miRTarBase - #MIRT514042 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATG14   
Synonyms ATG14L, BARKOR, KIAA0831
Description autophagy related 14
Transcript NM_014924   
Expression
Putative miRNA Targets on ATG14
3'UTR of ATG14
(miRNA target sites are highlighted)
>ATG14|NM_014924|3'UTR
   1 CGAGCATGGACCAAAACATACCAAATCTGCATCAAGAAAGTTCTTCTCCCACTACACTCTAGTAAACATTTTCTGTTTAA
  81 GTTAAGATAGTGTCTGGAACAAAGAGGTTAAAGTGTTGTTTTGTTTTGTCTTTTTAAGCAGGGAGACAAACATTTCTATT
 161 TGCCAAGTGGCCTGTGATGGTGACCAACATGCTTATGATAATTAAGAGAACAGGGGTCGAAGGTCTTTCTACCCAGACCA
 241 GTGCTGGTGGAAGGAGGACCTGTGCGTGTGGCCAGTTCTGCCAAGGAAGCAGTTGATTTGGGTTCCCTCTGGGCCCGGGC
 321 CACCGGGCCCACAGATATGGGTCAGTGTGCTGGTCCTTGCGGTGCTGAGACTGTTCCTGACACTTTAAGTTTTAGAGGTT
 401 GGTTGAATCACAAGAGGTGATTCTTGATTATTAGGACATGAAAGATAAAAGCTCTTTAATAAGAGTTTTTCTGCCATTGT
 481 TTTTTGTATGAGAACCAGCAGGCAATTTAAAATTTCTAATTTGGTCCTTTGATTTTGTTTGGGAGGGGTGAGTTACACGT
 561 ATTTTATTCATGCTGCTCTGTCGTAGTTTGTCAGACATTCCTGTTTTTCTTTCCCCCACACACCAAAGAAAATGAAAGTC
 641 TTTTTCTTTAGGACCCACATCCATAAATGGAAGAAATCCTGGCTGCAATAATGTCTAGAGAGTTTTTAACTATTTTCTTG
 721 TATTCTGAGGGGAATTAAGCTTATTCTTACCTAGTTGAATTCCTGCCATCCACACTATGAGCATTTTGAAATTGAACTTA
 801 TATTTTCTGGGTGAAAATAAGTCATGAAGGTCATTCCCTTATGTAAGCTCAATGCCTGCCTGGGCACAGGGGAAAAGCCA
 881 CTTAGTTAAGTGGCCTCTGGTCATTCTTGTGGTGTCCACTTTCTTTCTATGGGATTGAGTAGGTGGCAGGTGTTTTCAGG
 961 GGAAACCATCCTACTTGTTTCCCCGAACTCTTTGTTGCTCTGAGGACACAGCTTTGCTCAGAAATGCAGCGCAGATCCTT
1041 ACGGCTGATGCTACTCTGCTCTGTTCTGGGGAAAGCACAATATAAAGAAAGAATTTCCCAGCCAGGCGCAGTGGCTCACG
1121 CCTGTAATCCCAGCACTTTAGGAGGCCGAGGCAGGCGGATCACTTGAGGTCAGGAGTTTGAGAGCAGCCTGGCTAACATG
1201 GTGAAACCCTGTTTCTACTAAAAATACAAAAAATTACCGGGTGTGGTGGCGCACGCCTGTAATCCCAGCTACTCGGGAGG
1281 CTGCGGCAGGAGAATCGCTTGAACCGGGAGGCAGAGGTTGCAGTGAGCCGAGATTGTGCCATTGCACTCCAGCCTGGGCA
1361 ACAAGAGCGAAACTCCGTCTCAAAAAAAAAAAGAATTTCCCTCAGCAGGAGATCATTTTCAGCTCACGTGTCTTGTCATT
1441 CTTTTAGTGACAATCTTACAAGAAAACTATAATGAGAGAGGCATTATGTACAAATATGTAAGTAGTTTATTTTTAATAAC
1521 TGCAAAAAAATCCTATGTAACAACTACCAAAAGAAATCCTATGAAAGAGTCCTAACAGGCATTATTACCATATCTTATGT
1601 GATTGGCATGATAGCACCTCTGATAAATCATTCAGAGGTTTGCCATGCCCCAGCTTCTTTTCTCATCATAATAATTGTAG
1681 TTGATACTTTGCCTCCAAGTCCGAGGTGCTATATAGCTTTTGCTAATGGTATATTTGGTGTTTTGTATAGTTTTGGGTAG
1761 AGTTGCAGAACGGAGTTTATTTCTATCCGGTAGTCACAAATTCCTTGGCTCTATGAATTTTCCATGAAAGGAGGAAGTAG
1841 GCTTTTCTCGTTGTGGGTGGTCTTTTTTTTTTTTGGAGACGGAGTCTCACTCAGCTGCCCAGGCTGGAGTGTAGTGGCAC
1921 CATCTCCGCTCACTGCAACCACCATCTCCTGGGTTCAAGCAATTCTTCCATCTCAACCTCCCGAGTAGCTGGGATTATAG
2001 GCACCTGCCATCATGCCCAGCTAATTTTTGTATTTTAGTAAAGACGGGGGTTTTCACCATGTTGGCCAGGCTGGTCTTGA
2081 ACTCCTGACTTCAGGTGATCCGCTTGCCTTGGCCTCCTAAAGTGCTAGGATTACAGGCCTGAGCCACCGCGCCCGGCCCC
2161 TTATGGGTTCTTCTACACTGCTGGGATCTCTGTTTTAAGTGCTCAGCTTCATGATTGATTGCTGGGCTTCCATTTTCCCA
2241 TCCAGTTCTGGAGTTCGTAGAGAGTGAAGATGGTAGACTTGAACAGATAAATAAACTTAACGATCTTGTAAGAGTTGTCT
2321 AGCTACTTAAAACCCTCAGAAGTAAGAGCTTAGTCTCACGAGTTGTAAGAGTGGGATTTGGAGCTTGGTGGTGGAGACTG
2401 ACTTCAGCTGAGAGATGCACAACAGTCATGGTTTTCTTAAGCCTCTTATGAAACCATGAATGAGAGATGAAGCTAAAGAA
2481 TAGAATCCAGAGATCACAAACTCATCTAGAGTACTTCCACAAAATTTACAAAGATGTGGGAACTTTATGGATAGGATATA
2561 TTTTGTTTGTTGTTGTTAATATCAACTAGAGGCACTTTACATAGGGTTAAGTGATCGAACCCTTTTGTGGTTTTGAACAC
2641 CAACATACTGGCTTACACTGCTGAAATATTTTGGGTTTCATTATTTTGCACTGGATCCACCCTGTAAATACTCTTAAGTA
2721 TACATTTCAACCACTGTTTTTTCTACTCTTTTTGCTGCTCATTAAAATCTTTCATGTAGGTGCCAGAACCATATGTAAAC
2801 AGCTTTTTAAAAAATTGAAGCTGGTATTTTGTTTAAACAAAAAGCCATAGAACTTGGTCATGTTTTCCATTTTAAAATGA
2881 TTTACTGAAACAAAGTAATACTAATAAAAACCCACAGGCACCAAACAGGCTGCTTAAAATGGTCTGTTAAAGACATTTTT
2961 TGGTTATGGAATATAAGAAAAGTTTTGCACATCTGTAAGGGGGAAAAACAGTATATCACCATTGGGTAGAGTGGACGGGA
3041 CTCATGTAAGGACTCAATTTGGGGAAGAGCATTCAGTGGCATGCTGTTAGAGGACTAGTGTCCGAGAATCTCCTCACAGT
3121 ATCATGTTGCAGGAATTCCCCATTGCTCTGCAACTTCCAAACCAGTTTGAGTCATACAAATGTTTTCTAAACTTTTATTG
