dbSNP
rs775358789 1555 dbSNP
rs193057999 1559 dbSNP
rs781412281 1565 dbSNP
rs1207160561 1566 dbSNP
rs1233853302 1567 dbSNP
rs1480485120 1579 dbSNP
rs542310138 1585 dbSNP
rs1181077411 1586 dbSNP
rs1249125737 1588 dbSNP
rs1045869877 1590 dbSNP
rs17454031 1600 dbSNP
rs1399165132 1603 dbSNP
rs1423772190 1609 dbSNP
rs1410706414 1610 dbSNP
rs755083354 1611 dbSNP
rs1172385168 1615 dbSNP
rs1159561296 1617 dbSNP
rs188495954 1618 dbSNP
rs993841214 1620 dbSNP
rs930541461 1621 dbSNP
rs867993632 1624 dbSNP
rs769742856 1637 dbSNP
rs1240994366 1638 dbSNP
rs1365529004 1642 dbSNP
rs373014601 1644 dbSNP
rs1213283331 1649 dbSNP
rs1341949845 1650 dbSNP
rs972067051 1650 dbSNP
rs369812354 1651 dbSNP
rs966401565 1656 dbSNP
rs1019046443 1658 dbSNP
rs986591798 1665 dbSNP
rs1476743048 1667 dbSNP
rs953596536 1668 dbSNP
rs1005912853 1671 dbSNP
rs894223182 1673 dbSNP
rs1055561298 1674 dbSNP
rs1448704606 1685 dbSNP
rs1011148605 1696 dbSNP
rs1367135027 1699 dbSNP
rs745472956 1699 dbSNP
rs183987038 1700 dbSNP
rs1286474735 1704 dbSNP
rs1348264074 1707 dbSNP
rs1031175426 1709 dbSNP
rs998496768 1710 dbSNP
rs1365115692 1712 dbSNP
rs1345665388 1714 dbSNP
rs560756103 1714 dbSNP
rs557746459 1717 dbSNP
rs139933029 1718 dbSNP
rs565872820 1721 dbSNP
rs1288661942 1729 dbSNP
rs776404680 1733 dbSNP
rs770532041 1738 dbSNP
rs746526661 1742 dbSNP
rs914854524 1746 dbSNP
rs1248045024 1748 dbSNP
rs990107810 1749 dbSNP
rs777203523 1750 dbSNP
rs911270193 1753 dbSNP
rs894346830 1762 dbSNP
rs755452147 1763 dbSNP
rs1162933036 1764 dbSNP
rs1411895225 1766 dbSNP
rs986846812 1767 dbSNP
rs1048915829 1771 dbSNP
rs1387945599 1774 dbSNP
rs1299220985 1775 dbSNP
rs1339236454 1778 dbSNP
rs1384042049 1781 dbSNP
rs1244511344 1784 dbSNP
rs1283294526 1790 dbSNP
rs17454024 1793 dbSNP
rs1461132163 1795 dbSNP
rs1327812543 1797 dbSNP
rs919177319 1797 dbSNP
rs1030593167 1803 dbSNP
rs578199369 1805 dbSNP
rs962250705 1807 dbSNP
rs1373995947 1811 dbSNP
rs944736956 1822 dbSNP
rs1016224822 1825 dbSNP
rs1176134091 1828 dbSNP
rs986271754 1831 dbSNP
rs74387164 1833 dbSNP
rs1179293964 1837 dbSNP
rs1184188939 1840 dbSNP
rs115428394 1842 dbSNP
rs1263389012 1844 dbSNP
rs1337864959 1845 dbSNP
rs989612315 1852 dbSNP
rs1288565686 1853 dbSNP
rs1055529877 1858 dbSNP
rs956847115 1866 dbSNP
rs1264995938 1868 dbSNP
rs551013420 1871 dbSNP
rs1199764442 1872 dbSNP
rs906982835 1876 dbSNP
rs1276268894 1879 dbSNP
rs1484588911 1880 dbSNP
rs1183208862 1881 dbSNP
rs1251353414 1894 dbSNP
rs1004192688 1901 dbSNP
rs1042262024 1905 dbSNP
rs971109044 1908 dbSNP
rs1201699515 1909 dbSNP
rs946276519 1918 dbSNP
rs1012700825 1937 dbSNP
rs16866637 1939 dbSNP
rs1272396964 1942 dbSNP
rs1399144934 1943 dbSNP
rs1410851100 1943 dbSNP
rs1308331926 1944 dbSNP
rs571939918 1947 dbSNP
rs1048803498 1949 dbSNP
rs1407555460 1967 dbSNP
rs1212834496 1968 dbSNP
rs765123695 1981 dbSNP
rs1054641625 1982 dbSNP
rs1279126359 1988 dbSNP
rs1414376061 1990 dbSNP
rs942662785 1997 dbSNP
rs111441742 1998 dbSNP
rs986817800 2006 dbSNP
rs1273574445 2011 dbSNP
rs955628687 2018 dbSNP
rs918702614 2030 dbSNP
