miRTarBase - #MIRT511847 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GPATCH8   
Synonyms GPATC8, KIAA0553
Description G-patch domain containing 8
Transcript NM_001002909   
Expression
Putative miRNA Targets on GPATCH8
3'UTR of GPATCH8
(miRNA target sites are highlighted)
>GPATCH8|NM_001002909|3'UTR
   1 GTTGGGGGATGGGATCCTAGGTAGGGCCAGGGGAGGAGACCCATAAATGTTCCCTTGGGGGTGTTGAGCCATTAATACCA
  81 GCAAGTAGAAGCTGGGATGGGCAGTGTCTGACAGCCAAAGAATTGAGTTTTGGCTTGCAGGGGTGGGTTTAGATTTGAAG
 161 TTTGCTTTCAGTTTACTATCAGGGATTTCTTTTTCCTGTCCTCCTCTCAATTTGTCCCTCCCTCTTCTGTGTTTCTAAGC
 241 TAGGGAACACCAGTAAGTGCTACCCACCCCTCTGCAGCAACATCTCCAAACTGTCAAGTTTAGATAATCCCCTCCTCCCT
 321 CTGCTTTTTTCCTCTGCTCTTCCCTTCTGTAAATTTTAAAACATTTTCCTCCCCTCTGGCCAGTGGGTTGTCACCAGAGC
 401 ACTTGCTGTGGGCCCATCTGGTCTTGCCTTCTCAGCGCCACAGGGAAGGCCAAGCTGTTCTAGTGGTGGAAGTGCCACCA
 481 TTTTGGGGTAGTATCTTTGACCATCTTTGGTGACGTTACGTTATCCCAGGTGAGGTGGAAAGCGTCTCACCTGGAACCTG
 561 ATATAACTCAGGCTGCAATTCCATCCAGTTCCCACATCAACGGAGCCACACATTTGGCACTGTTATCTTGGTATCCCTCA
 641 TCCCAGAAGAGGCATCTCCATATCCCAGAAAAGAAGATCCTATCATGAATAAAAGCTGTATGGCCCAGAGAGGAGCTCAT
 721 GTGTCTAAAGTGAAGGGTATATTTTCTTCTGTTGTGTTGATGTTTCCTTCTTAATTTATAGGATTTTTTTAATGTAAAAA
 801 ATTGCACTGAACTCTATAAACGTAAATGCTGCTTTTTGTAGCTCATATAAAAAAGGTTCCATATTTGTAGTATACTGCAA
 881 TAATATTTTTTACATCCAGCTCTTTAAGTGATCCTCGTTCTGGTGGCTTTGTGTAAATATGTTTGCCCTAGTTGAATTAA
 961 GAAACTCTAAAGGTTATAAAATGAAAACAAAAAATAAAATATTTGTTTTCTGCTAGATGCAAAACTGACTAAGCATGTAT
1041 ATTTTACCAAACTTATGTATTTTTTGAAGTTATGAACTATAAAATGTTAAAACATTTTTTGCTGGGACAAAATGTTAAGT
1121 AATTTGCAGTATGTAGTGCCCCCAGTATTGGGATTTTTGAGCTAATGGGCAGCAGTCAGCTGGGGGCTTCTGAGGGATGC
1201 TCATCTTTAACAGTCTCCCTCATGTACTTTTGCTGTTTTACACAGAGAAACAGGTAGACCCCACAGAGGAGAAGGAGGGG
1281 ATTCAACAGCTTTATTGTCTGGAAGCAGTGAGATTTGGTGATTGTCTGGGGGGATTCCTGGGTTTCCCTGGGTACCTTGT
1361 TCCAGGCAGTCAGTCCATTTGCCTTCCTAGTACTTAGCCCCCTCTGACAATTTTTTTTTTAATGTGCCTTTTGGGTTGGT
1441 AGAAACGGAAGTAGAAGTAGGCTGGAGGATGAGTTGGGACAGTCTTCCTTTTGTTGGGAGGTGAGCACATTTACAGATAT
1521 TTTGCTTCATAGTTTCCATGCCCTCTGCCCAGCTCAGTTTAGACAGTAAACGTTCCTTGTTTCTTTTCTCCCATGACACT
1601 GACAAGAGGAATTACCACCTCAGCCTCTTTTGCCCCTCTTCTTGCCTTTCACCCAGGCTCTCAGCCCTAATTAACACACT
1681 GACCCAAAGGTGCTTGTGTTGCAGGTCCCATCTCCTTTGATGAGGTTAACAATTCCCACTTTGGCATTTTCCTAACTATT
1761 CGTGTGGCTAGAATTGGTTGGTTGGTCACTTGACAAGAAAAACCATACTTACCTGGGCCAAGGCTCTGTTCCTGCCTTCG
1841 CAAATTCTCAAAAGAGTAAAGTTTATGAAAAGAAAGTGGCAGGCAAACACAACTCTTGACTGCCCTCCCACCCTCCTACC
1921 TGTTCAGTACTCATCTGATTCAGAAGCATCACTTCTTGGATAACTAGCACTGGAAAAATGAAATCATCTGTGTAAGTGAA
2001 GGGACTCATTTTTCTTTGCTTTCAGCCCATGTAAATAAATAATACAGTATTAACATTTTCGTGCTGCTTCCCATTAGCTT
2081 GTAGATTGAGCCATACTCTGGCTGCCTCTTTGCCTTCCTAGGGGCATTTTCTTTAACTTCCAGAATAGTGATTTTAAAAG
2161 TAAAAATAAAAATAAACCTTACTTACAAGCATAACAGATTGTATTTAACTTTATCACATATGATAGAGATATATATGCTG
