miRTarBase - #MIRT507002 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HNRNPDL   
Synonyms HNRNP, HNRPDL, JKTBP, JKTBP2, LGMD1G, laAUF1
Description heterogeneous nuclear ribonucleoprotein D like
Transcript NM_031372   
Expression
Putative miRNA Targets on HNRNPDL
3'UTR of HNRNPDL
(miRNA target sites are highlighted)
>HNRNPDL|NM_031372|3'UTR
   1 AGGAGAACATTGGAGAAAACAGGAGGAGATGTTAAAGTAACCCATCTTGCAGGACGACATTGAAGATTGGTCTTCTGTTG
  81 ATCTAAGATGATTATTTTGTAAAAGACTTTCTAGTGTACAAGACACCATTGTGTCCAACTGTATATAGCTGCCAATTAGT
 161 TTTCTTTGTTTTTACTTTGTCCTTTGCTATCTGTGTTATGACTCAATGTGGATTTGTTTATACACATTTTATTTGTATCA
 241 TTTCATGTTAAACCTCAAATAAATGCTTCCTTATGTGATTGCTTTTCTGCGTCAGGTACTACATAGCTCTGTAAAAAATG
 321 TAATTTAAAATAAGCAATAATTAAGGCACAGTTGATTTTGTAGAGTATTGGTCCATACAGAGAAACTGTGGTCCTTTATA
 401 AATAGCCAGCCAGCGTCACCCTCTTCTCCAATTTGTAGGTGTATTTTATGCTCTTAAGGCTTCATCTTCTCCCTGTAACT
 481 GAGATTTCTACCACACCTTTGAACAATGTTCTTTCCCTTCTGGTTATCTGAAGACTGTCCTGAAAGGAAGACATAAGTGT
 561 TGTGATTAGTAGAAGCTTTCTAGTAGACCATATTTCTTCTGGATTGTAATAAAATTGTTAGTAGCTCCTTTTACTTTGTT
 641 CCTGTCTCTGGAAAGCCATTTTTGAATTGCTGATTACTTTGGCTTTAATCAGTGGTCACCTAGAAAAAGCTTTGTAATCA
 721 TAACACAATGAGTAATTCTTGATAAAAGTTCAGATACAAAAGGAGCACTGTAAAACTGGTAGGAGCTATGGTTTAAGAGC
 801 ATTGGAAGTAGTTACAACTCAAGGATTTTGGTAGAAAGGTATGAGTTTGGTCGAAAAATTAAAATAGTGGCAAAATAAGA
 881 TTTAGTTGTGTTTTCTCAGAGCCGCCACAAGATTGAACAAAATGTTTTCTGTTTGGGCATCCTGAGGAAGTTGTATTAGC
 961 TGTTAATGCTCTGTGAGTTTAGAAAAAGTCTTGATAGTAAATCTAGTTTTTGACACAGTGCATGAACTAAGTAGTTAAAT
1041 ATTTACATATTCAGAAAGGAATAGTGGAAAAGGTATCTTGGTTATGACAAAGTCATTACAAATGTGACTAAGTCATTACA
1121 AATGTGACTGAGTCATTACAGTGGACCCTCTGGGTGCATTGAAAAGAATCCGTTTTATATCCAGGTTTCAGAGGACCTGG
1201 AATAATAAAAAGCTTTGGATTTTGCATTCAGTGTAGTTGGATTTTGGGACCTTGGCCTCAGTGTTATTTACTGGGATTGG
1281 CATACGTGTTCACAGGCAGAGTAGTTGATCTCACACAACGGGTGATCTCACAAAACTGGTAAGTTTCTTATGCTCATGAG
1361 CCCTCCCTTTTTTTTTTTAATTTGGTGCCTGCAACTTTCTTAACAATGATTCTACTTCCTGGGCTATCACATTATAATGC
1441 TCTTGGCCTCTTTTTTGCTGCTGTTTTGCTATTCTTAAACTTAGGCCAAGTACCAATGTTGGCTGTTAGAAGGGATTCTG
1521 TTCATTCAACATGCAACTTTAGGGAATGGAAGTAAGTTCATTTTTAAGTTGTGTTGTCAGTAGGTGCGGTGTCTAGGGTA
1601 GTGAATCCTGTAAGTTCAAATTTATGATTAGGTGACGAGTTGACATTGAGATTGTCCTTTTCCCTGATCAAAAAATGAAT
1681 AAAGCCTTTTTAAACAAAATCCAAACTTTTAATCAAGTCTTGATATGTATGACTGAGAAAAAATACACTACATCTAGAGA
1761 TGATTGAGATGTTTTGCAAAGAATTGAAGGGGGAGTGAGAATTGGTTTTTCTTGCAGGGGCTTTGAACTCTAGATTTGGG
1841 CTTTGAACTCTAGATTTAATTCAGATTTCAGGGTCTATCAGTTCACCAACTGATGCAAATTTGAACAGATACTCTAAGGC
1921 TAAGTGTCCTAGGTTGGATGAACTGAAGCTACTATCAAGATCTCGTTCCCAAGGATTAATTTAGAACAAAGTAATTGGAC
2001 AAGTTTATTGGGGAGGGGATAGAAATGAATTCTAAAGTACCTATAACAAATACTCTGTGTATGTTTTTTACATCGTATTT
2081 GCCTTTTACATTGTTTAGACCAAATTCTGTGTGATGTTATCCTCGGGAAGAGGATAGAAATTAATTCTAAAGTACCTATA
2161 ACAAATGCTCGGTTTGTATATGTTTTTATACATCGTATTTGCCTTTTGCATTGTTCAGACCAAATTCTGTGTGATGTTAT
2241 CCTAACAAAACACCTTAGTAATTTCTTTGGTTAACATGTTAATCTGTAATCTCACTTTTATAAGATGAGGACTATTAAAA
2321 TGAGATGTCTGTTGGGATGCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |: || | ||||||| 
Target 5' cttggcCTCTTTTTTGCTGCTg 3'
1442 - 1463 152.00 -12.02
2
miRNA  3' gugUUUGGU-AAUAC---ACGACGAu 5'
             ||:||| || ||   ||||| | 
Target 5' ggaAAGCCATTTTTGAATTGCTGATt 3'
650 - 675 131.00 -13.30
3
miRNA  3' guGUUUGGU---A-AUACACGACGAu 5'
            ||:||||   | |:|||| ||:| 
Target 5' ttCAGACCAAATTCTGTGTGATGTTa 3'
2214 - 2239 124.00 -16.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26491294 206 COSMIC
COSN29374827 211 COSMIC
COSN22551107 351 COSMIC
COSN10036098 387 COSMIC
COSN23016498 461 COSMIC
COSN26549159 491 COSMIC