rs1224958730 2033 dbSNP
rs1432647231 2044 dbSNP
rs911931400 2044 dbSNP
rs1050866554 2046 dbSNP
rs149971303 2048 dbSNP
rs931963280 2048 dbSNP
rs879432529 2051 dbSNP
rs551775364 2052 dbSNP
rs972304349 2055 dbSNP
rs3943573 2058 dbSNP
rs961913891 2067 dbSNP
rs1016150694 2070 dbSNP
rs989496526 2075 dbSNP
rs1006161980 2079 dbSNP
rs958331562 2080 dbSNP
rs1034005560 2081 dbSNP
rs1002568404 2085 dbSNP
rs1167733726 2089 dbSNP
rs528729917 2096 dbSNP
rs906946415 2099 dbSNP
rs924095819 2100 dbSNP
rs1411109925 2103 dbSNP
rs1339748505 2104 dbSNP
rs756493058 2106 dbSNP
rs982421855 2107 dbSNP
rs192092564 2110 dbSNP
rs1488236849 2112 dbSNP
rs150557895 2120 dbSNP
rs1474012530 2130 dbSNP
rs1259364408 2134 dbSNP
rs1465752194 2137 dbSNP
rs528970985 2138 dbSNP
rs1054610423 2143 dbSNP
rs1182175501 2146 dbSNP
rs563016760 2170 dbSNP
rs1188427929 2175 dbSNP
rs1388754617 2177 dbSNP
rs942965619 2185 dbSNP
rs1166553786 2191 dbSNP
rs372291741 2194 dbSNP
rs1368669072 2204 dbSNP
rs767746936 2209 dbSNP
rs1051028090 2214 dbSNP
rs934045734 2216 dbSNP
rs1319782500 2217 dbSNP
rs369927320 2218 dbSNP
rs769271734 2219 dbSNP
rs543434961 2224 dbSNP
rs757247740 2225 dbSNP
rs972845972 2226 dbSNP
rs1454374684 2227 dbSNP
rs1313778839 2231 dbSNP
rs1321368377 2240 dbSNP
rs940496280 2251 dbSNP
rs374708520 2252 dbSNP
rs1329903468 2256 dbSNP
rs1208690407 2259 dbSNP
rs1246720600 2261 dbSNP
rs1462978413 2262 dbSNP
rs984653620 2266 dbSNP
rs185289148 2267 dbSNP
rs1332862353 2270 dbSNP
rs1162201678 2272 dbSNP
rs182094300 2276 dbSNP
rs554049531 2279 dbSNP
rs540966573 2280 dbSNP
rs1386345206 2288 dbSNP
rs1050341836 2289 dbSNP
rs1396924712 2291 dbSNP
rs545146488 2294 dbSNP
rs1373291311 2295 dbSNP
rs931990001 2305 dbSNP
rs78605128 2306 dbSNP
rs757076638 2307 dbSNP
rs1227844643 2315 dbSNP
rs1266253911 2318 dbSNP
rs763889162 2324 dbSNP
rs1163499288 2329 dbSNP
rs981508525 2336 dbSNP
rs141704180 2338 dbSNP
rs1482468810 2339 dbSNP
rs1020413321 2346 dbSNP
rs1179796061 2346 dbSNP
rs924143373 2347 dbSNP
rs949538967 2349 dbSNP
rs982694153 2349 dbSNP
rs1416137985 2350 dbSNP
rs1176644414 2351 dbSNP
rs1010003613 2352 dbSNP
rs893274241 2355 dbSNP
rs762944463 2359 dbSNP
rs1033127453 2361 dbSNP
rs991057683 2362 dbSNP
rs1007036477 2364 dbSNP
rs1371412822 2365 dbSNP
rs1409367358 2369 dbSNP
rs1286564415 2381 dbSNP
rs890032499 2382 dbSNP
rs189881136 2389 dbSNP
rs958388819 2390 dbSNP
rs1220361867 2408 dbSNP
rs1301151174 2411 dbSNP
rs1207051228 2412 dbSNP
rs556077299 2412 dbSNP
rs185568670 2443 dbSNP
rs961798401 2446 dbSNP
rs765318888 2447 dbSNP
rs897173222 2448 dbSNP
rs181347769 2449 dbSNP
rs1249017685 2451 dbSNP
rs1478705146 2454 dbSNP
rs537492205 2463 dbSNP
rs1191761745 2467 dbSNP
rs1424355360 2471 dbSNP
rs1009166850 2473 dbSNP
rs1170256114 2479 dbSNP
rs941413040 2480 dbSNP
rs1429371876 2481 dbSNP
rs1245755693 2483 dbSNP
rs776359301 2491 dbSNP
rs1437275130 2492 dbSNP
rs1293519688 2499 dbSNP
rs909994202 2501 dbSNP
rs1366132025 2502 dbSNP
rs1231176567 2503 dbSNP
rs1298843909 2503 dbSNP
rs1341843739 2509 dbSNP
rs571546357 2515 dbSNP