3201 TATTACTGCAATAAATCTTTTAACAGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||: || | ||||||| 
Target 5' tttctACTCTT-TTTGCTGCTc 3'
2740 - 2760 152.00 -8.70
2
miRNA  3' guGUUUGGUAAUA--CACGACGAu 5'
            |: |:: ||||   ||||||| 
Target 5' caCGTATT-TTATTCATGCTGCTc 3'
556 - 578 149.00 -12.50
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |:|||: ||   ||:|||| 
Target 5' ccCGAACTCTT---TGTTGCTc 3'
982 - 1000 141.00 -9.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24304829 1 COSMIC
COSN30522036 27 COSMIC
COSN26967098 43 COSMIC
COSN31516350 46 COSMIC
COSN30520542 86 COSMIC
COSN20196495 116 COSMIC
COSN31483751 134 COSMIC
COSN31524341 184 COSMIC
COSN31564024 222 COSMIC
COSN1169098 245 COSMIC
COSN15258925 307 COSMIC
COSN31533681 434 COSMIC
COSN20111325 559 COSMIC
COSN23721956 564 COSMIC
COSN31482308 573 COSMIC
COSN30175588 666 COSMIC
COSN19555930 697 COSMIC
COSN7021871 712 COSMIC
COSN5387723 713 COSMIC
COSN1169097 932 COSMIC
COSN1654307 1084 COSMIC
COSN17232458 1097 COSMIC
COSN1654306 1138 COSMIC
COSN25066499 1328 COSMIC
COSN31601110 1381 COSMIC
COSN30056280 1427 COSMIC
COSN20111323 1505 COSMIC
COSN17076390 1711 COSMIC
COSN20111321 1863 COSMIC
COSN8155185 2149 COSMIC
COSN16085582 2436 COSMIC
COSN1169096 2720 COSMIC
COSN31606630 2769 COSMIC
COSN31611051 2783 COSMIC
COSN6254105 2792 COSMIC
COSN30177163 2817 COSMIC
COSN26538244 2824 COSMIC
COSN31595412 2902 COSMIC
COSN20111318 2973 COSMIC
COSN26477268 3004 COSMIC
COSN31531601 3162 COSMIC
COSN24156622 3175 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766570685 1 dbSNP
rs576205797 2 dbSNP
rs750433610 5 dbSNP
rs1008369905 8 dbSNP
rs1286431293 9 dbSNP
rs765785216 10 dbSNP
rs370821908 21 dbSNP
rs763769489 21 dbSNP
rs1289636004 22 dbSNP
rs1355481138 23 dbSNP
rs1399128542 24 dbSNP
rs547191943 26 dbSNP
rs1417552825 29 dbSNP
rs777084059 31 dbSNP
rs895673471 36 dbSNP
rs201370665 39 dbSNP
rs761098909 43 dbSNP
rs774206717 44 dbSNP
rs1180965584 46 dbSNP
rs752417843 48 dbSNP
rs1262647796 51 dbSNP
rs781282993 54 dbSNP
rs193223490 55 dbSNP
rs1386503400 56 dbSNP
rs1357984198 58 dbSNP
rs940975997 59 dbSNP
rs554830379 60 dbSNP
rs1057148865 68 dbSNP
rs1392903609 81 dbSNP
rs1331845107 84 dbSNP
rs1342431632 87 dbSNP
rs1316479985 91 dbSNP
rs1001736401 93 dbSNP
rs899100647 96 dbSNP
rs1313205004 97 dbSNP
rs1323509834 106 dbSNP
rs536094229 107 dbSNP
rs1245703836 117 dbSNP
rs1381934856 118 dbSNP
rs1361213101 121 dbSNP
rs1338074696 124 dbSNP
rs561120147 130 dbSNP
rs1422614831 131 dbSNP
rs1239124788 139 dbSNP
rs927406807 140 dbSNP
rs114030577 142 dbSNP
rs940390547 145 dbSNP
rs1163557706 153 dbSNP
rs1423883842 158 dbSNP
rs947198137 158 dbSNP
rs1371183175 170 dbSNP
rs1467156376 171 dbSNP
rs914438532 177 dbSNP
rs1405012906 183 dbSNP
rs988711281 195 dbSNP
rs886090280 196 dbSNP
rs1381697210 197 dbSNP
rs1396659027 205 dbSNP
rs1295000720 206 dbSNP
rs1477964598 213 dbSNP
rs1220945226 214 dbSNP
rs956002952 214 dbSNP
rs546779435 215 dbSNP
rs1019669905 218 dbSNP
rs986491017 219 dbSNP
rs1257383252 223 dbSNP
rs1164722285 227 dbSNP
rs1051505337 232 dbSNP
rs1483400409 238 dbSNP
rs953889811 241 dbSNP
rs754999122 254 dbSNP
rs995250326 255 dbSNP
rs188833902 259 dbSNP
rs899325942 259 dbSNP
rs975623665 265 dbSNP
rs570600886 266 dbSNP
rs1466711862 267 dbSNP
rs1288531023 270 dbSNP
rs879117466 270 dbSNP
rs1358905438 280 dbSNP
rs552198516 289 dbSNP
rs73279091 292 dbSNP
rs1226941799 295 dbSNP
rs978989321 296 dbSNP
rs1341387110 298 dbSNP
rs938696884 303 dbSNP
rs527343414 305 dbSNP
rs1044487203 307 dbSNP
rs967410076 311 dbSNP
rs1280129277 312 dbSNP
rs114671248 315 dbSNP
rs115370885 316 dbSNP
rs369022580 317 dbSNP
rs74620276 317 dbSNP
rs1034824057 318 dbSNP
rs1407076945 321 dbSNP
rs1394025936 324 dbSNP
rs115743276 325 dbSNP
rs80269278 330 dbSNP