2241 TAAAATGAGGGAAAGGAACTTTCTAATAAACCAATGATTTGTGGAAACTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUA-CACGACGAu 5'
               | |||| | |||||||| 
Target 5' gtattAACATTTTCGTGCTGCTt 3'
2047 - 2069 161.00 -14.60
2
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||||   ||  ||||||| 
Target 5' taTAAAC--GTAAATGCTGCTt 3'
815 - 834 152.00 -11.90
3
miRNA  3' guguuuGGUA-AU--ACACGACGAu 5'
                :||| ||  | |||||:| 
Target 5' tctcccTCATGTACTTTTGCTGTTt 3'
1214 - 1238 134.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30448569 52 COSMIC
COSN30171871 105 COSMIC
COSN19658672 122 COSMIC
COSN30165209 125 COSMIC
COSN31507905 133 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs993326628 2 dbSNP
rs1395797854 6 dbSNP
rs762547138 8 dbSNP
rs1391505636 9 dbSNP
rs1467615794 11 dbSNP
rs1203092995 12 dbSNP
rs1165141003 13 dbSNP
rs867103452 14 dbSNP
rs775141892 21 dbSNP
rs1411795246 23 dbSNP
rs769229037 26 dbSNP
rs1473752335 29 dbSNP
rs200128147 31 dbSNP
rs1363693652 32 dbSNP
rs781177916 35 dbSNP
rs370530987 36 dbSNP
rs770824294 38 dbSNP
rs1434983818 41 dbSNP
rs369498242 43 dbSNP
rs1326480776 50 dbSNP
rs1267355137 52 dbSNP
rs569257493 53 dbSNP
rs758281471 57 dbSNP
rs530207828 58 dbSNP
rs561838924 60 dbSNP
rs748910017 62 dbSNP
rs779343082 64 dbSNP
rs1343848694 66 dbSNP
rs777431073 79 dbSNP
rs1388033844 80 dbSNP
rs1222344269 84 dbSNP
rs1008034749 86 dbSNP
rs1187890956 87 dbSNP
rs1459325581 95 dbSNP
rs914585691 98 dbSNP
rs755094128 103 dbSNP
rs1477485711 104 dbSNP
rs755892990 110 dbSNP
rs753911891 112 dbSNP
rs1463132059 113 dbSNP
rs766876139 114 dbSNP
rs1209253818 117 dbSNP
rs889136557 120 dbSNP
rs1454472286 128 dbSNP
rs1403844840 131 dbSNP
rs1336055463 138 dbSNP
rs1276227792 139 dbSNP
rs955972576 140 dbSNP
rs761043111 141 dbSNP
rs1386936029 142 dbSNP
rs750958709 143 dbSNP
rs1327181464 146 dbSNP
rs767815210 147 dbSNP
rs1390287557 148 dbSNP
rs762174859 153 dbSNP
rs1364513491 154 dbSNP
rs1321340789 157 dbSNP
rs971628239 160 dbSNP
rs1437901024 170 dbSNP
rs1404614850 173 dbSNP
rs1228654136 184 dbSNP
rs765260389 189 dbSNP
rs1156421532 198 dbSNP
rs1052164970 203 dbSNP
rs567097021 207 dbSNP
rs1012672645 208 dbSNP
rs1273795313 209 dbSNP
rs1489418781 211 dbSNP
rs1415337602 214 dbSNP
rs1427734868 217 dbSNP
rs1173921683 223 dbSNP
rs887491268 224 dbSNP
rs775123608 227 dbSNP
rs769494701 250 dbSNP
rs755532852 251 dbSNP
rs1472502093 252 dbSNP
rs1465872788 255 dbSNP
rs1241806075 256 dbSNP
rs78265957 262 dbSNP
rs1235598538 263 dbSNP
rs1209372458 264 dbSNP
rs550971153 265 dbSNP
rs192580684 267 dbSNP
rs1280526817 270 dbSNP
rs529039919 272 dbSNP
rs1293408574 275 dbSNP
rs1052674676 281 dbSNP
rs993145064 284 dbSNP
rs1409836002 287 dbSNP
rs1341799550 291 dbSNP
rs770507690 295 dbSNP