rs1243036271 2517 dbSNP
rs1270436542 2519 dbSNP
rs1452886656 2523 dbSNP
rs1221678607 2524 dbSNP
rs1245553486 2526 dbSNP
rs1487481739 2530 dbSNP
rs1190377822 2531 dbSNP
rs937193308 2537 dbSNP
rs555816832 2546 dbSNP
rs1378228421 2547 dbSNP
rs1448612220 2556 dbSNP
rs1167020933 2559 dbSNP
rs981382787 2562 dbSNP
rs1324662858 2567 dbSNP
rs971446443 2569 dbSNP
rs1348162039 2574 dbSNP
rs1019958987 2588 dbSNP
rs1364979987 2592 dbSNP
rs1433325750 2597 dbSNP
rs996033296 2602 dbSNP
rs1395993454 2606 dbSNP
rs1293807336 2612 dbSNP
rs988909401 2614 dbSNP
rs1343286454 2615 dbSNP
rs957100036 2618 dbSNP
rs1032762334 2620 dbSNP
rs1007003869 2631 dbSNP
rs1248565047 2632 dbSNP
rs1394348024 2633 dbSNP
rs954218460 2636 dbSNP
rs1030305201 2638 dbSNP
rs1186461854 2640 dbSNP
rs1238923672 2642 dbSNP
rs1473268639 2643 dbSNP
rs148007130 2644 dbSNP
rs897429866 2649 dbSNP
rs1037018707 2651 dbSNP
rs935297573 2652 dbSNP
rs1458864678 2653 dbSNP
rs1160622879 2655 dbSNP
rs1005597716 2661 dbSNP
rs1210723004 2683 dbSNP
rs1456047114 2686 dbSNP
rs1336589722 2688 dbSNP
rs1341393870 2693 dbSNP
rs1448362837 2696 dbSNP
rs1485661626 2701 dbSNP
rs1283206326 2703 dbSNP
rs1353095477 2711 dbSNP
rs888525984 2712 dbSNP
rs533767431 2713 dbSNP
rs772708599 2729 dbSNP
rs949595676 2730 dbSNP
rs1280503154 2740 dbSNP
rs1442769352 2741 dbSNP
rs1187160265 2750 dbSNP
rs916740923 2751 dbSNP
rs12613089 2753 dbSNP
rs16866636 2756 dbSNP
rs1232719605 2767 dbSNP
rs1174805977 2769 dbSNP
rs1332380943 2770 dbSNP
rs1403404908 2772 dbSNP
rs949983340 2773 dbSNP
rs913164000 2776 dbSNP
rs1301359531 2781 dbSNP
rs1373255321 2799 dbSNP
rs1381309703 2802 dbSNP
rs920141581 2803 dbSNP
rs988492841 2804 dbSNP
rs973069490 2809 dbSNP
rs1349285925 2822 dbSNP
rs957067826 2824 dbSNP
rs1236856726 2828 dbSNP
rs961682933 2836 dbSNP
rs12616452 2837 dbSNP
rs143473754 2839 dbSNP
rs543144357 2840 dbSNP
rs1171741433 2841 dbSNP
rs142445392 2854 dbSNP
rs996082160 2854 dbSNP
rs1251235504 2855 dbSNP
rs1436120832 2865 dbSNP
rs1029818498 2874 dbSNP
rs998785636 2876 dbSNP
rs114409940 2882 dbSNP
rs1172170638 2883 dbSNP
rs1392372664 2885 dbSNP
rs1431279307 2889 dbSNP
rs999498838 2890 dbSNP
rs1259868422 2899 dbSNP
rs1389176339 2902 dbSNP
rs1016296478 2916 dbSNP
rs563931775 2919 dbSNP
rs1232386590 2920 dbSNP
rs1301005421 2921 dbSNP
rs888454183 2926 dbSNP
rs1013652741 2927 dbSNP
rs1211728492 2927 dbSNP
rs142322591 2927 dbSNP
rs1055189582 2929 dbSNP
rs1451570208 2930 dbSNP
rs373906618 2930 dbSNP
rs895342751 2933 dbSNP
rs1002301172 2937 dbSNP
rs1192253227 2937 dbSNP
rs757435698 2940 dbSNP
rs753898473 2946 dbSNP
rs1055308165 2948 dbSNP
rs1164523573 2949 dbSNP
rs761035132 2949 dbSNP
rs1390760214 2959 dbSNP
rs200458669 2960 dbSNP
rs751761325 2960 dbSNP
rs920194143 2960 dbSNP
rs931431085 2960 dbSNP
rs1305997382 2963 dbSNP
rs1400199645 2965 dbSNP
rs1247199988 2967 dbSNP
rs1354645516 2970 dbSNP
rs1310841336 2972 dbSNP
rs1397717513 2977 dbSNP
rs906637213 2977 dbSNP
rs540984266 2980 dbSNP
rs1270556708 2982 dbSNP
rs940368693 2988 dbSNP
rs1188327254 2996 dbSNP
rs1260032345 2997 dbSNP