rs201888887 332 dbSNP
rs551108923 333 dbSNP
rs113633018 337 dbSNP
rs146474280 338 dbSNP
rs201298502 338 dbSNP
rs577054702 338 dbSNP
rs1004755956 340 dbSNP
rs1295817899 343 dbSNP
rs562377677 344 dbSNP
rs41299199 347 dbSNP
rs1200162071 349 dbSNP
rs1355473887 352 dbSNP
rs1240208573 359 dbSNP
rs116309676 360 dbSNP
rs767188142 361 dbSNP
rs1247217964 362 dbSNP
rs1039179307 364 dbSNP
rs942904834 373 dbSNP
rs41307104 376 dbSNP
rs979041805 386 dbSNP
rs1159506120 387 dbSNP
rs1318790877 387 dbSNP
rs1384633431 391 dbSNP
rs1403682289 393 dbSNP
rs950991824 397 dbSNP
rs1035941584 398 dbSNP
rs1003567701 401 dbSNP
rs1329784084 405 dbSNP
rs946288127 413 dbSNP
rs1221975029 414 dbSNP
rs1447005535 424 dbSNP
rs1313937996 428 dbSNP
rs1353560123 429 dbSNP
rs913446520 430 dbSNP
rs1229600099 435 dbSNP
rs1290487038 437 dbSNP
rs1344958851 445 dbSNP
rs1275555131 446 dbSNP
rs1202139266 451 dbSNP
rs1259706421 451 dbSNP
rs1438491407 457 dbSNP
rs905846937 458 dbSNP
rs1179422076 459 dbSNP
rs1242837756 461 dbSNP
rs1471844792 462 dbSNP
rs1333928241 465 dbSNP
rs554586111 466 dbSNP
rs879191034 471 dbSNP
rs1169195671 484 dbSNP
rs992861471 485 dbSNP
rs1402840126 486 dbSNP
rs1327889199 487 dbSNP
rs1335663658 494 dbSNP
rs752177154 499 dbSNP
rs1449550230 516 dbSNP
rs1245816245 518 dbSNP
rs1284319399 522 dbSNP
rs1360697568 523 dbSNP
rs1447268134 524 dbSNP
rs1280032316 527 dbSNP
rs1318330544 531 dbSNP
rs1011641780 537 dbSNP
rs1202863665 538 dbSNP
rs960285041 542 dbSNP
rs893233944 543 dbSNP
rs1402270487 545 dbSNP
rs1052900700 546 dbSNP
rs1212554280 549 dbSNP
rs1238079841 555 dbSNP
rs199510536 557 dbSNP
rs1469007773 558 dbSNP
rs536497753 559 dbSNP
rs150781832 564 dbSNP
rs3841297 564 dbSNP
rs397768375 564 dbSNP
rs139192890 575 dbSNP
rs1176219894 578 dbSNP
rs1479267256 578 dbSNP
rs1051007815 580 dbSNP
rs932583789 582 dbSNP
rs1231676638 583 dbSNP
rs1178350192 584 dbSNP
rs963222708 586 dbSNP
rs553971541 588 dbSNP
rs377647765 592 dbSNP
rs1004641439 594 dbSNP
rs962400439 597 dbSNP
rs1222642399 600 dbSNP
rs1272820438 609 dbSNP
rs1240486894 613 dbSNP
rs908300536 614 dbSNP
rs540840818 618 dbSNP
rs982975288 618 dbSNP
rs1030632481 619 dbSNP
rs1214612936 619 dbSNP
rs997218761 622 dbSNP
rs1488924929 625 dbSNP
rs1199366579 632 dbSNP
rs1376232408 633 dbSNP
rs900146894 634 dbSNP
rs1036295033 638 dbSNP
rs1172731837 640 dbSNP
rs1279357331 644 dbSNP
rs776412146 646 dbSNP
rs1299546507 649 dbSNP
rs1050103633 652 dbSNP
rs1360644629 659 dbSNP
rs1404209832 660 dbSNP
rs1321524764 664 dbSNP
rs1332542414 667 dbSNP
rs146198075 668 dbSNP
rs1275643431 670 dbSNP
rs763463747 672 dbSNP
rs1238011736 685 dbSNP
rs1288203548 692 dbSNP
rs1354527208 693 dbSNP
rs1209705442 697 dbSNP
rs1001013810 702 dbSNP
rs1453673269 708 dbSNP
rs182643161 711 dbSNP
rs1334504172 712 dbSNP
rs1451402503 713 dbSNP
rs1043249123 717 dbSNP
rs1053202219 720 dbSNP
rs1380317780 727 dbSNP
rs770670215 733 dbSNP
rs946173673 755 dbSNP
rs1398465214 768 dbSNP
rs1406681731 774 dbSNP
rs913500188 775 dbSNP
rs1327979031 777 dbSNP
rs191291953 779 dbSNP
rs1311754986 801 dbSNP
rs187007926 801 dbSNP
rs938720804 802 dbSNP
rs1377655311 807 dbSNP
rs927285080 808 dbSNP
rs1264182738 809 dbSNP
rs980246347 817 dbSNP
rs530380041 818 dbSNP
rs963440459 820 dbSNP
rs909264168 829 dbSNP
rs1180054975 836 dbSNP
rs1184838515 849 dbSNP
rs566233548 849 dbSNP
rs1037959866 854 dbSNP
rs1370083720 861 dbSNP
rs1458308553 862 dbSNP
rs1167283478 863 dbSNP
rs1397776522 864 dbSNP
rs1466995094 870 dbSNP
rs1333612520 871 dbSNP
rs1401363907 886 dbSNP
rs941026802 890 dbSNP
rs1310617442 899 dbSNP
rs950538838 903 dbSNP
rs182680080 906 dbSNP
rs997838589 911 dbSNP
rs939118064 912 dbSNP
rs964441331 913 dbSNP
rs1316446843 916 dbSNP
rs1258273634 929 dbSNP
rs928792808 929 dbSNP
rs1017695104 931 dbSNP
rs982026835 933 dbSNP
rs1198399430 939 dbSNP