rs754278869 296 dbSNP
rs1227629205 299 dbSNP
rs1313119172 303 dbSNP
rs1323479464 304 dbSNP
rs1037682963 309 dbSNP
rs1377081356 309 dbSNP
rs1284083720 314 dbSNP
rs746862751 315 dbSNP
rs1264753169 319 dbSNP
rs1361239970 323 dbSNP
rs75756764 324 dbSNP
rs547168928 325 dbSNP
rs528704127 326 dbSNP
rs560253877 332 dbSNP
rs1189157314 344 dbSNP
rs1450748271 349 dbSNP
rs1416445213 359 dbSNP
rs545144890 363 dbSNP
rs1164701911 365 dbSNP
rs561561599 372 dbSNP
rs914638007 373 dbSNP
rs1473106927 374 dbSNP
rs1429895905 375 dbSNP
rs1238979648 380 dbSNP
rs915580703 382 dbSNP
rs1380355735 393 dbSNP
rs1314288783 394 dbSNP
rs1202836892 398 dbSNP
rs1482615099 399 dbSNP
rs1275543312 402 dbSNP
rs1207602972 407 dbSNP
rs1319953607 408 dbSNP
rs990130623 409 dbSNP
rs1408813683 411 dbSNP
rs1229363650 413 dbSNP
rs562535266 415 dbSNP
rs959693689 418 dbSNP
rs1409521629 427 dbSNP
rs1351520944 433 dbSNP
rs1308207964 434 dbSNP
rs188060173 436 dbSNP
rs760944572 437 dbSNP
rs971938344 443 dbSNP
rs1272547691 444 dbSNP
rs573927607 445 dbSNP
rs555380310 449 dbSNP
rs1482490980 451 dbSNP
rs1419872215 455 dbSNP
rs1181622069 457 dbSNP
rs779946357 460 dbSNP
rs1472121674 463 dbSNP
rs1249258991 466 dbSNP
rs1252302488 467 dbSNP
rs1451844408 471 dbSNP
rs773060282 487 dbSNP
rs1487652743 488 dbSNP
rs767294512 497 dbSNP
rs1016482958 498 dbSNP
rs1222322971 502 dbSNP
rs1323585193 504 dbSNP
rs1023228689 505 dbSNP
rs1266737496 509 dbSNP
rs1228341876 510 dbSNP
rs991292019 515 dbSNP
rs1290637019 519 dbSNP
rs1247475483 520 dbSNP
rs761495097 533 dbSNP
rs1392766707 535 dbSNP
rs768083579 536 dbSNP
rs1292599553 540 dbSNP
rs540000623 542 dbSNP
rs750965213 543 dbSNP
rs1396076582 544 dbSNP
rs1007650951 550 dbSNP
rs1456687443 553 dbSNP
rs774033168 557 dbSNP
rs1412398284 561 dbSNP
rs1027393300 563 dbSNP
rs572719339 564 dbSNP
rs764838408 572 dbSNP
rs759072706 573 dbSNP
rs1290765455 575 dbSNP
rs776369178 578 dbSNP
rs1489477447 586 dbSNP
rs372057729 587 dbSNP
rs1246316393 591 dbSNP
rs1030407376 600 dbSNP
rs1465796815 601 dbSNP
rs768025834 605 dbSNP
rs1018574950 610 dbSNP
rs885757 611 dbSNP
rs885758 612 dbSNP
rs1231445178 614 dbSNP
rs1311981261 621 dbSNP
rs1293410808 622 dbSNP
rs760296741 626 dbSNP
rs1426879590 628 dbSNP
rs1052705429 639 dbSNP
rs1372516075 640 dbSNP
rs749284246 642 dbSNP
rs1434276736 644 dbSNP
rs1402736478 646 dbSNP
rs1049905206 649 dbSNP
rs1389362965 658 dbSNP
rs1458560461 659 dbSNP
rs1290565289 661 dbSNP
rs932801118 662 dbSNP
rs1376878743 665 dbSNP
rs773009678 674 dbSNP
rs1455774935 687 dbSNP
rs1388391705 695 dbSNP
rs893247991 698 dbSNP
rs775282622 700 dbSNP
rs1218883792 703 dbSNP
rs769685097 705 dbSNP
rs768034898 713 dbSNP
rs879921893 719 dbSNP
rs1483103261 721 dbSNP
rs1257008659 723 dbSNP
rs948245694 725 dbSNP