rs1045548549 3013 dbSNP
rs1173267551 3018 dbSNP
rs16866635 3023 dbSNP
rs79789502 3024 dbSNP
rs1052973332 3026 dbSNP
rs935629599 3028 dbSNP
rs921639495 3029 dbSNP
rs1257269851 3030 dbSNP
rs758535357 3032 dbSNP
rs542077095 3039 dbSNP
rs1288095873 3043 dbSNP
rs974548558 3044 dbSNP
rs1444654910 3054 dbSNP
rs985122282 3056 dbSNP
rs1313678051 3057 dbSNP
rs1340004770 3060 dbSNP
rs1231521702 3067 dbSNP
rs953803464 3078 dbSNP
rs1330456979 3082 dbSNP
rs111673835 3083 dbSNP
rs922386582 3098 dbSNP
rs976942163 3102 dbSNP
rs1195696589 3104 dbSNP
rs1336932846 3108 dbSNP
rs1201882467 3109 dbSNP
rs1256417579 3110 dbSNP
rs961853163 3120 dbSNP
rs142703170 3122 dbSNP
rs1024973115 3131 dbSNP
rs1333616253 3144 dbSNP
rs1013970827 3147 dbSNP
rs557474807 3158 dbSNP
rs1055191453 3171 dbSNP
rs1328158520 3177 dbSNP
rs1413096117 3186 dbSNP
rs191743636 3187 dbSNP
rs1223767529 3191 dbSNP
rs952660762 3197 dbSNP
rs1305479898 3201 dbSNP
rs1314379023 3209 dbSNP
rs1033665165 3212 dbSNP
rs1398291083 3213 dbSNP
rs1333375368 3232 dbSNP
rs1002227403 3233 dbSNP
rs1208228298 3240 dbSNP
rs1253395249 3245 dbSNP
rs1483083283 3245 dbSNP
rs1466351946 3247 dbSNP
rs1417362306 3251 dbSNP
rs1161858151 3252 dbSNP
rs1037312063 3257 dbSNP
rs1473999833 3257 dbSNP
rs1369385743 3258 dbSNP
rs940285550 3262 dbSNP
rs1181786259 3263 dbSNP
rs1434764032 3264 dbSNP
rs1436575057 3265 dbSNP
rs1239471180 3266 dbSNP
rs1198661637 3267 dbSNP
rs1467778535 3270 dbSNP
rs1176536665 3279 dbSNP
rs1394213363 3289 dbSNP
rs578015354 3292 dbSNP
rs2008999 3294 dbSNP
rs1371310974 3303 dbSNP
rs773654532 3304 dbSNP
rs1296459179 3313 dbSNP
rs534670710 3314 dbSNP
rs1025514601 3315 dbSNP
rs7566810 3316 dbSNP
rs1236802686 3323 dbSNP
rs891624668 3324 dbSNP
rs1052939757 3325 dbSNP
rs921702303 3327 dbSNP
rs1311589009 3331 dbSNP
rs1276317716 3332 dbSNP
rs759607720 3335 dbSNP
rs796229231 3336 dbSNP
rs904472882 3339 dbSNP
rs753609078 3343 dbSNP
rs186943887 3347 dbSNP
rs1252203102 3348 dbSNP
rs1452329912 3353 dbSNP
rs766088432 3354 dbSNP
rs760331367 3357 dbSNP
rs1391026297 3358 dbSNP
rs1409545917 3360 dbSNP
rs1391985673 3365 dbSNP
rs535693839 3365 dbSNP
rs570147870 3366 dbSNP
rs1437855721 3367 dbSNP
rs1325794735 3370 dbSNP
rs772758525 3371 dbSNP
rs1025272981 3375 dbSNP
rs1437716387 3375 dbSNP
rs1382648495 3382 dbSNP
rs1013606703 3383 dbSNP
rs550304525 3386 dbSNP
rs549396800 3393 dbSNP
rs771759998 3394 dbSNP
rs532898154 3397 dbSNP
rs1214312922 3398 dbSNP
rs995573685 3401 dbSNP
rs1467033003 3405 dbSNP
rs1190292055 3409 dbSNP
rs761281149 3411 dbSNP
rs1248360144 3412 dbSNP
rs898705755 3413 dbSNP
rs1015764631 3415 dbSNP
rs1004756960 3417 dbSNP
rs564176677 3422 dbSNP
rs984315884 3437 dbSNP
rs1051758884 3438 dbSNP
rs879644875 3443 dbSNP
rs371871693 3451 dbSNP
rs1038781603 3452 dbSNP
rs1451758341 3454 dbSNP
rs936421256 3455 dbSNP
rs879589297 3457 dbSNP
rs748522894 3458 dbSNP
rs1233374187 3460 dbSNP
rs368589547 3465 dbSNP
rs1203110473 3467 dbSNP
rs1210469842 3472 dbSNP
rs1355810743 3481 dbSNP
rs977953959 3486 dbSNP
rs781314899 3487 dbSNP
rs547102662 3492 dbSNP