rs970258545 947 dbSNP
rs1240761114 956 dbSNP
rs1192766004 957 dbSNP
rs1421474524 964 dbSNP
rs1171177374 966 dbSNP
rs1478672743 966 dbSNP
rs1355798960 967 dbSNP
rs1000494435 970 dbSNP
rs113372251 973 dbSNP
rs990436333 973 dbSNP
rs903623070 977 dbSNP
rs1227537165 981 dbSNP
rs957345651 984 dbSNP
rs1032111984 985 dbSNP
rs1220811002 992 dbSNP
rs370796609 992 dbSNP
rs1311995380 994 dbSNP
rs1230539774 998 dbSNP
rs998925777 998 dbSNP
rs1344059545 1000 dbSNP
rs1010438294 1001 dbSNP
rs1260896579 1002 dbSNP
rs1489207988 1010 dbSNP
rs997626368 1020 dbSNP
rs1424137459 1025 dbSNP
rs1431236759 1027 dbSNP
rs565010540 1030 dbSNP
rs762047695 1031 dbSNP
rs1379651592 1032 dbSNP
rs996635600 1033 dbSNP
rs1158160584 1037 dbSNP
rs1358733813 1042 dbSNP
rs776809869 1042 dbSNP
rs1299354706 1043 dbSNP
rs867109905 1048 dbSNP
rs941309482 1052 dbSNP
rs1302939137 1053 dbSNP
rs886756462 1054 dbSNP
rs1057408530 1058 dbSNP
rs1047184878 1063 dbSNP
rs1283203232 1063 dbSNP
rs1217166388 1072 dbSNP
rs939083981 1074 dbSNP
rs938925878 1075 dbSNP
rs927706737 1079 dbSNP
rs980587212 1090 dbSNP
rs948858501 1091 dbSNP
rs1454839582 1094 dbSNP
rs916111821 1102 dbSNP
rs543511259 1103 dbSNP
rs531333224 1108 dbSNP
rs560897914 1109 dbSNP
rs11626751 1110 dbSNP
rs1217481165 1111 dbSNP
rs861719 1113 dbSNP
rs1044795577 1119 dbSNP
rs1372210173 1120 dbSNP
rs977832526 1124 dbSNP
rs1306637459 1125 dbSNP
rs1378469228 1128 dbSNP
rs1240315821 1133 dbSNP
rs955442974 1136 dbSNP
rs1319901768 1144 dbSNP
rs942014628 1145 dbSNP
rs867312888 1147 dbSNP
rs572349717 1148 dbSNP
rs190440943 1156 dbSNP
rs575556824 1157 dbSNP
rs975906236 1161 dbSNP
rs1441606178 1166 dbSNP
rs1339467055 1167 dbSNP
rs577382170 1169 dbSNP
rs1278231836 1180 dbSNP
rs1422529778 1181 dbSNP
rs187092212 1182 dbSNP
rs183532035 1184 dbSNP
rs569959777 1190 dbSNP
rs1005397913 1191 dbSNP
rs1402078440 1192 dbSNP
rs1457882150 1197 dbSNP
rs370814214 1199 dbSNP
rs554990757 1203 dbSNP
rs967692963 1208 dbSNP
rs1283042516 1211 dbSNP
rs1350813076 1211 dbSNP
rs536499796 1223 dbSNP
rs1229907115 1231 dbSNP
rs1408388654 1234 dbSNP
rs149273084 1238 dbSNP
rs891999448 1239 dbSNP
rs939012265 1241 dbSNP
rs1459291885 1243 dbSNP
rs139843605 1250 dbSNP
rs749169392 1251 dbSNP
rs777739609 1254 dbSNP
rs547326176 1255 dbSNP
rs1419277856 1260 dbSNP
rs1488793751 1267 dbSNP
rs947811130 1272 dbSNP
rs548096845 1275 dbSNP
rs1202218935 1276 dbSNP
rs1044599610 1277 dbSNP
rs1316839437 1279 dbSNP
rs1258316435 1280 dbSNP
rs942057223 1282 dbSNP
rs532772920 1284 dbSNP
rs571845037 1285 dbSNP
rs755953011 1286 dbSNP
rs1216536142 1296 dbSNP
rs923341128 1297 dbSNP
rs58780994 1305 dbSNP
rs376090117 1306 dbSNP
rs776728141 1311 dbSNP
rs1445046093 1313 dbSNP
rs1400099890 1315 dbSNP
rs1171644640 1317 dbSNP
rs910488554 1323 dbSNP
rs560815636 1329 dbSNP
rs975448863 1330 dbSNP
rs964111583 1334 dbSNP
rs979326224 1335 dbSNP
rs1265727037 1340 dbSNP
rs967746633 1341 dbSNP
rs1020628917 1342 dbSNP
rs1422696586 1343 dbSNP
rs989143976 1345 dbSNP
rs1016692046 1353 dbSNP
rs987765943 1354 dbSNP
rs1173763495 1355 dbSNP
rs960743793 1356 dbSNP
rs1359382036 1357 dbSNP
rs1034744783 1362 dbSNP
rs1299966435 1363 dbSNP
rs370273020 1368 dbSNP
rs200724942 1369 dbSNP
rs1457141064 1372 dbSNP
rs112658461 1374 dbSNP
rs1006428260 1376 dbSNP
rs887992877 1377 dbSNP
rs1281063027 1381 dbSNP
rs1353099225 1386 dbSNP
rs1011973935 1393 dbSNP
rs1044768928 1393 dbSNP
rs1198660749 1393 dbSNP
rs1287040013 1393 dbSNP
rs1447928080 1393 dbSNP
rs552931513 1393 dbSNP
rs1047730381 1394 dbSNP
rs1193902315 1394 dbSNP
rs893566669 1395 dbSNP
rs1054589632 1396 dbSNP
rs1385641087 1396 dbSNP
rs1404515064 1396 dbSNP
rs936162806 1399 dbSNP
rs1313241789 1409 dbSNP
rs1332628185 1409 dbSNP
rs1304033686 1410 dbSNP
rs924835806 1412 dbSNP
rs1304453175 1416 dbSNP