COSN7845054 564 COSMIC
COSN8491437 570 COSMIC
COSN16100155 789 COSMIC
COSN26200594 982 COSMIC
COSN21286595 1109 COSMIC
COSN31567860 1320 COSMIC
COSN31568998 1452 COSMIC
COSN20100267 1466 COSMIC
COSN31515882 1535 COSMIC
COSN31536450 1542 COSMIC
COSN31484565 1641 COSMIC
COSN18004989 2024 COSMIC
COSN20100266 2125 COSMIC
COSN16758457 2202 COSMIC
COSN20100265 2238 COSMIC
COSN7052428 2513 COSMIC
COSN30446917 2549 COSMIC
COSN7845053 2768 COSMIC
COSN24936715 2883 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs896537523 2 dbSNP
rs1416222519 5 dbSNP
rs771466422 8 dbSNP
rs1158174051 9 dbSNP
rs747341068 10 dbSNP
rs778144589 18 dbSNP
rs925433090 20 dbSNP
rs367614143 29 dbSNP
rs1161502930 40 dbSNP
rs753504406 40 dbSNP
rs376744985 45 dbSNP
rs375152625 49 dbSNP
rs773387280 50 dbSNP
rs914179213 52 dbSNP
rs988409578 55 dbSNP
rs1356238339 62 dbSNP
rs1017193365 63 dbSNP
rs1350756063 66 dbSNP
rs1229661214 67 dbSNP
rs1005590256 77 dbSNP
rs1349796734 78 dbSNP
rs965024577 82 dbSNP
rs780735686 85 dbSNP
rs985173943 86 dbSNP
rs1449702671 87 dbSNP
rs1221493954 88 dbSNP
rs754733641 92 dbSNP
rs766812584 92 dbSNP
rs1003317726 93 dbSNP
rs1470067884 94 dbSNP
rs1164380554 96 dbSNP
rs560853198 101 dbSNP
rs1336786956 105 dbSNP
rs10026631 106 dbSNP
rs1374926414 107 dbSNP
rs945237615 108 dbSNP
rs915105323 109 dbSNP
rs961560565 112 dbSNP
rs1015527360 126 dbSNP
rs1013553828 133 dbSNP
rs896483379 135 dbSNP
rs1285829994 140 dbSNP
rs1354200604 163 dbSNP
rs1055161970 168 dbSNP
rs1002685086 169 dbSNP
rs1203220741 173 dbSNP
rs1157748721 178 dbSNP
rs1248467001 179 dbSNP
rs911253525 184 dbSNP
rs985489555 185 dbSNP
rs758404907 188 dbSNP
rs903959160 190 dbSNP
rs1163273576 195 dbSNP
rs1391230599 196 dbSNP
rs922721832 203 dbSNP
rs1044261331 205 dbSNP
rs1239074224 208 dbSNP
rs1296135995 211 dbSNP
rs1395351253 232 dbSNP
rs750425995 234 dbSNP
rs1188171807 236 dbSNP
rs1396066344 236 dbSNP
rs973276775 255 dbSNP
rs961569329 257 dbSNP
rs945580251 260 dbSNP
rs914124019 268 dbSNP
rs1218230176 278 dbSNP
rs1017600323 288 dbSNP
rs1230853256 294 dbSNP
rs1249789048 298 dbSNP
rs1339019873 305 dbSNP
rs1201045644 309 dbSNP
rs765384397 326 dbSNP
rs1488397751 373 dbSNP
rs763655515 386 dbSNP
rs1481762077 392 dbSNP
rs1258373516 409 dbSNP
rs1460361893 433 dbSNP
rs1040610155 434 dbSNP
rs1283205973 447 dbSNP
rs1249003360 456 dbSNP
rs1451777206 465 dbSNP
rs944999440 467 dbSNP
rs912222255 475 dbSNP
rs1005841003 484 dbSNP
rs575063832 486 dbSNP
rs959013169 489 dbSNP
rs1223566736 527 dbSNP
rs1033321963 547 dbSNP
rs1003224151 556 dbSNP
rs1348997220 571 dbSNP
rs1286400194 573 dbSNP
rs778536110 574 dbSNP
rs985172732 577 dbSNP
rs906241530 585 dbSNP
rs1321193687 589 dbSNP
rs1246201664 590 dbSNP
rs186725217 592 dbSNP
rs1380273892 599 dbSNP
rs760132395 607 dbSNP
rs1234320875 610 dbSNP
rs1257833155 614 dbSNP
rs1321560905 629 dbSNP
rs1042143046 632 dbSNP
rs1009814800 639 dbSNP
rs1311121592 641 dbSNP
rs1466638692 643 dbSNP
rs953910906 650 dbSNP
rs1185081682 656 dbSNP
rs1261538031 658 dbSNP
rs893675807 664 dbSNP
rs1401967581 666 dbSNP
rs1200599814 671 dbSNP
rs1426560373 675 dbSNP
rs1054101597 676 dbSNP
rs1361404506 695 dbSNP
rs1317971747 706 dbSNP
rs919698349 710 dbSNP
rs541843928 719 dbSNP
rs974278276 724 dbSNP
rs1390661652 728 dbSNP
rs1451562961 744 dbSNP
rs1288058549 746 dbSNP
rs889047639 769 dbSNP
rs961238753 774 dbSNP
rs1163722555 779 dbSNP
rs1343899657 783 dbSNP
rs754688453 786 dbSNP
rs1289077834 799 dbSNP
rs1415640724 800 dbSNP
rs576209058 806 dbSNP
rs1013498528 812 dbSNP
rs2859539 813 dbSNP