rs770269918 3495 dbSNP
rs1370411337 3498 dbSNP
rs746368128 3501 dbSNP
rs375782786 3503 dbSNP
rs527260456 3507 dbSNP
rs781581768 3510 dbSNP
rs959385618 3513 dbSNP
rs182391456 3515 dbSNP
rs771222844 3523 dbSNP
rs879841381 3529 dbSNP
rs529267229 3531 dbSNP
rs1004401302 3534 dbSNP
rs2008989 3536 dbSNP
rs1029941417 3539 dbSNP
rs1362824854 3541 dbSNP
rs1159846384 3557 dbSNP
rs1049642064 3558 dbSNP
rs1349768724 3569 dbSNP
rs576356798 3570 dbSNP
rs997487303 3571 dbSNP
rs138621846 3574 dbSNP
rs1422454930 3575 dbSNP
rs547297885 3596 dbSNP
rs533580896 3607 dbSNP
rs562549335 3617 dbSNP
rs1183256623 3624 dbSNP
rs777830453 3633 dbSNP
rs1174701951 3634 dbSNP
rs1426266589 3637 dbSNP
rs17453976 3648 dbSNP
rs374845783 3650 dbSNP
rs1373152614 3651 dbSNP
rs1048589652 3652 dbSNP
rs1411119761 3653 dbSNP
rs931503102 3661 dbSNP
rs1042502986 3670 dbSNP
rs147120564 3675 dbSNP
rs917726059 3678 dbSNP
rs1348282343 3680 dbSNP
rs779144786 3682 dbSNP
rs1278456321 3686 dbSNP
rs1344506540 3687 dbSNP
rs1196471456 3690 dbSNP
rs1249848055 3692 dbSNP
rs1436611735 3701 dbSNP
rs1201606022 3703 dbSNP
rs970728968 3713 dbSNP
rs992130081 3719 dbSNP
rs1454096401 3726 dbSNP
rs1172699607 3728 dbSNP
rs1210155955 3729 dbSNP
rs1463146367 3734 dbSNP
rs1168011983 3746 dbSNP
rs917898026 3749 dbSNP
rs1276605895 3750 dbSNP
rs1371548204 3754 dbSNP
rs1220968246 3756 dbSNP
rs926494381 3762 dbSNP
rs73973204 3767 dbSNP
rs988183515 3772 dbSNP
rs372388798 3778 dbSNP
rs72025552 3778 dbSNP
rs763494909 3778 dbSNP
rs1398371266 3781 dbSNP
rs1228378215 3787 dbSNP
rs1250871791 3800 dbSNP
rs189147827 3801 dbSNP
rs956786111 3806 dbSNP
rs1337507094 3808 dbSNP
rs1342850702 3809 dbSNP
rs962676618 3815 dbSNP
rs1468375829 3816 dbSNP
rs753778062 3817 dbSNP
rs1250231589 3818 dbSNP
rs1032424327 3819 dbSNP
rs1015690102 3823 dbSNP
rs999953152 3828 dbSNP
rs1414729882 3844 dbSNP
rs1474140469 3847 dbSNP
rs1166389112 3849 dbSNP
rs562434620 3851 dbSNP
rs968526514 3855 dbSNP
rs572100134 3862 dbSNP
rs1177645166 3863 dbSNP
rs1030240019 3865 dbSNP
rs1390527313 3878 dbSNP
rs997140916 3885 dbSNP
rs1414587573 3886 dbSNP
rs1324827516 3890 dbSNP
rs964271334 3890 dbSNP
rs555688801 3894 dbSNP
rs370416314 3906 dbSNP
rs1247088390 3908 dbSNP
rs1374385847 3915 dbSNP
rs1293924852 3919 dbSNP
rs1033201074 3920 dbSNP
rs1212315914 3921 dbSNP
rs1418135202 3921 dbSNP
rs1168164056 3923 dbSNP
rs1000500495 3928 dbSNP
rs75769444 3942 dbSNP
rs1426309343 3943 dbSNP
rs1189477425 3944 dbSNP
rs199802200 3945 dbSNP
rs1041089346 3946 dbSNP
rs1009729883 3948 dbSNP
rs141836388 3950 dbSNP
rs886848087 3951 dbSNP
rs1365381810 3958 dbSNP
rs550126461 3964 dbSNP
rs1287999468 3967 dbSNP
rs937790518 3971 dbSNP
rs931428211 3972 dbSNP
rs926543221 3981 dbSNP
rs1038262553 3986 dbSNP
rs1239089219 3992 dbSNP
rs1232050272 3996 dbSNP
rs1290736882 4001 dbSNP
rs926796516 4007 dbSNP
rs1238799783 4008 dbSNP
rs941368731 4008 dbSNP
rs777682775 4010 dbSNP
rs1484709080 4011 dbSNP
rs1212539462 4024 dbSNP
rs1257662388 4030 dbSNP
rs1485052735 4033 dbSNP
rs1185803122 4034 dbSNP
rs1257501029 4044 dbSNP