rs1349684696 727 dbSNP
rs772184433 734 dbSNP
rs1226954266 735 dbSNP
rs747917493 737 dbSNP
rs184802403 739 dbSNP
rs992579603 741 dbSNP
rs1473485940 746 dbSNP
rs1401196657 759 dbSNP
rs1303276508 760 dbSNP
rs1201788395 766 dbSNP
rs1436798864 770 dbSNP
rs1405855352 772 dbSNP
rs1489930076 773 dbSNP
rs915807351 781 dbSNP
rs991349566 790 dbSNP
rs1348236126 791 dbSNP
rs755179686 791 dbSNP
rs1366725600 792 dbSNP
rs1168201236 797 dbSNP
rs1205584338 801 dbSNP
rs1450123064 802 dbSNP
rs751926618 804 dbSNP
rs1374887783 805 dbSNP
rs1435764508 809 dbSNP
rs764413825 812 dbSNP
rs1423790130 813 dbSNP
rs1352549261 816 dbSNP
rs768592358 821 dbSNP
rs749410501 822 dbSNP
rs971969376 826 dbSNP
rs1271989118 834 dbSNP
rs963231086 838 dbSNP
rs1357438923 840 dbSNP
rs1204029351 845 dbSNP
rs536960858 846 dbSNP
rs1342224240 854 dbSNP
rs145310816 856 dbSNP
rs1242507420 860 dbSNP
rs533958974 873 dbSNP
rs986403161 877 dbSNP
rs1313357537 883 dbSNP
rs1416320291 886 dbSNP
rs567921280 893 dbSNP
rs756147407 896 dbSNP
rs372813786 898 dbSNP
rs746021383 914 dbSNP
rs557366304 915 dbSNP
rs535483665 916 dbSNP
rs192968633 917 dbSNP
rs1410788080 918 dbSNP
rs1457833352 920 dbSNP
rs546340018 921 dbSNP
rs1369494639 922 dbSNP
rs1167744928 926 dbSNP
rs1008542743 937 dbSNP
rs955839975 939 dbSNP
rs1028516522 940 dbSNP
rs1251608591 940 dbSNP
rs148844931 941 dbSNP
rs1438111857 950 dbSNP
rs528669072 952 dbSNP
rs1252027387 956 dbSNP
rs1207489940 959 dbSNP
rs779099307 960 dbSNP
rs1355042863 962 dbSNP
rs187337402 964 dbSNP
rs1235086664 965 dbSNP
rs752093968 966 dbSNP
rs374419419 973 dbSNP
rs757841956 973 dbSNP
rs1343614293 982 dbSNP
rs1287538291 983 dbSNP
rs1410666529 994 dbSNP
rs1202624253 995 dbSNP
rs548169366 995 dbSNP
rs1178707834 1002 dbSNP
rs764394790 1002 dbSNP
rs1337815723 1004 dbSNP
rs1321846422 1005 dbSNP
rs1235731462 1022 dbSNP
rs780225432 1031 dbSNP
rs999351878 1031 dbSNP
rs1386218282 1033 dbSNP
rs1030971914 1037 dbSNP
rs1001117245 1041 dbSNP
rs950067814 1043 dbSNP
rs904142744 1047 dbSNP
rs1416585782 1048 dbSNP
rs915864890 1053 dbSNP
rs1436489773 1055 dbSNP
rs778019612 1055 dbSNP
rs371861723 1056 dbSNP
rs1045314907 1057 dbSNP
rs1160441702 1069 dbSNP
rs1183253459 1070 dbSNP
rs753425838 1072 dbSNP
rs1055718293 1073 dbSNP
rs930508774 1076 dbSNP
rs1196340963 1078 dbSNP
rs1012861050 1079 dbSNP
rs920436082 1086 dbSNP
rs1248170242 1087 dbSNP
rs896635917 1088 dbSNP
rs766113266 1092 dbSNP
rs971896011 1093 dbSNP
rs1253144219 1094 dbSNP
rs756549462 1101 dbSNP
rs183442963 1102 dbSNP
rs772885894 1105 dbSNP
rs754437748 1106 dbSNP
rs1378464563 1110 dbSNP
rs1352580266 1122 dbSNP
rs938405670 1123 dbSNP
rs1273262169 1125 dbSNP
rs1232869427 1132 dbSNP
rs766783789 1133 dbSNP
rs767163653 1137 dbSNP
rs1458036868 1138 dbSNP