rs933999073 817 dbSNP
rs373581803 818 dbSNP
rs1489038994 819 dbSNP
rs1212026879 820 dbSNP
rs972880191 824 dbSNP
rs754053513 826 dbSNP
rs1182198299 830 dbSNP
rs1033660410 834 dbSNP
rs1292490201 838 dbSNP
rs1002229610 839 dbSNP
rs1417239016 844 dbSNP
rs1158351200 846 dbSNP
rs910080090 854 dbSNP
rs2114692 857 dbSNP
rs1459208953 864 dbSNP
rs903909545 866 dbSNP
rs539661739 871 dbSNP
rs1214762019 887 dbSNP
rs35327845 890 dbSNP
rs984307621 895 dbSNP
rs1334731492 905 dbSNP
rs959583452 914 dbSNP
rs1292050412 917 dbSNP
rs1222541477 922 dbSNP
rs114786982 925 dbSNP
rs200979805 931 dbSNP
rs1248540284 934 dbSNP
rs1269786638 935 dbSNP
rs553908767 937 dbSNP
rs970460810 938 dbSNP
rs1351886461 943 dbSNP
rs1479402568 957 dbSNP
rs1021116960 960 dbSNP
rs1176151231 961 dbSNP
rs1009349827 967 dbSNP
rs1425498019 971 dbSNP
rs533876857 974 dbSNP
rs568334988 977 dbSNP
rs1460790825 982 dbSNP
rs548338532 983 dbSNP
rs1032109562 988 dbSNP
rs892633056 990 dbSNP
rs1440060711 991 dbSNP
rs1040554770 1005 dbSNP
rs11552702 1008 dbSNP
rs1172750901 1009 dbSNP
rs1380458707 1014 dbSNP
rs944947179 1014 dbSNP
rs764228756 1019 dbSNP
rs1228658103 1027 dbSNP
rs3172564 1029 dbSNP
rs932341888 1030 dbSNP
rs867856191 1032 dbSNP
rs1203134121 1034 dbSNP
rs1051633759 1038 dbSNP
rs933982092 1044 dbSNP
rs1181716673 1047 dbSNP
rs1478791330 1054 dbSNP
rs761042677 1054 dbSNP
rs537798376 1055 dbSNP
rs1246966514 1059 dbSNP
rs1408445773 1060 dbSNP
rs1037510398 1061 dbSNP
rs919629359 1075 dbSNP
rs1194649351 1082 dbSNP
rs775705713 1086 dbSNP
rs1335381693 1093 dbSNP
rs1468363964 1097 dbSNP
rs973847292 1100 dbSNP
rs569016976 1101 dbSNP
rs1382731971 1103 dbSNP
rs939783486 1103 dbSNP
rs1271757181 1104 dbSNP
rs567721273 1106 dbSNP
rs992014454 1112 dbSNP
rs960588425 1117 dbSNP
rs1278671704 1129 dbSNP
rs984255293 1132 dbSNP
rs1033611236 1134 dbSNP
rs981148426 1140 dbSNP
rs1201253442 1150 dbSNP
rs767414871 1156 dbSNP
rs548803994 1157 dbSNP
rs528912080 1160 dbSNP
rs1194988807 1162 dbSNP
rs1272350303 1164 dbSNP
rs3172563 1168 dbSNP
rs199638307 1169 dbSNP
rs1186189526 1171 dbSNP
rs1304523522 1174 dbSNP
rs982396700 1177 dbSNP
rs774890636 1180 dbSNP
rs549715964 1182 dbSNP
rs769248982 1183 dbSNP
rs747613088 1188 dbSNP
rs1020644320 1190 dbSNP
rs1429562267 1194 dbSNP
rs1275024735 1195 dbSNP
rs190403058 1199 dbSNP
rs1347042617 1203 dbSNP
rs988233216 1208 dbSNP
rs1329763412 1209 dbSNP
rs1368524797 1212 dbSNP
rs1206899157 1214 dbSNP
rs1281846300 1221 dbSNP
rs1333238049 1222 dbSNP
rs561581939 1226 dbSNP
rs1353906559 1230 dbSNP
rs1222063208 1236 dbSNP
rs1167664438 1237 dbSNP
rs1481545962 1241 dbSNP
rs1415747701 1243 dbSNP
rs1428760995 1246 dbSNP
rs1032057644 1252 dbSNP
rs1406448015 1255 dbSNP
rs1172638077 1258 dbSNP
rs1400450447 1258 dbSNP
rs184799779 1264 dbSNP
rs768177027 1269 dbSNP
rs576074747 1275 dbSNP
rs1180953827 1277 dbSNP
rs1481228386 1278 dbSNP
rs1350617306 1279 dbSNP
rs1241070886 1294 dbSNP
rs779963713 1305 dbSNP
rs1349915351 1307 dbSNP
rs1030196677 1308 dbSNP
rs1293693246 1311 dbSNP
rs1202514584 1312 dbSNP
rs1220584628 1315 dbSNP
rs997471502 1317 dbSNP
rs758316612 1319 dbSNP
rs11552704 1321 dbSNP
rs901150913 1321 dbSNP
rs375865857 1325 dbSNP
rs1037007101 1329 dbSNP
rs745750180 1335 dbSNP
rs1004630271 1339 dbSNP
rs1387548247 1340 dbSNP
rs888493850 1342 dbSNP
rs113289789 1346 dbSNP
rs112419307 1351 dbSNP
rs1391793906 1355 dbSNP
rs1370810163 1358 dbSNP
rs779024129 1359 dbSNP
rs1326291592 1360 dbSNP
rs1335041143 1364 dbSNP
rs1372520138 1372 dbSNP
rs938155084 1375 dbSNP
rs1357068512 1378 dbSNP