rs1419540515 4045 dbSNP
rs1045292216 4050 dbSNP
rs949651063 4052 dbSNP
rs1217037593 4060 dbSNP
rs1320202009 4068 dbSNP
rs918214842 4069 dbSNP
rs1436855897 4072 dbSNP
rs569667033 4074 dbSNP
rs145832935 4081 dbSNP
rs1413005366 4093 dbSNP
rs982925355 4106 dbSNP
rs1374727675 4109 dbSNP
rs1391286093 4116 dbSNP
rs955633609 4116 dbSNP
rs1236117194 4117 dbSNP
rs745387610 4117 dbSNP
rs1280596385 4118 dbSNP
rs925333449 4125 dbSNP
rs1346621276 4135 dbSNP
rs1208117885 4138 dbSNP
rs1449378337 4139 dbSNP
rs979507159 4141 dbSNP
rs1252503395 4142 dbSNP
rs1480936084 4145 dbSNP
rs1176516317 4147 dbSNP
rs1248205958 4147 dbSNP
rs1353481333 4151 dbSNP
rs975556052 4154 dbSNP
rs968495857 4155 dbSNP
rs1433042906 4161 dbSNP
rs1172668555 4171 dbSNP
rs1355160234 4177 dbSNP
rs10205588 4178 dbSNP
rs1296943995 4181 dbSNP
rs996713093 4183 dbSNP
rs1033251997 4184 dbSNP
rs184749889 4186 dbSNP
rs1369815278 4192 dbSNP
rs1021030191 4196 dbSNP
rs967777219 4196 dbSNP
rs965670663 4202 dbSNP
rs1466873038 4205 dbSNP
rs1009199389 4208 dbSNP
rs896224647 4208 dbSNP
rs1056192057 4214 dbSNP
rs28542900 4216 dbSNP
rs1002052671 4220 dbSNP
rs1421876251 4221 dbSNP
rs1252106853 4223 dbSNP
rs1452857738 4236 dbSNP
rs1188486811 4238 dbSNP
rs1420390988 4241 dbSNP
rs1303767293 4248 dbSNP
rs1427992097 4249 dbSNP
rs1019561031 4258 dbSNP
rs1168333025 4264 dbSNP
rs1415680541 4266 dbSNP
rs1397343680 4268 dbSNP
rs547504108 4270 dbSNP
rs1325685465 4273 dbSNP
rs527327933 4275 dbSNP
rs905016654 4279 dbSNP
rs1038320875 4281 dbSNP
rs1003846546 4283 dbSNP
rs1480230910 4287 dbSNP
rs1237659230 4288 dbSNP
rs1213478502 4291 dbSNP
rs766144049 4294 dbSNP
rs1336901640 4298 dbSNP
rs908576233 4302 dbSNP
rs1272376700 4304 dbSNP
rs1449643075 4308 dbSNP
rs1218294661 4313 dbSNP
rs755959742 4324 dbSNP
rs995267692 4326 dbSNP
rs904967662 4329 dbSNP
rs1320350783 4330 dbSNP
rs1475842845 4331 dbSNP
rs750271285 4335 dbSNP
rs536332079 4337 dbSNP
rs1416214286 4338 dbSNP
rs1315264196 4339 dbSNP
rs949613492 4341 dbSNP
rs150243832 4342 dbSNP
rs1052706076 4343 dbSNP
rs548544815 4345 dbSNP
rs531318728 4346 dbSNP
rs1356796130 4348 dbSNP
rs1233890179 4352 dbSNP
rs1292595327 4357 dbSNP
rs180730483 4360 dbSNP
rs1225271364 4372 dbSNP
rs1284637693 4375 dbSNP
rs545553035 4378 dbSNP
rs1214685004 4379 dbSNP
rs1259758093 4380 dbSNP
rs964203349 4381 dbSNP
rs922077135 4387 dbSNP
rs1351411213 4388 dbSNP
rs1471408002 4388 dbSNP
rs975642661 4394 dbSNP
rs1159542482 4398 dbSNP
rs1407680851 4403 dbSNP
rs542656250 4404 dbSNP
rs979015323 4405 dbSNP
rs1019910148 4408 dbSNP
rs1376817509 4410 dbSNP
rs1418458234 4415 dbSNP
rs982712625 4437 dbSNP
rs868053656 4438 dbSNP
rs564482001 4439 dbSNP
rs1311684944 4446 dbSNP
rs1338653634 4447 dbSNP
rs1180402347 4449 dbSNP
rs1441681107 4459 dbSNP
rs1444243676 4460 dbSNP
rs1279962625 4462 dbSNP
rs761509956 4475 dbSNP
rs1372315795 4484 dbSNP
rs1238320830 4494 dbSNP
rs541227770 4495 dbSNP
rs1348782802 4498 dbSNP
rs1210267714 4500 dbSNP
rs879810798 4501 dbSNP
rs995211899 4503 dbSNP
rs1190894314 4508 dbSNP
rs188248230 4509 dbSNP
rs1438223453 4510 dbSNP