rs1035947712 1141 dbSNP
rs1323157240 1144 dbSNP
rs941698323 1145 dbSNP
rs1387076723 1146 dbSNP
rs1380095956 1150 dbSNP
rs1330801043 1159 dbSNP
rs1388468940 1161 dbSNP
rs909149541 1162 dbSNP
rs1331132038 1164 dbSNP
rs371782273 1166 dbSNP
rs1288580931 1173 dbSNP
rs986046058 1184 dbSNP
rs1240813969 1187 dbSNP
rs1337842627 1189 dbSNP
rs1402759238 1193 dbSNP
rs533086533 1194 dbSNP
rs1170426056 1196 dbSNP
rs1322571967 1199 dbSNP
rs997056225 1201 dbSNP
rs1403507416 1202 dbSNP
rs774440476 1222 dbSNP
rs562338757 1223 dbSNP
rs749176137 1226 dbSNP
rs544150537 1227 dbSNP
rs1447147867 1233 dbSNP
rs1247269455 1238 dbSNP
rs957582511 1249 dbSNP
rs956733992 1256 dbSNP
rs1216451999 1261 dbSNP
rs1428790439 1263 dbSNP
rs756590008 1265 dbSNP
rs903290384 1270 dbSNP
rs1410451764 1271 dbSNP
rs1276290597 1272 dbSNP
rs1453647576 1275 dbSNP
rs1200086844 1288 dbSNP
rs192512074 1297 dbSNP
rs1000903815 1298 dbSNP
rs1305912251 1304 dbSNP
rs561617530 1305 dbSNP
rs1045808792 1306 dbSNP
rs1226184318 1307 dbSNP
rs968066195 1312 dbSNP
rs775566598 1315 dbSNP
rs1024332772 1318 dbSNP
rs770107270 1319 dbSNP
rs1357757182 1322 dbSNP
rs540159966 1324 dbSNP
rs1387945052 1325 dbSNP
rs572680991 1326 dbSNP
rs1344467674 1327 dbSNP
rs1014710989 1328 dbSNP
rs766113388 1329 dbSNP
rs1375615824 1330 dbSNP
rs1314856332 1332 dbSNP
rs557567368 1333 dbSNP
rs1265890980 1334 dbSNP
rs1455546681 1334 dbSNP
rs757352480 1341 dbSNP
rs1389038351 1349 dbSNP
rs930561086 1351 dbSNP
rs540302167 1362 dbSNP
rs1235505159 1367 dbSNP
rs896661278 1368 dbSNP
rs1184848363 1373 dbSNP
rs1056523641 1390 dbSNP
rs1418794896 1394 dbSNP
rs758554667 1394 dbSNP
rs1485878845 1399 dbSNP
rs1282688018 1401 dbSNP
rs1203306101 1402 dbSNP
rs1244858062 1403 dbSNP
rs1341517253 1403 dbSNP
rs1273855347 1408 dbSNP
rs1216826095 1410 dbSNP
rs1377704197 1411 dbSNP
rs940524940 1413 dbSNP
rs1364622927 1420 dbSNP
rs1370919506 1421 dbSNP
rs750617614 1421 dbSNP
rs765540121 1421 dbSNP
rs1284140406 1422 dbSNP
rs1390550655 1423 dbSNP
rs1415714164 1424 dbSNP
rs1357796155 1426 dbSNP
rs1314282427 1427 dbSNP
rs112724419 1434 dbSNP
rs931692459 1435 dbSNP
rs1353408088 1438 dbSNP
rs778317561 1446 dbSNP
rs1002581559 1447 dbSNP
rs749942391 1449 dbSNP
rs1231336490 1461 dbSNP
rs758674790 1466 dbSNP
rs1480543645 1470 dbSNP
rs989076933 1477 dbSNP
rs1411450613 1494 dbSNP
rs957636312 1500 dbSNP
rs897619589 1509 dbSNP
rs753154316 1510 dbSNP
rs187567430 1513 dbSNP
rs1180253601 1514 dbSNP
rs779541210 1519 dbSNP
rs537489505 1520 dbSNP
rs755748909 1531 dbSNP
rs1470316900 1536 dbSNP
rs1206643587 1539 dbSNP
rs1320008812 1541 dbSNP
rs1289746891 1546 dbSNP
rs1234468408 1547 dbSNP
rs941723019 1554 dbSNP
rs1337383957 1556 dbSNP
rs1286915867 1564 dbSNP
rs1314244838 1565 dbSNP
rs1407598030 1566 dbSNP