rs1244998178 1388 dbSNP
rs1291257225 1393 dbSNP
rs1340328975 1405 dbSNP
rs1296440427 1407 dbSNP
rs1449509432 1418 dbSNP
rs926809425 1418 dbSNP
rs1437752622 1419 dbSNP
rs1184796604 1422 dbSNP
rs1245335089 1423 dbSNP
rs562594171 1427 dbSNP
rs1183400607 1428 dbSNP
rs1311849193 1433 dbSNP
rs1046666707 1440 dbSNP
rs949641198 1442 dbSNP
rs914150660 1443 dbSNP
rs1470232397 1451 dbSNP
rs538157014 1460 dbSNP
rs987789398 1462 dbSNP
rs1380529030 1466 dbSNP
rs1451560773 1471 dbSNP
rs1327232953 1472 dbSNP
rs138358528 1472 dbSNP
rs576855898 1475 dbSNP
rs1249659321 1481 dbSNP
rs1338880984 1487 dbSNP
rs746417003 1487 dbSNP
rs985875055 1489 dbSNP
rs1204410848 1491 dbSNP
rs1265501100 1503 dbSNP
rs1460378025 1513 dbSNP
rs1183311098 1518 dbSNP
rs868486017 1524 dbSNP
rs1030144330 1528 dbSNP
rs553724283 1533 dbSNP
rs1372164329 1535 dbSNP
rs770953141 1544 dbSNP
rs75767756 1550 dbSNP
rs574645490 1554 dbSNP
rs1403741123 1567 dbSNP
rs138288718 1568 dbSNP
rs1469277941 1568 dbSNP
rs757340959 1576 dbSNP
rs145639900 1579 dbSNP
rs6848299 1580 dbSNP
rs556292111 1583 dbSNP
rs1285292137 1598 dbSNP
rs1322023360 1599 dbSNP
rs191491807 1603 dbSNP
rs1239486602 1610 dbSNP
rs1487023564 1612 dbSNP
rs1260520403 1613 dbSNP
rs140423053 1616 dbSNP
rs1046532563 1617 dbSNP
rs1491280832 1617 dbSNP
rs1491533833 1618 dbSNP
rs756290073 1619 dbSNP
rs566956833 1620 dbSNP
rs1365488167 1623 dbSNP
rs1451311405 1625 dbSNP
rs552324173 1627 dbSNP
rs1360073676 1631 dbSNP
rs1311713073 1635 dbSNP
rs1305032467 1639 dbSNP
rs1343767105 1641 dbSNP
rs1218739044 1642 dbSNP
rs1412458285 1644 dbSNP
rs1308283944 1645 dbSNP
rs914116703 1648 dbSNP
rs1237259545 1649 dbSNP
rs1289105696 1652 dbSNP
rs1490409649 1661 dbSNP
rs1224303305 1664 dbSNP
rs1053153883 1665 dbSNP
rs1177306355 1668 dbSNP
rs113676360 1673 dbSNP
rs1417255915 1675 dbSNP
rs924977705 1676 dbSNP
rs1385708361 1678 dbSNP
rs1157490889 1681 dbSNP
rs1165647795 1683 dbSNP
rs1476459332 1686 dbSNP
rs985825006 1690 dbSNP
rs1298829247 1695 dbSNP
rs1376147922 1696 dbSNP
rs1390233610 1698 dbSNP
rs753007304 1699 dbSNP
rs1360677314 1700 dbSNP
rs1248654976 1701 dbSNP
rs1419254762 1706 dbSNP
rs749500260 1707 dbSNP
rs953108756 1709 dbSNP
rs1479616226 1716 dbSNP
rs1474300245 1720 dbSNP
rs527471113 1721 dbSNP
rs1265536305 1727 dbSNP
rs562254859 1729 dbSNP
rs1446184616 1733 dbSNP
rs1181525495 1735 dbSNP
rs72909808 1735 dbSNP
rs1405047616 1736 dbSNP
rs1456259154 1739 dbSNP
rs1370082594 1743 dbSNP
rs770160835 1746 dbSNP
rs1356392312 1747 dbSNP
rs962226516 1749 dbSNP
rs1384225167 1752 dbSNP
rs1223547629 1753 dbSNP
rs188226035 1761 dbSNP
rs1313395146 1763 dbSNP
rs551269134 1769 dbSNP
rs1014836288 1773 dbSNP
rs115114284 1778 dbSNP
rs1305311733 1779 dbSNP
rs1230866636 1780 dbSNP
rs1341844629 1782 dbSNP
rs1295800672 1790 dbSNP
rs952673991 1791 dbSNP
rs1359489158 1792 dbSNP
rs1026965245 1793 dbSNP
rs1242368491 1794 dbSNP
rs1472572970 1801 dbSNP
rs774770092 1808 dbSNP
rs1287451409 1810 dbSNP
rs1421942465 1811 dbSNP
rs1426771716 1817 dbSNP
rs1463402112 1818 dbSNP
rs12644560 1825 dbSNP
rs1471277078 1833 dbSNP
rs184276024 1857 dbSNP
rs1025480547 1859 dbSNP
rs1358991721 1878 dbSNP
rs1271527476 1881 dbSNP
rs1359429340 1881 dbSNP
rs1430988679 1881 dbSNP
rs1013750152 1882 dbSNP
rs763569751 1884 dbSNP
rs1325582656 1891 dbSNP
rs1459878023 1894 dbSNP
rs892660176 1895 dbSNP
rs1052687865 1901 dbSNP
rs4572868 1902 dbSNP
rs936947555 1909 dbSNP
rs1243994083 1910 dbSNP
rs1487439247 1916 dbSNP
rs904132019 1918 dbSNP
rs1194057423 1919 dbSNP
rs997721 1920 dbSNP