rs1195816969 4511 dbSNP
rs1487588600 4513 dbSNP
rs1023392888 4519 dbSNP
rs1434900071 4520 dbSNP
rs1172513535 4522 dbSNP
rs1267617282 4523 dbSNP
rs1399392272 4524 dbSNP
rs555629164 4525 dbSNP
rs960377263 4526 dbSNP
rs1222709712 4536 dbSNP
rs1353658061 4539 dbSNP
rs1305279928 4546 dbSNP
rs1372025130 4552 dbSNP
rs1034798377 4553 dbSNP
rs773785925 4556 dbSNP
rs1014132777 4562 dbSNP
rs1284556044 4564 dbSNP
rs767115824 4565 dbSNP
rs2847 4572 dbSNP
rs1053089794 4573 dbSNP
rs905067706 4574 dbSNP
rs1215967691 4583 dbSNP
rs1253978746 4585 dbSNP
rs1016770868 4587 dbSNP
rs3731739 4589 dbSNP
rs1375484121 4594 dbSNP
rs1476105823 4603 dbSNP
rs776982537 4606 dbSNP
rs770924973 4610 dbSNP
rs1384731144 4614 dbSNP
rs1399470238 4614 dbSNP
rs532564631 4625 dbSNP
rs1394920807 4635 dbSNP
rs1293930221 4640 dbSNP
rs1321828632 4641 dbSNP
rs1328360017 4647 dbSNP
rs1452843447 4648 dbSNP
rs1228261939 4650 dbSNP
rs1269620978 4652 dbSNP
rs1358371713 4656 dbSNP
rs1316630706 4663 dbSNP
rs752305901 4668 dbSNP
rs887028511 4668 dbSNP
rs1468307332 4670 dbSNP
rs1208939259 4676 dbSNP
rs904135346 4681 dbSNP
rs1420223730 4686 dbSNP
rs1381002472 4687 dbSNP
rs1042757486 4696 dbSNP
rs1431679442 4699 dbSNP
rs1269686253 4700 dbSNP
rs1191959072 4702 dbSNP
rs1046952086 4703 dbSNP
rs1193303621 4705 dbSNP
rs1422234202 4706 dbSNP
rs1488196386 4706 dbSNP
rs202234397 4706 dbSNP
rs934013483 4706 dbSNP
rs901155318 4713 dbSNP
rs3731740 4719 dbSNP
rs1043702710 4720 dbSNP
rs771513399 4721 dbSNP
rs1262813371 4722 dbSNP
rs1317776598 4722 dbSNP
rs1334691316 4722 dbSNP
rs1338489503 4722 dbSNP
rs1382954406 4722 dbSNP
rs35475379 4722 dbSNP
rs397873196 4722 dbSNP
rs878915114 4722 dbSNP
rs879041038 4722 dbSNP
rs1230388953 4723 dbSNP
rs1205320351 4724 dbSNP
rs1487020649 4724 dbSNP
rs375777487 4724 dbSNP
rs926003859 4724 dbSNP
rs1313411110 4726 dbSNP
rs1301608698 4727 dbSNP
rs978900942 4728 dbSNP
rs946210750 4729 dbSNP
rs932016533 4733 dbSNP
rs376172166 4736 dbSNP
rs1358772219 4739 dbSNP
rs921974552 4744 dbSNP
rs976194737 4747 dbSNP
rs943843726 4754 dbSNP
rs1313492489 4755 dbSNP
rs960677425 4758 dbSNP
rs1034684384 4760 dbSNP
rs1309654006 4762 dbSNP
rs1299733617 4766 dbSNP
rs1400548532 4769 dbSNP
rs980552217 4772 dbSNP
rs1239406510 4778 dbSNP
rs1172097057 4783 dbSNP
rs969134746 4786 dbSNP
rs1212435098 4792 dbSNP
rs747334775 4796 dbSNP
rs1005817617 4799 dbSNP
rs1177130883 4801 dbSNP
rs1180026193 4803 dbSNP
rs1252473122 4807 dbSNP
rs912410722 4814 dbSNP
rs982640564 4820 dbSNP
rs184812283 4821 dbSNP
rs1455708303 4823 dbSNP
rs1196240169 4825 dbSNP
rs1358615789 4828 dbSNP
rs373228752 4831 dbSNP
rs998110789 4834 dbSNP
rs1397754951 4837 dbSNP
rs1446526952 4839 dbSNP
rs1307468036 4840 dbSNP
rs973700807 4847 dbSNP
rs1236005886 4857 dbSNP
rs1303575151 4859 dbSNP
rs969085002 4860 dbSNP
rs369806380 4861 dbSNP
rs1483983074 4869 dbSNP
rs901215097 4871 dbSNP
rs1013351869 4875 dbSNP
rs1039684755 4888 dbSNP
rs533803526 4890 dbSNP
rs1455777474 4891 dbSNP
rs942662868 4892 dbSNP
rs1217635724 4900 dbSNP
rs1315616721 4903 dbSNP
rs904631730 4904 dbSNP