rs1376585787 1420 dbSNP
rs929295513 1424 dbSNP
rs192156454 1427 dbSNP
rs1449213149 1445 dbSNP
rs1209802751 1449 dbSNP
rs1288110201 1452 dbSNP
rs1470110428 1453 dbSNP
rs1213925609 1474 dbSNP
rs922577442 1474 dbSNP
rs757089554 1476 dbSNP
rs1040441399 1478 dbSNP
rs370564578 1481 dbSNP
rs964060198 1481 dbSNP
rs1161400114 1484 dbSNP
rs909970196 1487 dbSNP
rs1466625392 1488 dbSNP
rs1326816188 1494 dbSNP
rs1399907880 1495 dbSNP
rs111808578 1497 dbSNP
rs1156740519 1502 dbSNP
rs77355286 1504 dbSNP
rs141329297 1505 dbSNP
rs951277229 1505 dbSNP
rs1025501154 1507 dbSNP
rs368005536 1509 dbSNP
rs386381426 1509 dbSNP
rs75291779 1509 dbSNP
rs768360445 1512 dbSNP
rs551441916 1519 dbSNP
rs1023272061 1531 dbSNP
rs1337390512 1531 dbSNP
rs1255066687 1533 dbSNP
rs910378895 1536 dbSNP
rs1256992425 1542 dbSNP
rs376551769 1545 dbSNP
rs1011921650 1547 dbSNP
rs1197203701 1548 dbSNP
rs754574439 1549 dbSNP
rs187229302 1553 dbSNP
rs1420013708 1558 dbSNP
rs878892018 1562 dbSNP
rs1475401512 1563 dbSNP
rs1483945173 1564 dbSNP
rs1258475862 1567 dbSNP
rs999311346 1568 dbSNP
rs1353646950 1572 dbSNP
rs903331327 1576 dbSNP
rs751049306 1590 dbSNP
rs543994653 1591 dbSNP
rs576528270 1596 dbSNP
rs180691060 1598 dbSNP
rs1357957866 1599 dbSNP
rs188480225 1599 dbSNP
rs76643119 1603 dbSNP
rs1039971904 1612 dbSNP
rs980541433 1617 dbSNP
rs1229071459 1622 dbSNP
rs1251600772 1633 dbSNP
rs942698739 1635 dbSNP
rs970672659 1640 dbSNP
rs1485936037 1641 dbSNP
rs1023093859 1642 dbSNP
rs984596258 1646 dbSNP
rs1404420628 1649 dbSNP
rs930096008 1653 dbSNP
rs1172784418 1654 dbSNP
rs1373904084 1658 dbSNP
rs75774651 1662 dbSNP
rs1171800364 1664 dbSNP
rs981973798 1667 dbSNP
rs1415871318 1669 dbSNP
rs1023552005 1670 dbSNP
rs148981395 1670 dbSNP
rs73279087 1675 dbSNP
rs750882572 1676 dbSNP
rs957678815 1676 dbSNP
rs1230652064 1686 dbSNP
rs999657842 1687 dbSNP
rs1367745807 1691 dbSNP
rs1347995428 1693 dbSNP
rs539296389 1695 dbSNP
rs993929786 1703 dbSNP
rs1486711506 1704 dbSNP
rs571959005 1709 dbSNP
rs1266443603 1714 dbSNP
rs1432767727 1715 dbSNP
rs1260344210 1716 dbSNP
rs1191998751 1721 dbSNP
rs1020833701 1727 dbSNP
rs1435484990 1729 dbSNP
rs998362837 1732 dbSNP
rs45508795 1735 dbSNP
rs1287378689 1737 dbSNP
rs901383877 1741 dbSNP
rs1219505146 1745 dbSNP
rs1039922518 1747 dbSNP
rs45470002 1752 dbSNP
rs10129944 1756 dbSNP
rs1245735802 1763 dbSNP
rs1371087858 1771 dbSNP
rs1342523893 1772 dbSNP
rs181358184 1775 dbSNP
rs1048405151 1779 dbSNP
rs1318609726 1780 dbSNP
rs1216437264 1783 dbSNP
rs1276315599 1783 dbSNP
rs548767656 1788 dbSNP
rs115375835 1789 dbSNP
rs1212047431 1795 dbSNP
rs1299959831 1796 dbSNP
rs1178156494 1797 dbSNP
rs1454750369 1797 dbSNP
rs559672610 1800 dbSNP
rs188755651 1802 dbSNP
rs1421351311 1806 dbSNP
rs1160488293 1808 dbSNP
rs1349595152 1809 dbSNP
rs1043586291 1813 dbSNP
rs1459085055 1818 dbSNP
rs529553307 1819 dbSNP
rs768743317 1825 dbSNP
rs1295895810 1830 dbSNP
rs949189356 1841 dbSNP
rs913837186 1842 dbSNP
rs533097795 1849 dbSNP
rs562439915 1850 dbSNP
rs990716421 1859 dbSNP
rs1275254378 1860 dbSNP
rs957958644 1861 dbSNP
rs1032394410 1865 dbSNP
rs1195911176 1865 dbSNP
rs1167497341 1875 dbSNP
rs1178279598 1875 dbSNP
rs139279146 1875 dbSNP
rs1474412405 1875 dbSNP
rs1481661568 1875 dbSNP
rs771517650 1880 dbSNP
rs1326446202 1881 dbSNP
rs939051086 1881 dbSNP
rs1355764795 1893 dbSNP
rs1267064680 1899 dbSNP
rs1210817455 1901 dbSNP
rs927651979 1905 dbSNP
rs1358671322 1918 dbSNP
rs1442374598 1919 dbSNP
rs3783649 1927 dbSNP
rs185137910 1928 dbSNP
rs772149119 1931 dbSNP
rs1030075043 1939 dbSNP
rs561451112 1946 dbSNP
rs1205371326 1949 dbSNP
rs1434147080 1950 dbSNP
rs1449654165 1951 dbSNP
rs1190713018 1954 dbSNP
rs1258571515 1957 dbSNP
rs1330482231 1962 dbSNP
rs952196603 1969 dbSNP
rs1165776599 1976 dbSNP
rs1421266642 1977 dbSNP