rs1481688933 1922 dbSNP
rs1174970210 1931 dbSNP
rs1259995455 1932 dbSNP
rs1401614379 1932 dbSNP
rs532153923 1934 dbSNP
rs1320705547 1936 dbSNP
rs1343056448 1944 dbSNP
rs560144338 1952 dbSNP
rs923043483 1961 dbSNP
rs1468763805 1968 dbSNP
rs540060474 1975 dbSNP
rs1272403465 1976 dbSNP
rs151020164 1981 dbSNP
rs1351315976 1983 dbSNP
rs369770953 1983 dbSNP
rs1281961698 1988 dbSNP
rs1351779917 1990 dbSNP
rs567257660 1992 dbSNP
rs1226106602 1995 dbSNP
rs1490848042 1996 dbSNP
rs1196892880 2001 dbSNP
rs1324312457 2002 dbSNP
rs1246573033 2004 dbSNP
rs544135967 2005 dbSNP
rs951916217 2006 dbSNP
rs1372187513 2011 dbSNP
rs1034277755 2012 dbSNP
rs980727092 2017 dbSNP
rs1367085362 2020 dbSNP
rs1402479763 2021 dbSNP
rs969414716 2023 dbSNP
rs1336266695 2024 dbSNP
rs1444375572 2028 dbSNP
rs575178993 2031 dbSNP
rs1246473286 2032 dbSNP
rs558576841 2035 dbSNP
rs892615672 2038 dbSNP
rs1208120273 2039 dbSNP
rs1031562855 2041 dbSNP
rs1001001656 2042 dbSNP
rs1461596537 2045 dbSNP
rs538979251 2050 dbSNP
rs59154495 2056 dbSNP
rs1184597594 2057 dbSNP
rs1386646812 2065 dbSNP
rs997720 2066 dbSNP
rs901533927 2068 dbSNP
rs536468839 2070 dbSNP
rs1040104471 2071 dbSNP
rs567877399 2074 dbSNP
rs551179434 2076 dbSNP
rs1191572026 2077 dbSNP
rs1399504105 2084 dbSNP
rs1439455495 2088 dbSNP
rs1251238294 2089 dbSNP
rs1385253139 2089 dbSNP
rs756511691 2091 dbSNP
rs1242930728 2095 dbSNP
rs1194719668 2099 dbSNP
rs1197661416 2108 dbSNP
rs1340095489 2108 dbSNP
rs940409711 2111 dbSNP
rs1457721486 2115 dbSNP
rs1204698214 2122 dbSNP
rs1257324728 2124 dbSNP
rs373795505 2129 dbSNP
rs1348986311 2130 dbSNP
rs771951453 2133 dbSNP
rs531270512 2135 dbSNP
rs1232644685 2138 dbSNP
rs1167927594 2142 dbSNP
rs192696304 2143 dbSNP
rs745664455 2144 dbSNP
rs1470298965 2147 dbSNP
rs552205295 2149 dbSNP
rs532089301 2150 dbSNP
rs560004661 2152 dbSNP
rs1394463340 2154 dbSNP
rs1395259813 2154 dbSNP
rs778938309 2168 dbSNP
rs112820787 2171 dbSNP
rs1333704733 2171 dbSNP
rs1229628281 2173 dbSNP
rs1314950598 2175 dbSNP
rs969403808 2180 dbSNP
rs1265368919 2181 dbSNP
rs1394745771 2189 dbSNP
rs1171513842 2191 dbSNP
rs1261944082 2195 dbSNP
rs1448388746 2198 dbSNP
rs554002357 2199 dbSNP
rs1025421366 2200 dbSNP
rs992191859 2201 dbSNP
rs1480716874 2202 dbSNP
rs1031093351 2203 dbSNP
rs1364248568 2207 dbSNP
rs1181004973 2216 dbSNP
rs749315110 2217 dbSNP
rs75710591 2219 dbSNP
rs1158955986 2220 dbSNP
rs1259032091 2224 dbSNP
rs1402124683 2225 dbSNP
rs568540615 2230 dbSNP
rs529730933 2233 dbSNP
rs1429241276 2234 dbSNP
rs1211039977 2236 dbSNP
rs1340012184 2238 dbSNP
rs62313422 2242 dbSNP
rs1310985993 2245 dbSNP
rs968220897 2245 dbSNP
rs1485138725 2246 dbSNP
rs1029187021 2251 dbSNP
rs996407051 2252 dbSNP
rs1352393748 2255 dbSNP
rs372443050 2257 dbSNP
rs1262039938 2258 dbSNP
rs148883748 2262 dbSNP
rs149398529 2262 dbSNP
rs201294806 2262 dbSNP
rs772922533 2262 dbSNP
rs1217777068 2263 dbSNP
rs147820528 2263 dbSNP
rs1421738345 2267 dbSNP
rs551564125 2267 dbSNP
rs1360134541 2268 dbSNP
rs1280611025 2270 dbSNP
rs1425332638 2271 dbSNP
rs1238989424 2272 dbSNP
rs1334566979 2274 dbSNP
rs1295175130 2283 dbSNP
rs1491320376 2283 dbSNP
rs558392358 2283 dbSNP
rs1491368528 2284 dbSNP
rs1040414064 2285 dbSNP
rs752870536 2285 dbSNP
rs1415541862 2292 dbSNP
rs1375055291 2293 dbSNP
rs144376145 2294 dbSNP
rs558624260 2294 dbSNP
rs1488114408 2295 dbSNP
rs1177767913 2298 dbSNP
rs1004557403 2300 dbSNP
rs1177805381 2301 dbSNP
rs886147057 2302 dbSNP
rs997719 2304 dbSNP
rs1166958954 2308 dbSNP
rs1348274419 2309 dbSNP
rs553072528 2311 dbSNP