rs1372083416 1571 dbSNP
rs1366037113 1572 dbSNP
rs908852611 1576 dbSNP
rs967569385 1578 dbSNP
rs1050783708 1579 dbSNP
rs1024855829 1580 dbSNP
rs1211318596 1587 dbSNP
rs750824617 1590 dbSNP
rs145537920 1591 dbSNP
rs1460225360 1594 dbSNP
rs1298395642 1598 dbSNP
rs762215401 1606 dbSNP
rs894536010 1606 dbSNP
rs750119243 1608 dbSNP
rs767957402 1616 dbSNP
rs866093714 1618 dbSNP
rs1325111873 1619 dbSNP
rs1461929918 1623 dbSNP
rs767075918 1625 dbSNP
rs1419758723 1626 dbSNP
rs923099435 1628 dbSNP
rs1034370883 1632 dbSNP
rs1156757404 1633 dbSNP
rs761409961 1635 dbSNP
rs1408903426 1636 dbSNP
rs1417000554 1644 dbSNP
rs751540757 1649 dbSNP
rs1176274094 1650 dbSNP
rs1360716221 1650 dbSNP
rs1487520782 1655 dbSNP
rs557182307 1657 dbSNP
rs535806687 1660 dbSNP
rs1268466535 1663 dbSNP
rs899112577 1668 dbSNP
rs1266793070 1669 dbSNP
rs762636968 1674 dbSNP
rs761603593 1676 dbSNP
rs1307202652 1680 dbSNP
rs940556914 1684 dbSNP
rs1364835554 1686 dbSNP
rs1203422864 1689 dbSNP
rs1302144993 1690 dbSNP
rs1441528712 1692 dbSNP
rs1396524206 1693 dbSNP
rs769507905 1700 dbSNP
rs924053658 1703 dbSNP
rs1345593689 1705 dbSNP
rs112471632 1710 dbSNP
rs1051998568 1713 dbSNP
rs1431703847 1714 dbSNP
rs1394541978 1715 dbSNP
rs1194273966 1724 dbSNP
rs931744985 1725 dbSNP
rs968472816 1732 dbSNP
rs553678621 1736 dbSNP
rs1246680537 1742 dbSNP
rs1412678032 1744 dbSNP
rs1458770902 1745 dbSNP
rs1208673841 1752 dbSNP
rs1486384869 1754 dbSNP
rs1344687954 1757 dbSNP
rs1437215812 1758 dbSNP
rs770993057 1762 dbSNP
rs368133857 1764 dbSNP
rs1217489182 1770 dbSNP
rs1343872506 1780 dbSNP
rs1310136704 1782 dbSNP
rs1279180432 1786 dbSNP
rs1234298725 1787 dbSNP
rs1443937425 1788 dbSNP
rs796643443 1790 dbSNP
rs1295254926 1794 dbSNP
rs1381632029 1797 dbSNP
rs1289353325 1800 dbSNP
rs1331612328 1804 dbSNP
rs747147869 1810 dbSNP
rs1290484907 1812 dbSNP
rs1284103275 1815 dbSNP
rs936327876 1819 dbSNP
rs568923129 1820 dbSNP
rs1464367589 1831 dbSNP
rs1375002186 1832 dbSNP
rs1221657387 1836 dbSNP
rs1174526695 1839 dbSNP
rs551890058 1840 dbSNP
rs1388451587 1843 dbSNP
rs1432806805 1850 dbSNP
rs1193060568 1851 dbSNP
rs1470998978 1854 dbSNP
rs1429694348 1855 dbSNP
rs1260607971 1859 dbSNP
rs1156753401 1861 dbSNP
rs1264285685 1861 dbSNP
rs1407151368 1861 dbSNP
rs1180424480 1865 dbSNP
rs960951132 1868 dbSNP
rs1035232877 1869 dbSNP
rs1406097563 1871 dbSNP
rs1485552487 1874 dbSNP
rs1279115337 1875 dbSNP
rs1360546302 1877 dbSNP
rs1364003736 1879 dbSNP
rs1211189188 1882 dbSNP
rs535371881 1888 dbSNP
rs754382178 1892 dbSNP
rs1349396000 1900 dbSNP
rs926238185 1902 dbSNP
rs977705500 1903 dbSNP
rs1244375004 1905 dbSNP
rs1226604022 1907 dbSNP
rs182637174 1918 dbSNP
rs968001165 1920 dbSNP
rs1024491189 1924 dbSNP
rs775489270 1925 dbSNP
rs1014644523 1926 dbSNP