rs1323890007 1978 dbSNP
rs1026553878 1982 dbSNP
rs997251778 1983 dbSNP
rs3783648 1986 dbSNP
rs1436449004 1987 dbSNP
rs966479414 1994 dbSNP
rs536431338 1997 dbSNP
rs1428453809 2005 dbSNP
rs1007069295 2012 dbSNP
rs1364298213 2014 dbSNP
rs1170332721 2017 dbSNP
rs1018948340 2021 dbSNP
rs1345823345 2029 dbSNP
rs1246654982 2030 dbSNP
rs1007938319 2036 dbSNP
rs994177479 2037 dbSNP
rs1488153892 2040 dbSNP
rs889216384 2044 dbSNP
rs143050120 2045 dbSNP
rs1010766897 2046 dbSNP
rs892288796 2052 dbSNP
rs554246227 2055 dbSNP
rs1052823147 2060 dbSNP
rs1392653616 2070 dbSNP
rs1132399 2071 dbSNP
rs539029324 2072 dbSNP
rs906410005 2079 dbSNP
rs1132400 2081 dbSNP
rs578256473 2085 dbSNP
rs1132401 2087 dbSNP
rs1132402 2090 dbSNP
rs111263526 2093 dbSNP
rs909660093 2094 dbSNP
rs1398710256 2099 dbSNP
rs564683068 2102 dbSNP
rs1458400899 2108 dbSNP
rs1054977780 2110 dbSNP
rs1132405 2121 dbSNP
rs1431669060 2126 dbSNP
rs1132406 2127 dbSNP
rs1132407 2133 dbSNP
rs556877774 2136 dbSNP
rs1303033277 2139 dbSNP
rs1275154791 2140 dbSNP
rs1217551859 2141 dbSNP
rs1236650990 2147 dbSNP
rs936534765 2148 dbSNP
rs930847742 2149 dbSNP
rs544664685 2150 dbSNP
rs919431047 2151 dbSNP
rs538447829 2154 dbSNP
rs922955698 2155 dbSNP
rs1468483522 2157 dbSNP
rs1160230514 2159 dbSNP
rs975783558 2160 dbSNP
rs1404607229 2164 dbSNP
rs1325442814 2165 dbSNP
rs966325661 2166 dbSNP
rs1392601993 2167 dbSNP
rs1443416172 2170 dbSNP
rs1326607739 2173 dbSNP
rs1335263011 2175 dbSNP
rs964445339 2177 dbSNP
rs1351835925 2190 dbSNP
rs1233111796 2191 dbSNP
rs1270851995 2192 dbSNP
rs1447016076 2193 dbSNP
rs1469502105 2194 dbSNP
rs1491173233 2196 dbSNP
rs1018365393 2197 dbSNP
rs1402031372 2197 dbSNP
rs1491217181 2197 dbSNP
rs1183881911 2201 dbSNP
rs1019584784 2204 dbSNP
rs780905485 2205 dbSNP
rs1413400664 2213 dbSNP
rs747942754 2215 dbSNP
rs780983381 2218 dbSNP
rs754595578 2219 dbSNP
rs1456004870 2220 dbSNP
rs1165936159 2223 dbSNP
rs1027229150 2224 dbSNP
rs994853671 2226 dbSNP
rs1331435116 2230 dbSNP
rs1336913327 2237 dbSNP
rs953338561 2239 dbSNP
rs1291755615 2242 dbSNP
rs1337408817 2243 dbSNP
rs567730534 2248 dbSNP
rs1233517912 2249 dbSNP
rs1250469436 2250 dbSNP
rs1022415222 2251 dbSNP
rs1336851492 2256 dbSNP
rs746636983 2257 dbSNP
rs1485274934 2259 dbSNP
rs779455362 2261 dbSNP
rs1178444560 2264 dbSNP
rs757672609 2265 dbSNP
rs1259278821 2269 dbSNP
rs897135895 2270 dbSNP
rs1188496292 2274 dbSNP
rs1372769678 2278 dbSNP
rs1460502468 2284 dbSNP
rs1169685695 2292 dbSNP
rs1046850476 2296 dbSNP
rs892516295 2300 dbSNP
rs754571057 2301 dbSNP
rs139037824 2302 dbSNP
rs1415832190 2302 dbSNP
rs906470025 2311 dbSNP
rs1208350034 2312 dbSNP
rs1324276040 2312 dbSNP
rs1229179995 2315 dbSNP
rs1251328069 2317 dbSNP
rs750966014 2321 dbSNP
rs1279468637 2322 dbSNP
rs1208639525 2323 dbSNP
rs1282463724 2325 dbSNP
rs1485863976 2327 dbSNP
rs947753162 2331 dbSNP
rs75350177 2334 dbSNP
rs925137351 2341 dbSNP
rs1351463467 2347 dbSNP
rs1426914559 2357 dbSNP
rs192918723 2359 dbSNP
rs929730156 2360 dbSNP
rs1378916722 2364 dbSNP
rs1282063334 2365 dbSNP
rs143268417 2366 dbSNP
rs972270686 2372 dbSNP
rs1295935114 2374 dbSNP
rs1359216058 2375 dbSNP
rs532746962 2381 dbSNP
rs910297929 2387 dbSNP
rs944845011 2390 dbSNP
rs1231509998 2392 dbSNP
rs1305498311 2394 dbSNP
rs1348453276 2396 dbSNP
rs912169231 2396 dbSNP
rs1258678998 2399 dbSNP
rs986366744 2403 dbSNP
rs953390861 2406 dbSNP
rs1359189210 2409 dbSNP
rs1486762444 2413 dbSNP
rs1207105937 2415 dbSNP
rs764451148 2416 dbSNP
rs1022310562 2418 dbSNP
rs1230893191 2419 dbSNP
rs1410699155 2423 dbSNP
rs1191780411 2431 dbSNP
rs1396987992 2436 dbSNP
rs778419305 2439 dbSNP
rs1180300195 2440 dbSNP
rs1472619115 2443 dbSNP
rs1238072454 2445 dbSNP
rs541798570 2449 dbSNP
rs1362421788 2456 dbSNP
rs984537058 2457 dbSNP
rs1572611 2463 dbSNP