rs536785671 2312 dbSNP
rs567752579 2319 dbSNP
rs1385440078 2321 dbSNP
rs1240635119 2322 dbSNP
rs1299179617 2322 dbSNP
rs1403128621 2323 dbSNP
rs1157876436 2324 dbSNP
rs557634337 2325 dbSNP
rs930457666 2326 dbSNP
rs927142024 2333 dbSNP
rs1188031130 2335 dbSNP
rs1320528828 2337 dbSNP
rs112392797 2340 dbSNP
rs1254876525 2345 dbSNP
rs949985572 2349 dbSNP
rs571977411 2355 dbSNP
rs13952 2362 dbSNP
rs1243566411 2365 dbSNP
rs1445456618 2377 dbSNP
rs992535039 2379 dbSNP
rs956769411 2388 dbSNP
rs763333619 2393 dbSNP
rs979513850 2397 dbSNP
rs1204961276 2400 dbSNP
rs532030380 2414 dbSNP
rs1464558685 2415 dbSNP
rs566489454 2415 dbSNP
rs1275658771 2419 dbSNP
rs61132735 2420 dbSNP
rs57945204 2421 dbSNP
rs386676659 2422 dbSNP
rs1300645917 2423 dbSNP
rs1291623473 2426 dbSNP
rs966659467 2434 dbSNP
rs1214594133 2435 dbSNP
rs114515824 2438 dbSNP
rs1315949692 2439 dbSNP
rs147577198 2440 dbSNP
rs1263699365 2441 dbSNP
rs1443865998 2445 dbSNP
rs1207797770 2446 dbSNP
rs886142940 2454 dbSNP
rs1483076968 2457 dbSNP
rs1187152012 2463 dbSNP
rs1317333845 2466 dbSNP
rs559768423 2467 dbSNP
rs9316 2468 dbSNP
rs1170516270 2471 dbSNP
rs1430613515 2471 dbSNP
rs879646645 2472 dbSNP
rs1396522799 2473 dbSNP
rs905630748 2477 dbSNP
rs1165571271 2480 dbSNP
rs1431057479 2484 dbSNP
rs564857955 2485 dbSNP
rs1299489943 2486 dbSNP
rs1460433027 2490 dbSNP
rs545316005 2490 dbSNP
rs573040728 2491 dbSNP
rs1044223683 2492 dbSNP
rs756768029 2493 dbSNP
rs1187816744 2494 dbSNP
rs571683874 2494 dbSNP
rs1475522164 2495 dbSNP
rs536512172 2500 dbSNP
rs751447765 2503 dbSNP
rs917114661 2504 dbSNP
rs1487311006 2507 dbSNP
rs1262435492 2508 dbSNP
rs149880926 2509 dbSNP
rs1247750801 2510 dbSNP
rs375521123 2512 dbSNP
rs1189809267 2514 dbSNP
rs766243380 2515 dbSNP
rs1334185011 2516 dbSNP
rs62313421 2518 dbSNP
rs1287782719 2519 dbSNP
rs1332728503 2520 dbSNP
rs1802542 2521 dbSNP
rs923966576 2521 dbSNP
rs979419281 2522 dbSNP
rs547522856 2523 dbSNP
rs1290726131 2532 dbSNP
rs541971941 2532 dbSNP
rs553681989 2532 dbSNP
rs79921409 2532 dbSNP
rs1269843062 2533 dbSNP
rs574184374 2536 dbSNP
rs975274844 2537 dbSNP
rs1372954081 2538 dbSNP
rs1326445137 2540 dbSNP
rs1440056187 2542 dbSNP
rs1392255685 2547 dbSNP
rs1378078465 2548 dbSNP
rs1438742306 2552 dbSNP
rs771865710 2552 dbSNP
rs983751097 2553 dbSNP
rs1355073333 2554 dbSNP
rs1306868875 2555 dbSNP
rs1418274266 2555 dbSNP
rs950346447 2558 dbSNP
rs1239776367 2559 dbSNP
rs1027302335 2560 dbSNP
rs1358483351 2566 dbSNP
rs1447999292 2566 dbSNP
rs1226717624 2567 dbSNP
rs1289736245 2569 dbSNP
rs1255310458 2572 dbSNP
rs994519790 2573 dbSNP
rs1200881362 2576 dbSNP
rs1236807111 2577 dbSNP
rs905578305 2579 dbSNP
rs1022724526 2583 dbSNP
rs1187743483 2584 dbSNP
rs1014496580 2587 dbSNP
rs116639662 2588 dbSNP
rs1053426152 2589 dbSNP
rs1162150643 2589 dbSNP
rs1206643642 2590 dbSNP
rs934570497 2591 dbSNP
rs1329036039 2593 dbSNP
rs1399340995 2594 dbSNP
rs1438470831 2598 dbSNP
rs1453113491 2598 dbSNP
rs537653876 2605 dbSNP
rs1043672971 2608 dbSNP
rs757652663 2610 dbSNP
rs946719444 2610 dbSNP
rs578194743 2617 dbSNP
rs762758853 2617 dbSNP
rs974891907 2621 dbSNP
rs944859515 2622 dbSNP
rs1317606175 2625 dbSNP
rs912089233 2630 dbSNP
rs139028248 2631 dbSNP
rs1440385245 2632 dbSNP
rs1186185176 2634 dbSNP
rs1263352255 2639 dbSNP
rs984045161 2640 dbSNP
rs950917327 2649 dbSNP
rs1233382488 2651 dbSNP
rs1027917277 2660 dbSNP
rs1365394386 2661 dbSNP
rs973026016 2661 dbSNP
rs1299826267 2665 dbSNP
rs1442210170 2668 dbSNP
rs969750955 2669 dbSNP
rs772909769 2671 dbSNP
rs1436171333 2674 dbSNP