rs1307943441 1927 dbSNP
rs778119729 1932 dbSNP
rs1394023482 1936 dbSNP
rs1354601953 1938 dbSNP
rs1313688496 1941 dbSNP
rs1416898999 1947 dbSNP
rs1005939946 1948 dbSNP
rs1221278844 1950 dbSNP
rs1018357 1955 dbSNP
rs1439406638 1957 dbSNP
rs1359387190 1964 dbSNP
rs1368782062 1969 dbSNP
rs552848418 1972 dbSNP
rs14977 1976 dbSNP
rs958803884 1992 dbSNP
rs772673963 1995 dbSNP
rs1163329961 2001 dbSNP
rs1034423247 2002 dbSNP
rs1383504387 2003 dbSNP
rs1258720910 2005 dbSNP
rs1424023268 2006 dbSNP
rs1169481672 2008 dbSNP
rs1188188777 2013 dbSNP
rs1486487842 2016 dbSNP
rs1247792531 2017 dbSNP
rs764576709 2018 dbSNP
rs765355306 2028 dbSNP
rs774112681 2030 dbSNP
rs748630793 2039 dbSNP
rs1405793549 2040 dbSNP
rs759100375 2043 dbSNP
rs1450852066 2044 dbSNP
rs887447847 2046 dbSNP
rs763725094 2055 dbSNP
rs755308375 2059 dbSNP
rs762353311 2060 dbSNP
rs140718505 2061 dbSNP
rs568895402 2064 dbSNP
rs1292273659 2067 dbSNP
rs901790366 2079 dbSNP
rs1423824046 2090 dbSNP
rs756816661 2093 dbSNP
rs1167627775 2100 dbSNP
rs769620858 2117 dbSNP
rs1193910825 2125 dbSNP
rs1471815801 2127 dbSNP
rs1015298060 2135 dbSNP
rs1040303542 2145 dbSNP
rs1180670679 2147 dbSNP
rs1437880568 2151 dbSNP
rs1004808695 2156 dbSNP
rs1442749905 2156 dbSNP
rs935177722 2160 dbSNP
rs1444148749 2166 dbSNP
rs1211737090 2167 dbSNP
rs1390678525 2172 dbSNP
rs745765168 2175 dbSNP
rs1375050772 2177 dbSNP
rs751168416 2177 dbSNP
rs1273751772 2179 dbSNP
rs773861720 2187 dbSNP
rs1167513288 2189 dbSNP
rs979527502 2191 dbSNP
rs1215262249 2197 dbSNP
rs532156150 2199 dbSNP
rs946788544 2204 dbSNP
rs1240091094 2209 dbSNP
rs1337583645 2214 dbSNP
rs1299375166 2219 dbSNP
rs1372017592 2220 dbSNP
rs900289576 2221 dbSNP
rs763911152 2225 dbSNP
rs1053465158 2227 dbSNP
rs1328552235 2228 dbSNP
rs1224827548 2230 dbSNP
rs936386541 2231 dbSNP
rs923639440 2232 dbSNP
rs1384756064 2233 dbSNP
rs1225104896 2235 dbSNP
rs776432226 2236 dbSNP
rs1157596360 2237 dbSNP
rs1042418692 2242 dbSNP
rs916572559 2247 dbSNP
rs990876004 2255 dbSNP
rs1263981849 2256 dbSNP
rs1365014378 2260 dbSNP
rs946339676 2262 dbSNP
rs1220685579 2266 dbSNP
rs1191143701 2272 dbSNP
rs917473717 2274 dbSNP
rs960983322 2288 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUA-CACGACGAu 5'
               | |||| | |||||||| 
Target 5' -uauuAACAUUUUCGUGCUGCUu 3'
1 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_8 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000591680.1 | 3UTR | UAUUAACAUUUUCGUGCUGCUUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000591680.1 | 3UTR | UAUUAACAUUUUCGUGCUGCUUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000591680.1 | 3UTR | UAUUAACAUUUUCGUGCUGCUUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.611 2.1e-3 0.714 2.0e-4 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.521 3.8e-3 0.337 5.0e-2 25 Click to see details