rs1393327923 2464 dbSNP
rs1487236451 2468 dbSNP
rs1285209701 2478 dbSNP
rs1031482413 2480 dbSNP
rs1397492385 2481 dbSNP
rs775731658 2487 dbSNP
rs1304856728 2489 dbSNP
rs767535017 2490 dbSNP
rs1239551781 2504 dbSNP
rs1272347838 2508 dbSNP
rs961942940 2509 dbSNP
rs149169223 2513 dbSNP
rs529109931 2524 dbSNP
rs1287526663 2530 dbSNP
rs1013591421 2537 dbSNP
rs1023587409 2547 dbSNP
rs1379485202 2554 dbSNP
rs1160312314 2560 dbSNP
rs1294518387 2570 dbSNP
rs145552124 2572 dbSNP
rs760745927 2572 dbSNP
rs1339349999 2578 dbSNP
rs1349942433 2578 dbSNP
rs540409631 2579 dbSNP
rs1296347847 2581 dbSNP
rs1375390987 2584 dbSNP
rs903664282 2587 dbSNP
rs1292382502 2589 dbSNP
rs1042628703 2598 dbSNP
rs1048056201 2603 dbSNP
rs945281498 2604 dbSNP
rs1163145203 2605 dbSNP
rs1404920079 2616 dbSNP
rs1370415890 2617 dbSNP
rs75379426 2620 dbSNP
rs896919868 2629 dbSNP
rs560545883 2633 dbSNP
rs1481880679 2644 dbSNP
rs943028972 2645 dbSNP
rs1041171881 2648 dbSNP
rs944919921 2666 dbSNP
rs1189594655 2669 dbSNP
rs912038354 2675 dbSNP
rs1194271617 2683 dbSNP
rs1050546854 2684 dbSNP
rs1409037908 2695 dbSNP
rs545451854 2702 dbSNP
rs1167643050 2703 dbSNP
rs76381329 2704 dbSNP
rs1244726508 2707 dbSNP
rs915468978 2713 dbSNP
rs1220561043 2714 dbSNP
rs556837951 2715 dbSNP
rs1312267497 2716 dbSNP
rs1353318071 2719 dbSNP
rs1321885047 2725 dbSNP
rs538108917 2731 dbSNP
rs1380109901 2732 dbSNP
rs1214233285 2736 dbSNP
rs1293455961 2736 dbSNP
rs1344416963 2737 dbSNP
rs533252518 2738 dbSNP
rs1280296335 2740 dbSNP
rs1213411947 2745 dbSNP
rs989501920 2747 dbSNP
rs956903428 2748 dbSNP
rs973317955 2751 dbSNP
rs1474843801 2752 dbSNP
rs533869444 2758 dbSNP
rs574186267 2762 dbSNP
rs1316709107 2769 dbSNP
rs982597488 2772 dbSNP
rs1373601573 2776 dbSNP
rs1436538435 2777 dbSNP
rs190441778 2779 dbSNP
rs1344405779 2780 dbSNP
rs557171568 2786 dbSNP
rs1292093171 2791 dbSNP
rs1012000567 2792 dbSNP
rs959341936 2794 dbSNP
rs1436193336 2801 dbSNP
rs1302803471 2810 dbSNP
rs1346275517 2822 dbSNP
rs1395765601 2824 dbSNP
rs748036371 2826 dbSNP
rs1328139717 2831 dbSNP
rs1213192290 2832 dbSNP
rs113991067 2833 dbSNP
rs1464308825 2834 dbSNP
rs1243538800 2835 dbSNP
rs1422948283 2836 dbSNP
rs1464932812 2839 dbSNP
rs776325705 2840 dbSNP
rs1192419446 2844 dbSNP
rs116219514 2848 dbSNP
rs1455492914 2857 dbSNP
rs1026834317 2866 dbSNP
rs1429623679 2868 dbSNP
rs1173098300 2874 dbSNP
rs1430168123 2886 dbSNP
rs867761814 2892 dbSNP
rs1000930624 2899 dbSNP
rs752714204 2901 dbSNP
rs993815741 2902 dbSNP
rs1190602270 2906 dbSNP
rs1316451905 2913 dbSNP
rs768450777 2917 dbSNP
rs1488682210 2918 dbSNP
rs1391051931 2927 dbSNP
rs1254701500 2928 dbSNP
rs746693048 2928 dbSNP
rs1325232999 2932 dbSNP
rs1368879119 2934 dbSNP
rs375405950 2945 dbSNP
rs1276020178 2946 dbSNP
rs1350384621 2948 dbSNP
rs1008388052 2953 dbSNP
rs1009810175 2963 dbSNP
rs1457056572 2967 dbSNP
rs1212701269 2971 dbSNP
rs10628679 2974 dbSNP
rs10692792 2977 dbSNP
rs1452903497 2979 dbSNP
rs386777723 2980 dbSNP
rs889512298 2985 dbSNP
rs150148557 2987 dbSNP
rs779723161 2990 dbSNP
rs1228995745 2993 dbSNP
rs1050599120 2995 dbSNP
rs1160031519 2998 dbSNP
rs1412446357 3002 dbSNP
rs932116572 3003 dbSNP
rs1164564025 3004 dbSNP
rs79228435 3007 dbSNP
rs757968298 3013 dbSNP
rs1040252326 3014 dbSNP
rs1372154350 3014 dbSNP
rs1054028011 3021 dbSNP
rs1444786835 3022 dbSNP
rs568487775 3026 dbSNP
rs767839364 3027 dbSNP
rs550858319 3036 dbSNP
rs923935134 3037 dbSNP
rs1049216526 3038 dbSNP
rs1357826766 3039 dbSNP
rs1209870553 3042 dbSNP
rs930375460 3045 dbSNP
rs1435945043 3046 dbSNP
rs919003799 3055 dbSNP
rs982096483 3057 dbSNP
rs1474791087 3060 dbSNP
rs971227714 3066 dbSNP
rs868190142 3069 dbSNP
rs971874678 3071 dbSNP
rs940171391 3090 dbSNP
rs745365088 3093 dbSNP
rs1175233988 3098 dbSNP
rs778333697 3103 dbSNP
rs990631804 3104 dbSNP