rs774285156 2679 dbSNP
rs1174651605 2682 dbSNP
rs1342427489 2684 dbSNP
rs1199576815 2688 dbSNP
rs1802544 2690 dbSNP
rs566242493 2693 dbSNP
rs1179496692 2695 dbSNP
rs546580080 2703 dbSNP
rs1262363169 2705 dbSNP
rs1802543 2706 dbSNP
rs1200732261 2713 dbSNP
rs998652082 2719 dbSNP
rs1465371265 2721 dbSNP
rs1232353573 2725 dbSNP
rs1203163653 2727 dbSNP
rs1173178783 2728 dbSNP
rs760328821 2737 dbSNP
rs904408523 2737 dbSNP
rs150917590 2740 dbSNP
rs141564694 2741 dbSNP
rs1361831378 2743 dbSNP
rs900542616 2744 dbSNP
rs1266854049 2746 dbSNP
rs530501276 2748 dbSNP
rs767932349 2749 dbSNP
rs1209808750 2761 dbSNP
rs1039513970 2763 dbSNP
rs1801067 2771 dbSNP
rs564773986 2778 dbSNP
rs1309005515 2779 dbSNP
rs911978157 2783 dbSNP
rs1047859520 2785 dbSNP
rs1488760990 2789 dbSNP
rs551276009 2790 dbSNP
rs1206351374 2798 dbSNP
rs1265188735 2802 dbSNP
rs1432347944 2804 dbSNP
rs1372582971 2805 dbSNP
rs929463341 2813 dbSNP
rs567950798 2814 dbSNP
rs1381124780 2816 dbSNP
rs1441817837 2821 dbSNP
rs920845422 2823 dbSNP
rs779520094 2834 dbSNP
rs1344742297 2844 dbSNP
rs369680059 2845 dbSNP
rs769725600 2847 dbSNP
rs188817622 2848 dbSNP
rs1311901016 2852 dbSNP
rs1389241729 2853 dbSNP
rs1465821575 2856 dbSNP
rs1357810380 2857 dbSNP
rs915554790 2859 dbSNP
rs77885237 2861 dbSNP
rs1305871481 2862 dbSNP
rs1321725724 2863 dbSNP
rs959780872 2864 dbSNP
rs1263555608 2869 dbSNP
rs760055182 2870 dbSNP
rs780549942 2872 dbSNP
rs755186869 2876 dbSNP
rs751817353 2883 dbSNP
rs998640633 2885 dbSNP
rs780259027 2887 dbSNP
rs1424428682 2889 dbSNP
rs772489105 2890 dbSNP
rs1021485809 2896 dbSNP
rs889331573 2899 dbSNP
rs1050700673 2901 dbSNP
rs1402840170 2902 dbSNP
rs758811072 2903 dbSNP
rs1180094087 2906 dbSNP
rs996745275 2907 dbSNP
rs899767404 2908 dbSNP
rs1334062704 2913 dbSNP
rs543017954 2914 dbSNP
rs1009322415 2916 dbSNP
rs1187536134 2922 dbSNP
rs574046440 2925 dbSNP
rs1262248160 2931 dbSNP
rs1203595882 2934 dbSNP
rs1232463762 2941 dbSNP
rs1216282546 2943 dbSNP
rs1183669903 2947 dbSNP
rs1047882184 2959 dbSNP
rs1474931073 2961 dbSNP
rs930927857 2979 dbSNP
rs929453256 2984 dbSNP
rs1464348509 2986 dbSNP
rs368344815 2990 dbSNP
rs200246259 2992 dbSNP
rs202203776 2993 dbSNP
rs1316264534 2997 dbSNP
rs1170250351 2999 dbSNP
rs1266223394 3000 dbSNP
rs1234526363 3003 dbSNP
rs920785357 3004 dbSNP
rs1300553072 3006 dbSNP
rs1467318406 3006 dbSNP
rs1355577848 3010 dbSNP
rs1310316944 3011 dbSNP
rs137931240 3011 dbSNP
rs1400081625 3012 dbSNP
rs869100438 3012 dbSNP
rs898150559 3015 dbSNP
rs1363691368 3017 dbSNP
rs563791539 3020 dbSNP
rs1312984507 3026 dbSNP
rs543959126 3030 dbSNP
rs1278466587 3033 dbSNP
rs908309367 3034 dbSNP
rs1485363183 3037 dbSNP
rs991964916 3046 dbSNP
rs1388481106 3047 dbSNP
rs578132115 3049 dbSNP
rs939176129 3060 dbSNP
rs1426383274 3061 dbSNP
rs924374803 3062 dbSNP
rs1173431397 3065 dbSNP
rs367896765 3066 dbSNP
rs534861091 3067 dbSNP
rs11932284 3073 dbSNP
rs1299551078 3075 dbSNP
rs968406175 3075 dbSNP
rs1358545023 3078 dbSNP
rs1430008397 3083 dbSNP
rs1275384884 3086 dbSNP
rs140163431 3087 dbSNP
rs146129186 3089 dbSNP
rs193014392 3090 dbSNP
rs956766615 3091 dbSNP
rs1217395316 3096 dbSNP
rs1288332146 3097 dbSNP
rs1018992828 3099 dbSNP
rs550145830 3107 dbSNP
rs536792596 3112 dbSNP
rs1215629207 3113 dbSNP
rs1362944739 3117 dbSNP
rs1485429338 3117 dbSNP
rs560443083 3118 dbSNP
rs1394075069 3121 dbSNP
rs1215510305 3125 dbSNP
rs1335445361 3128 dbSNP
rs1008978700 3134 dbSNP
rs889277823 3136 dbSNP
rs1029607881 3141 dbSNP
rs879517039 3144 dbSNP
rs995086560 3146 dbSNP