GSE19536 Breast cancer 0.23 1.1e-2 0.231 1.0e-2 100 Click to see details
GSE19783 ER- ER- breast cancer 0.251 1.3e-2 0.286 5.3e-3 79 Click to see details
GSE27834 Pluripotent stem cells 0.552 1.3e-2 0.406 5.9e-2 16 Click to see details
GSE21032 Prostate cancer 0.229 1.9e-2 0.177 5.5e-2 83 Click to see details
GSE14794 Lymphoblastoid cells 0.181 4.4e-2 0.191 3.6e-2 90 Click to see details
GSE42095 Differentiated embryonic stem cells 0.34 5.6e-2 0.153 2.4e-1 23 Click to see details
GSE21849 B cell lymphoma 0.279 7.1e-2 0.457 6.3e-3 29 Click to see details
GSE28260 Renal cortex and medulla -0.423 7.5e-2 -0.374 1.0e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.251 8.3e-2 0.006 4.9e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.285 8.9e-2 0.251 1.2e-1 24 Click to see details
GSE28544 Breast cancer -0.26 1.1e-1 -0.177 2.0e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.149 1.2e-1 -0.062 3.1e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.173 2.0e-1 0.177 2.0e-1 25 Click to see details
GSE17306 Multiple myeloma 0.102 2.4e-1 0.078 3.0e-1 49 Click to see details
GSE19783 ER+ ER+ breast cancer -0.159 2.5e-1 -0.116 3.1e-1 20 Click to see details
GSE38226 Liver fibrosis 0.099 3.3e-1 0.194 2.0e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.083 4.0e-1 -0.273 2.0e-1 12 Click to see details
GSE17498 Multiple myeloma 0.031 4.2e-1 0.094 2.8e-1 40 Click to see details
GSE17498 Multiple myeloma 0.031 4.2e-1 0.094 2.8e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.984 0.01 1.000 0.5 4 Click to see details
COAD 0.739 0.02 0.738 0.02 8 Click to see details
KIRP -0.366 0.02 -0.370 0.02 32 Click to see details
LUAD 0.593 0.02 0.587 0.02 12 Click to see details
STAD -0.333 0.03 -0.481 0 32 Click to see details
CHOL -0.502 0.08 -0.400 0.14 9 Click to see details
HNSC 0.205 0.1 0.238 0.06 42 Click to see details
UCEC 0.286 0.12 0.270 0.13 19 Click to see details
LUSC -0.185 0.13 -0.125 0.23 38 Click to see details
ESCA 0.336 0.16 0.273 0.21 11 Click to see details
BRCA -0.107 0.17 -0.181 0.05 84 Click to see details
BLCA -0.216 0.19 -0.139 0.29 18 Click to see details
KIRC 0.102 0.2 0.096 0.22 68 Click to see details
PCPG -0.749 0.23 -1.000 0.5 3 Click to see details
PRAD 0.089 0.27 -0.044 0.38 50 Click to see details
CESC 0.346 0.39 0.500 0.33 3 Click to see details
LIHC -0.024 0.43 -0.015 0.46 49 Click to see details
THCA -0.021 0.44 -0.118 0.19 59 Click to see details
KICH -0.018 0.47 0.086 0.34 25 Click to see details
KICH -0.018 0.47 0.086 0.34 25 Click to see details
KICH -0.018 0.47 0.086 0.34 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*