rs1371547330 3105 dbSNP
rs1414608303 3111 dbSNP
rs757765868 3112 dbSNP
rs568355925 3118 dbSNP
rs1341838586 3120 dbSNP
rs1026886495 3121 dbSNP
rs529138759 3125 dbSNP
rs1033648828 3128 dbSNP
rs1269007333 3136 dbSNP
rs1396605088 3146 dbSNP
rs1336958286 3148 dbSNP
rs1207195946 3154 dbSNP
rs1275321632 3160 dbSNP
rs994481716 3163 dbSNP
rs1485204071 3164 dbSNP
rs754331351 3167 dbSNP
rs1176575138 3175 dbSNP
rs1438618982 3176 dbSNP
rs114720589 3177 dbSNP
rs968116672 3179 dbSNP
rs1019708205 3182 dbSNP
rs1372577647 3192 dbSNP
rs1447800605 3196 dbSNP
rs1171011074 3199 dbSNP
rs1391372371 3202 dbSNP
rs1481973852 3208 dbSNP
rs546503675 3218 dbSNP
rs1396241826 3221 dbSNP
rs1317271750 3224 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_7 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||: || | ||||||| 
Target 5' --ucuACUCUU-UUUGCUGCUc 3'
1 - 19
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000247178.5 | 3UTR | UCUACUCUUUUUGCUGCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer 0.226 1.2e-2 0.203 2.1e-2 100 Click to see details
GSE19783 ER- ER- breast cancer 0.252 1.3e-2 0.238 1.7e-2 79 Click to see details
GSE14794 Lymphoblastoid cells -0.229 1.5e-2 -0.128 1.1e-1 90 Click to see details
GSE38226 Liver fibrosis 0.473 1.5e-2 0.498 1.1e-2 21 Click to see details
GSE21032 Prostate cancer 0.237 1.5e-2 0.176 5.6e-2 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.385 2.9e-2 0.305 6.9e-2 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.27 1.2e-1 0.304 9.6e-2 20 Click to see details
GSE28260 Renal cortex and medulla -0.337 1.3e-1 -0.253 2.0e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.29 1.4e-1 -0.191 2.4e-1 16 Click to see details
GSE19350 CNS germ cell tumors 0.262 2.1e-1 0.014 4.8e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells 0.18 2.1e-1 0.025 4.5e-1 23 Click to see details
GSE19783 ER+ ER+ breast cancer 0.177 2.3e-1 0.221 1.7e-1 20 Click to see details
GSE21849 B cell lymphoma 0.131 2.5e-1 0.340 3.6e-2 29 Click to see details
GSE28544 Breast cancer -0.143 2.5e-1 -0.173 2.1e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.137 2.6e-1 -0.088 3.4e-1 24 Click to see details
GSE21687 Ependynoma primary tumors 0.064 3.1e-1 0.120 1.7e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.034 4.3e-1 0.025 4.5e-1 32 Click to see details
GSE17306 Multiple myeloma 0.016 4.6e-1 0.055 3.5e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.02 4.6e-1 0.005 4.9e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.02 4.6e-1 0.005 4.9e-1 25 Click to see details
GSE17498 Multiple myeloma 0 5.0e-1 0.066 3.4e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.56 0 -0.612 0 32 Click to see details
PRAD -0.36 0.01 -0.438 0 50 Click to see details
PAAD 0.985 0.01 0.800 0.1 4 Click to see details
BLCA -0.464 0.03 -0.414 0.04 18 Click to see details
LUSC -0.28 0.04 -0.304 0.03 38 Click to see details
KIRP -0.263 0.07 -0.225 0.11 32 Click to see details
ESCA -0.448 0.08 -0.155 0.32 11 Click to see details
CHOL 0.378 0.16 0.417 0.13 9 Click to see details
COAD -0.27 0.26 -0.500 0.1 8 Click to see details
THCA -0.078 0.28 -0.084 0.26 59 Click to see details
HNSC -0.078 0.31 -0.091 0.28 42 Click to see details
BRCA -0.038 0.37 -0.115 0.15 84 Click to see details
PCPG 0.408 0.37 0.500 0.33 3 Click to see details
UCEC -0.079 0.37 -0.170 0.24 19 Click to see details
LUAD -0.066 0.42 -0.175 0.29 12 Click to see details
CESC 0.23 0.43 0.500 0.33 3 Click to see details
KIRC 0.022 0.43 0.008 0.47 68 Click to see details
KICH 0.015 0.47 0.028 0.45 25 Click to see details
LIHC -0.003 0.49 -0.061 0.34 49 Click to see details
LIHC -0.003 0.49 -0.061 0.34 49 Click to see details
LIHC -0.003 0.49 -0.061 0.34 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1