rs1377888484 3153 dbSNP
rs1295871752 3161 dbSNP
rs1324085531 3166 dbSNP
rs1008898009 3172 dbSNP
rs890486727 3175 dbSNP
rs1047830314 3178 dbSNP
rs1383067862 3185 dbSNP
rs899435250 3187 dbSNP
rs1311755099 3190 dbSNP
rs1038016549 3194 dbSNP
rs142906141 3196 dbSNP
rs551556311 3198 dbSNP
rs1291155045 3200 dbSNP
rs1453882166 3204 dbSNP
rs1252829407 3205 dbSNP
rs773430510 3205 dbSNP
rs1458506125 3206 dbSNP
rs115245273 3208 dbSNP
rs1469138804 3209 dbSNP
rs948901558 3209 dbSNP
rs1056230101 3213 dbSNP
rs1163385974 3214 dbSNP
rs1459873259 3214 dbSNP
rs746215808 3214 dbSNP
rs1163926395 3215 dbSNP
rs894723070 3218 dbSNP
rs1448722667 3220 dbSNP
rs1333567874 3222 dbSNP
rs939123596 3223 dbSNP
rs926469353 3225 dbSNP
rs765777204 3227 dbSNP
rs1456505922 3228 dbSNP
rs1359069390 3240 dbSNP
rs1231938033 3243 dbSNP
rs1273117471 3245 dbSNP
rs1318995296 3249 dbSNP
rs138329175 3249 dbSNP
rs1247953769 3256 dbSNP
rs549268593 3257 dbSNP
rs1171401837 3260 dbSNP
rs1448596819 3265 dbSNP
rs1388066022 3268 dbSNP
rs1238763205 3269 dbSNP
rs1473946201 3270 dbSNP
rs924298131 3271 dbSNP
rs575043451 3272 dbSNP
rs1165987177 3274 dbSNP
rs988075168 3277 dbSNP
rs975178350 3278 dbSNP
rs117839267 3286 dbSNP
rs1341732939 3287 dbSNP
rs956706967 3292 dbSNP
rs1250047070 3295 dbSNP
rs1338331267 3297 dbSNP
rs377637392 3300 dbSNP
rs34980053 3301 dbSNP
rs577049445 3302 dbSNP
rs1484381165 3319 dbSNP
rs1209558138 3320 dbSNP
rs1019519813 3321 dbSNP
rs529178270 3323 dbSNP
rs146329382 3324 dbSNP
rs987506462 3329 dbSNP
rs767204887 3331 dbSNP
rs1432920337 3342 dbSNP
rs80094926 3344 dbSNP
rs751137060 3345 dbSNP
rs1384483825 3347 dbSNP
rs533470608 3348 dbSNP
rs564386984 3354 dbSNP
rs72909806 3356 dbSNP
rs1015598827 3357 dbSNP
rs1345351576 3360 dbSNP
rs1209489222 3361 dbSNP
rs993504239 3363 dbSNP
rs1003843149 3364 dbSNP
rs1203244766 3366 dbSNP
rs1398754705 3369 dbSNP
rs1298869664 3371 dbSNP
rs1452883580 3381 dbSNP
rs1464680190 3382 dbSNP
rs1429315696 3392 dbSNP
rs1369020224 3393 dbSNP
rs572522034 3394 dbSNP
rs1056176067 3395 dbSNP
rs1455413535 3397 dbSNP
rs1287587347 3401 dbSNP
rs779990629 3407 dbSNP
rs1387682536 3408 dbSNP
rs371425862 3409 dbSNP
rs1013076723 3411 dbSNP
rs752414652 3413 dbSNP
rs1196713057 3414 dbSNP
rs1368329747 3418 dbSNP
rs1420298484 3420 dbSNP
rs1309547174 3421 dbSNP
rs770585021 3422 dbSNP
rs894661489 3423 dbSNP
rs1236284818 3431 dbSNP
rs1057363463 3437 dbSNP
rs762841450 3439 dbSNP
rs1481864853 3442 dbSNP
rs1467882092 3445 dbSNP
rs1193172428 3448 dbSNP
rs1239048161 3452 dbSNP
rs1003283288 3453 dbSNP
rs375308834 3456 dbSNP
rs903460740 3463 dbSNP
rs11737188 3467 dbSNP
rs542151196 3470 dbSNP
rs533970829 3473 dbSNP
rs745797014 3475 dbSNP
rs1167532242 3477 dbSNP
rs769753663 3479 dbSNP
rs1349052210 3480 dbSNP
rs367725261 3481 dbSNP
rs946556507 3482 dbSNP
rs915121343 3484 dbSNP
rs1231681689 3487 dbSNP
rs1305759512 3490 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |: || | ||||||| 
Target 5' -----cCUCUUUUUUGCUGCUg 3'
1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine, 3_ML_LG PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000602300.1 | 3UTR | CCUCUUUUUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000602300.1 | 3UTR | CCUCUUUUUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000602300.1 | 3UTR | CCUCUUUUUUGCUGCUGUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000602300.1 | 3UTR | CCUCUUUUUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000602300.1 | 3UTR | CCUCUUUUUUGCUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B