rs1043092188 4907 dbSNP
rs1339619204 4914 dbSNP
rs1465530458 4915 dbSNP
rs533968696 4920 dbSNP
rs1397117376 4923 dbSNP
rs1031113008 4924 dbSNP
rs568296579 4927 dbSNP
rs1337407702 4929 dbSNP
rs1465322409 4933 dbSNP
rs1421707184 4936 dbSNP
rs1297030016 4941 dbSNP
rs1318556530 4956 dbSNP
rs1217903534 4957 dbSNP
rs1255972020 4971 dbSNP
rs1214019348 4973 dbSNP
rs1246361267 4975 dbSNP
rs1173058486 4978 dbSNP
rs904102510 4985 dbSNP
rs1262485511 4989 dbSNP
rs1475975500 4990 dbSNP
rs192769117 4997 dbSNP
rs1368245010 5019 dbSNP
rs1169154010 5020 dbSNP
rs1043962033 5025 dbSNP
rs938939867 5027 dbSNP
rs375557465 5032 dbSNP
rs1164446081 5037 dbSNP
rs1426001980 5037 dbSNP
rs199497594 5039 dbSNP
rs568725534 5042 dbSNP
rs1290157807 5049 dbSNP
rs1456190997 5053 dbSNP
rs1259633366 5056 dbSNP
rs1276220671 5059 dbSNP
rs900517920 5065 dbSNP
rs1336785744 5068 dbSNP
rs1355451750 5072 dbSNP
rs552159829 5076 dbSNP
rs1288833332 5081 dbSNP
rs980437479 5088 dbSNP
rs969020007 5090 dbSNP
rs1264071915 5097 dbSNP
rs1488003379 5104 dbSNP
rs1260243213 5109 dbSNP
rs373283720 5109 dbSNP
rs562663931 5109 dbSNP
rs577440954 5109 dbSNP
rs188616738 5123 dbSNP
rs944796078 5124 dbSNP
rs1412035421 5129 dbSNP
rs1025467086 5130 dbSNP
rs907975578 5133 dbSNP
rs965266949 5139 dbSNP
rs1018122172 5144 dbSNP
rs755126778 5154 dbSNP
rs115714874 5155 dbSNP
rs919803645 5158 dbSNP
rs1333687684 5161 dbSNP
rs569377652 5170 dbSNP
rs1010320524 5173 dbSNP
rs539978103 5181 dbSNP
rs916237310 5184 dbSNP
rs1287020437 5188 dbSNP
rs1490186588 5190 dbSNP
rs992261293 5193 dbSNP
rs1282508900 5195 dbSNP
rs1057309746 5196 dbSNP
rs549185832 5206 dbSNP
rs1459914300 5215 dbSNP
rs1210003401 5223 dbSNP
rs938793880 5223 dbSNP
rs1386358060 5230 dbSNP
rs927550197 5234 dbSNP
rs1380552855 5236 dbSNP
rs1438653421 5255 dbSNP
rs527861839 5258 dbSNP
rs960482523 5263 dbSNP
rs1030739902 5268 dbSNP
rs1239453469 5276 dbSNP
rs947731071 5282 dbSNP
rs151064886 5301 dbSNP
rs117774782 5305 dbSNP
rs1309649456 5313 dbSNP
rs1287497162 5314 dbSNP
rs1238201431 5319 dbSNP
rs968188885 5331 dbSNP
rs1356753766 5333 dbSNP
rs918290810 5339 dbSNP
rs976629810 5342 dbSNP
rs1285284575 5344 dbSNP
rs1022479102 5358 dbSNP
rs965153343 5359 dbSNP
rs185344280 5362 dbSNP
rs1176384959 5363 dbSNP
rs900779834 5364 dbSNP
rs1006746858 5369 dbSNP
rs1311475430 5372 dbSNP
rs192157576 5374 dbSNP
rs1009347129 5375 dbSNP
rs1411551378 5381 dbSNP
rs1021621727 5382 dbSNP
rs1330689318 5402 dbSNP
rs1010620688 5404 dbSNP
rs891882882 5405 dbSNP
rs1322019562 5407 dbSNP
rs1328166994 5410 dbSNP
rs1331828032 5415 dbSNP
rs1388925135 5416 dbSNP
rs546177757 5417 dbSNP
rs187720537 5422 dbSNP
rs1158633827 5424 dbSNP
rs1219760017 5425 dbSNP
rs1003055717 5430 dbSNP
rs1047846199 5439 dbSNP
rs1044706845 5446 dbSNP
rs906018378 5446 dbSNP
rs1197583371 5452 dbSNP
rs929772552 5452 dbSNP
rs942252061 5457 dbSNP
rs1478788244 5459 dbSNP
rs909419377 5459 dbSNP
rs1422740480 5461 dbSNP
rs1463870241 5477 dbSNP
rs113867255 5478 dbSNP
rs1391765766 5482 dbSNP
rs554293499 5495 dbSNP
rs1381631185 5500 dbSNP
rs1386397893 5502